Regulog Crp - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2713 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - CRP
By effector - Cyclic 3',5'-AMP
By pathway - Carbon catabolism

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	286	150
Shewanella putrefaciens CN-32	317	165
Shewanella sp W3-18-1	316	164
Shewanella sp ANA-3	335	178
Shewanella sp MR-4	346	181
Shewanella sp MR-7	345	179
Shewanella baltica OS155	291	153
Shewanella denitrificans OS217	111	55
Shewanella frigidimarina NCIMB 400	233	120
Shewanella amazonensis SB2B	234	106
Shewanella loihica PV-4	235	126
Shewanella pealeana ATCC 700345	294	148
Shewanella halifaxensis HAW-EB4	310	162
Shewanella piezotolerans WP3	262	136
Shewanella sediminis HAW-EB3	281	144
Shewanella woodyi ATCC 51908	241	130

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
SO1419	* Shewanella oneidensis MR-1 Site: position = -117 score = 3.9475 sequence = AAGTGTTAGCTAACTCATAGAT Gene: SO1419: lipoprotein, putative	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	* Shewanella loihica PV-4 Site: position = -120 score = 4.46207 sequence = TTTTGTTAAGCAGATCAAAATA Gene: Shew_1972: lipoprotein, putative	* Shewanella pealeana ATCC 700345 Site: position = -120 score = 4.15776 sequence = TAGTGTTAACTGTGTCAAATAA Gene: Spea_2091: lipoprotein, putative	* Shewanella halifaxensis HAW-EB4 Site: position = -93 score = 4.09607 sequence = TTGTGTTAACTGCGTCAAATAA Gene: Shal_2064: lipoprotein, putative	* Shewanella piezotolerans WP3 Site: position = -119 score = 4.47596 sequence = AAATGTTATCTCTGTCAAACAA Gene: swp_2516: lipoprotein, putative	* Shewanella sediminis HAW-EB3 Site: position = -159 score = 4.20258 sequence = ATGTGTTAACTGGGTCAAATAT Gene: Ssed_2279: lipoprotein, putative	Shewanella woodyi ATCC 51908	lipoprotein, putative
SO1420	Shewanella oneidensis MR-1 Gene: SO1420: outer membrane porin, putative	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_2403: outer membrane porin, putative	Shewanella loihica PV-4 Gene: Shew_1973: outer membrane porin, putative	Shewanella pealeana ATCC 700345 Gene: Spea_2092: outer membrane porin, putative	Shewanella halifaxensis HAW-EB4 Gene: Shal_2065: outer membrane porin, putative	Shewanella piezotolerans WP3 Gene: swp_2517: outer membrane porin, putative	Shewanella sediminis HAW-EB3 Gene: Ssed_2278: outer membrane porin, putative	Shewanella woodyi ATCC 51908	outer membrane porin, putative

CRON 2.
SO1247	Shewanella oneidensis MR-1 Gene: SO1247: hypothetical protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_2807: hypothetical protein	Shewanella sp W3-18-1 Gene: Sputw3181_1205: hypothetical protein	Shewanella sp ANA-3 Gene: Shewana3_1063: hypothetical protein	* Shewanella sp MR-4 Site: position = -273 score = 4.28857 sequence = CAATGTGAGCTAGTTAACATCA Gene: Shewmr4_1059: hypothetical protein	* Shewanella sp MR-7 Site: position = -273 score = 4.28857 sequence = CAATGTGAGCTAGTTAACATCA Gene: Shewmr7_1131: hypothetical protein	* Shewanella baltica OS155 Site: position = -159 score = 3.83994 sequence = AATAGTGATCTTTCTCAGCATC Gene: Sbal_3204: hypothetical protein	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	* Shewanella amazonensis SB2B Site: position = -108 score = 3.79832 sequence = TCATGTGAGCCAGGTTAAAAAA Gene: Sama_0996: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_2789: hypothetical protein	* Shewanella pealeana ATCC 700345 Site: position = -187 score = 4.05502 sequence = TTTAGTGATGTTTTTTAGATTA Gene: Spea_3022: hypothetical protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_3112: hypothetical protein	Shewanella piezotolerans WP3 Gene: swp_1258: hypothetical protein	Shewanella sediminis HAW-EB3 Gene: Ssed_3352: hypothetical protein	* Shewanella woodyi ATCC 51908 Site: position = -312 score = 4.78872 sequence = TTTTGTGAATTGTATCACTTAT Gene: Swoo_3518: hypothetical protein	hypothetical protein

CRON 3.
fadD1	* Shewanella oneidensis MR-1 Site: position = -155 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: SO2581: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella putrefaciens CN-32 Site: position = -154 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: Sputcn32_1761: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella sp W3-18-1 Site: position = -154 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: Sputw3181_2264: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella sp ANA-3 Site: position = -155 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: Shewana3_2386: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella sp MR-4 Site: position = -155 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: Shewmr4_2177: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella sp MR-7 Site: position = -155 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: Shewmr7_2254: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella baltica OS155 Site: position = -156 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: Sbal_1864: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella denitrificans OS217 Site: position = -189 score = 4.12923 sequence = TTATGTGATTATGGGCCCAAAT Gene: Sden_1625: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella frigidimarina NCIMB 400 Site: position = -165 score = 4.70241 sequence = TTATGTGATTATGATCGAAAAT Gene: Sfri_1733: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella amazonensis SB2B Site: position = -140 score = 4.83629 sequence = TTATGTGATGATTGTCAAAAAT Gene: Sama_1934: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella loihica PV-4 Site: position = -149 score = 4.86581 sequence = TTGTGTGATGATGTTCAAAATT Gene: Shew_2188: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella pealeana ATCC 700345 Site: position = -156 score = 5.01352 sequence = TTATGTGATGATAATCAAAATT Gene: Spea_2448: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella halifaxensis HAW-EB4 Site: position = -155 score = 5.01352 sequence = TTATGTGATGATAATCAAAATT Gene: Shal_1832: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella piezotolerans WP3 Site: position = -153 score = 5.00694 sequence = ATATGTGATGATAATCAAAATT Gene: swp_2289: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella sediminis HAW-EB3 Site: position = -151 score = 5.02801 sequence = TTATGTGATGATGATCATAATT Gene: Ssed_2523: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	* Shewanella woodyi ATCC 51908 Site: position = -153 score = 5.07027 sequence = TTATGTGATGATGTTCAAAATT Gene: Swoo_2110: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)

CRON 4.
SO0971	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	* Shewanella pealeana ATCC 700345 Site: position = -161 score = 4.28008 sequence = TATCGATATCTGCCTCACATAT Gene: Spea_0741: hypothetical protein	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	hypothetical protein
SO0972	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_0740: methyltransferase type 12	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	SAM-dependent methyltransferases
SO0973	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_0739: hypothetical protein	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	hypothetical protein
Sputcn32_0834	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32 Gene: Sputcn32_0834: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	Shewanella sp W3-18-1 Gene: Sputw3181_3339: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	* Shewanella sp ANA-3 Site: position = -156 score = 4.19724 sequence = AAAGGTGACGAGTATAACAAAA Gene: Shewana3_0799: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	* Shewanella sp MR-4 Site: position = -156 score = 4.19724 sequence = AAAGGTGACGAGTATAACAAAA Gene: Shewmr4_3139: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	* Shewanella sp MR-7 Site: position = -156 score = 4.19724 sequence = AAAGGTGACGAGTATAACAAAA Gene: Shewmr7_0827: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	Shewanella baltica OS155 Gene: Sbal_0733: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	* Shewanella denitrificans OS217 Site: position = -175 score = 4.00133 sequence = TAATGTGATTGGTATAAGAACA Gene: Sden_3048: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0515: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	Shewanella amazonensis SB2B Gene: Sama_0606: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	Shewanella loihica PV-4 Gene: Shew_0783: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	Shewanella pealeana ATCC 700345 Gene: Spea_0738: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0791: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	* Shewanella piezotolerans WP3 Site: position = -322 score = 3.85784 sequence = TAATGCAATTGGTATTACAATA Gene: swp_4339: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	Shewanella sediminis HAW-EB3 Gene: Ssed_0821: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	* Shewanella woodyi ATCC 51908 Site: position = -67 score = 3.73566 sequence = TATTTTTACTTGCCTCAACTAA Gene: Swoo_0917: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)	ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
asnC	Shewanella oneidensis MR-1 Gene: SO3799: regulatory protein AsnC	Shewanella putrefaciens CN-32 Gene: Sputcn32_0833: regulatory protein AsnC	Shewanella sp W3-18-1 Gene: Sputw3181_3340: regulatory protein AsnC	Shewanella sp ANA-3 Gene: Shewana3_0798: regulatory protein AsnC	Shewanella sp MR-4 Gene: Shewmr4_3140: regulatory protein AsnC	Shewanella sp MR-7 Gene: Shewmr7_0826: regulatory protein AsnC	Shewanella baltica OS155 Gene: Sbal_0732: regulatory protein AsnC	Shewanella denitrificans OS217 Gene: Sden_3049: regulatory protein AsnC	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0514: regulatory protein AsnC	Shewanella amazonensis SB2B Gene: Sama_0605: regulatory protein AsnC	Shewanella loihica PV-4 Gene: Shew_0782: regulatory protein AsnC	* Shewanella pealeana ATCC 700345 Site: position = -7 score = 3.76387 sequence = ATTTATTATGGAAGTCCCATTT Gene: Spea_0737: regulatory protein AsnC	* Shewanella halifaxensis HAW-EB4 Site: position = -248 score = 3.81488 sequence = ATTTATAATGATAATCACAACT Gene: Shal_0790: regulatory protein AsnC	Shewanella piezotolerans WP3 Gene: swp_4340: regulatory protein AsnC	Shewanella sediminis HAW-EB3 Gene: Ssed_0820: regulatory protein AsnC	Shewanella woodyi ATCC 51908 Gene: Swoo_0916: regulatory protein AsnC	regulatory protein AsnC

CRON 5.
Sputcn32_0312	Shewanella oneidensis MR-1	* Shewanella putrefaciens CN-32 Site: position = -99 score = 4.31656 sequence = AAGTGTGATGCTGGTCAATAAA Gene: Sputcn32_0312: hypothetical protein	* Shewanella sp W3-18-1 Site: position = -99 score = 4.24289 sequence = AAGTGTGATACTGGTCAATAAA Gene: Sputw3181_3896: hypothetical protein	* Shewanella sp ANA-3 Site: position = -99 score = 5.23204 sequence = AAATGTGATCTATGTCAAAAAA Gene: Shewana3_3963: hypothetical protein	* Shewanella sp MR-4 Site: position = -99 score = 5.23204 sequence = AAATGTGATCTATGTCAAAAAA Gene: Shewmr4_3765: hypothetical protein	* Shewanella sp MR-7 Site: position = -99 score = 5.19373 sequence = AAATGTGATCTGTGTCAAAAAA Gene: Shewmr7_3838: hypothetical protein	* Shewanella baltica OS155 Site: position = -97 score = 5.20192 sequence = AAATGTGATCGTGTTCAAAAAA Gene: Sbal_0180: hypothetical protein	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -115 score = 3.65375 sequence = TTAATTGATTACGATCAATTTA Gene: Sfri_0616: hypothetical protein	* Shewanella amazonensis SB2B Site: position = -285 score = 4.06654 sequence = AAAAGAGACTTAGATCATATTT Gene: Sama_2901: hypothetical protein	* Shewanella loihica PV-4 Site: position = -286 score = 3.87265 sequence = AAAATAGATCTTGATCATATTT Gene: Shew_3155: hypothetical protein	* Shewanella pealeana ATCC 700345 Site: position = -127 score = 3.40276 sequence = TTTTATGATGAATAAAACGTTC Gene: Spea_3968: hypothetical protein	* Shewanella halifaxensis HAW-EB4 Site: position = -100 score = 3.62988 sequence = ATAATTGATTTGTATCAATGTT Gene: Shal_0300: hypothetical protein	* Shewanella piezotolerans WP3 Site: position = -97 score = 3.34695 sequence = TTATATAATGATTTTTATATTT Gene: swp_4118: hypothetical protein	* Shewanella sediminis HAW-EB3 Site: position = -100 score = 4.06844 sequence = TTGTTTGATTTAAATCAAGGTT Gene: Ssed_0240: hypothetical protein	* Shewanella woodyi ATCC 51908 Site: position = -92 score = 3.98241 sequence = TAACTTGATTTGAATCAATATT Gene: Swoo_0239: hypothetical protein	hypothetical protein
nrfB	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32 Gene: Sputcn32_0313: Cytochrome c-type protein NrfB precursor	Shewanella sp W3-18-1 Gene: Sputw3181_3895: Cytochrome c-type protein NrfB precursor	Shewanella sp ANA-3 Gene: Shewana3_3962: Cytochrome c-type protein NrfB precursor	Shewanella sp MR-4 Gene: Shewmr4_3764: Cytochrome c-type protein NrfB precursor	Shewanella sp MR-7 Gene: Shewmr7_3837: Cytochrome c-type protein NrfB precursor	Shewanella baltica OS155 Gene: Sbal_0181: Cytochrome c-type protein NrfB precursor	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0615: Cytochrome c-type protein NrfB precursor	Shewanella amazonensis SB2B Gene: Sama_2902: Cytochrome c-type protein NrfB precursor	Shewanella loihica PV-4 Gene: Shew_3156: Cytochrome c-type protein NrfB precursor	Shewanella pealeana ATCC 700345 Gene: Spea_3967: Cytochrome c-type protein NrfB precursor	Shewanella halifaxensis HAW-EB4 Gene: Shal_0301: Cytochrome c-type protein NrfB precursor	Shewanella piezotolerans WP3 Gene: swp_4117: Cytochrome c-type protein NrfB precursor	Shewanella sediminis HAW-EB3 Gene: Ssed_0241: Cytochrome c-type protein NrfB precursor	Shewanella woodyi ATCC 51908 Gene: Swoo_0240: Cytochrome c-type protein NrfB precursor	Cytochrome c-type protein NrfB precursor
nrfC	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32 Gene: Sputcn32_0314: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	Shewanella sp W3-18-1 Gene: Sputw3181_3894: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	Shewanella sp ANA-3 Gene: Shewana3_3961: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	Shewanella sp MR-4 Gene: Shewmr4_3763: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	Shewanella sp MR-7 Gene: Shewmr7_3836: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	Shewanella baltica OS155 Gene: Sbal_0182: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0614: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	Shewanella amazonensis SB2B Gene: Sama_2903: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	Shewanella loihica PV-4 Gene: Shew_3157: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	Shewanella pealeana ATCC 700345 Gene: Spea_3966: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_0302: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	Shewanella piezotolerans WP3 Gene: swp_4116: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	Shewanella sediminis HAW-EB3 Gene: Ssed_0242: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	Shewanella woodyi ATCC 51908 Gene: Swoo_0241: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein	4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
nrfD-2	Shewanella oneidensis MR-1 Gene: SO4568: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella putrefaciens CN-32 Gene: Sputcn32_0315: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella sp W3-18-1 Gene: Sputw3181_3893: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella sp ANA-3 Gene: Shewana3_3960: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella sp MR-4 Gene: Shewmr4_3762: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella sp MR-7 Gene: Shewmr7_3835: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella baltica OS155 Gene: Sbal_0183: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0613: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella amazonensis SB2B Gene: Sama_2904: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella loihica PV-4 Gene: Shew_3158: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella pealeana ATCC 700345 Gene: Spea_3965: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella halifaxensis HAW-EB4 Gene: Shal_0303: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella piezotolerans WP3 Gene: swp_4115: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella sediminis HAW-EB3 Gene: Ssed_0243: nitrite reductase, quinol dehydrogenase component, NrfD	Shewanella woodyi ATCC 51908 Gene: Swoo_0242: nitrite reductase, quinol dehydrogenase component, NrfD	nitrite reductase, quinol dehydrogenase component, NrfD
SO4570	* Shewanella oneidensis MR-1 Site: position = -207 score = 4.40356 sequence = ATTTGTGAGCTAGTTAGAATTA Gene: SO4570: conserved domain protein	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	conserved domain protein

CRON 6.
hyaA	* Shewanella oneidensis MR-1 Site: position = -105 score = 3.97644 sequence = ATTCTTGATATGCATCAATAAT Gene: SO2099: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	* Shewanella putrefaciens CN-32 Site: position = -167 score = 3.70145 sequence = AAATTAGATCTGCGTCATGTTA Site: position = -107 score = 4.01474 sequence = ATTCTTGATATACATCAATAAT Gene: Sputcn32_2088: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	* Shewanella sp W3-18-1 Site: position = -167 score = 3.70145 sequence = AAATTAGATCTGCGTCATGTTA Site: position = -107 score = 4.01474 sequence = ATTCTTGATATACATCAATAAT Gene: Sputw3181_1924: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	* Shewanella sp ANA-3 Site: position = -166 score = 3.91857 sequence = AAATTAGATCTGCATCATGTTA Site: position = -106 score = 4.17166 sequence = ATTCTTGATATGCATCAAGAAT Gene: Shewana3_1880: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	* Shewanella sp MR-4 Site: position = -166 score = 3.91857 sequence = AAATTAGATCTGCATCATGTTA Site: position = -106 score = 4.17166 sequence = ATTCTTGATATGCATCAAGAAT Gene: Shewmr4_1822: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	* Shewanella sp MR-7 Site: position = -166 score = 3.91857 sequence = AAATTAGATCTGCATCATGTTA Site: position = -106 score = 4.17166 sequence = ATTCTTGATATGCATCAAGAAT Gene: Shewmr7_2155: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	* Shewanella baltica OS155 Site: position = -107 score = 4.20997 sequence = ATTCTTGATATACATCAAGAAT Site: position = -229 score = 3.92975 sequence = TTAAGTGACCGATTTCATCCAA Site: position = -167 score = 3.73976 sequence = AAATTAGATCTACGTCATGTTA Gene: Sbal_1889: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -174 score = 3.76852 sequence = TTTTGTTAACTTGATCAACATC Site: position = -168 score = 4.36595 sequence = TAACTTGATCAACATCATAAAT Gene: Sfri_2103: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	* Shewanella amazonensis SB2B Site: position = -172 score = 3.44118 sequence = AAGCATGACACACCTCATGTTA Gene: Sama_1679: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	* Shewanella loihica PV-4 Site: position = -164 score = 3.80383 sequence = AAACTTGATCCAGCTCATAGCT Site: position = -103 score = 3.70832 sequence = AATGTTGACATACATCAACATT Gene: Shew_1765: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	* Shewanella pealeana ATCC 700345 Site: position = -211 score = 4.63119 sequence = TTACGTGACCACGATCACCTTT Gene: Spea_2033: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	* Shewanella halifaxensis HAW-EB4 Site: position = -212 score = 5.04352 sequence = TTACGTGATCTCCATCACCTTT Gene: Shal_2261: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	Shewanella piezotolerans WP3 Gene: swp_2639: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	* Shewanella sediminis HAW-EB3 Site: position = -162 score = 3.97894 sequence = AAAGATGATCTAGTTCATATTG Gene: Ssed_1908: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)	Shewanella woodyi ATCC 51908	Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
hyaB	Shewanella oneidensis MR-1 Gene: SO2098: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella putrefaciens CN-32 Gene: Sputcn32_2089: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella sp W3-18-1 Gene: Sputw3181_1923: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella sp ANA-3 Gene: Shewana3_1879: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella sp MR-4 Gene: Shewmr4_1821: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella sp MR-7 Gene: Shewmr7_2156: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella baltica OS155 Gene: Sbal_1888: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2104: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella amazonensis SB2B Gene: Sama_1678: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella loihica PV-4 Gene: Shew_1764: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella pealeana ATCC 700345 Gene: Spea_2032: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella halifaxensis HAW-EB4 Gene: Shal_2262: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella piezotolerans WP3 Gene: swp_2640: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella sediminis HAW-EB3 Gene: Ssed_1907: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)	Shewanella woodyi ATCC 51908	Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
hydC	Shewanella oneidensis MR-1 Gene: SO2097: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella putrefaciens CN-32 Gene: Sputcn32_2090: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella sp W3-18-1 Gene: Sputw3181_1922: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella sp ANA-3 Gene: Shewana3_1878: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella sp MR-4 Gene: Shewmr4_1820: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella sp MR-7 Gene: Shewmr7_2157: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella baltica OS155 Gene: Sbal_1887: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2105: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella amazonensis SB2B Gene: Sama_1677: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella loihica PV-4 Gene: Shew_1763: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella pealeana ATCC 700345 Gene: Spea_2031: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella halifaxensis HAW-EB4 Gene: Shal_2263: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella piezotolerans WP3 Gene: swp_2641: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella sediminis HAW-EB3 Gene: Ssed_1906: Ni,Fe-hydrogenase I cytochrome b subunit	Shewanella woodyi ATCC 51908	Ni,Fe-hydrogenase I cytochrome b subunit
hyaD	Shewanella oneidensis MR-1 Gene: SO2096: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella putrefaciens CN-32 Gene: Sputcn32_2091: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella sp W3-18-1 Gene: Sputw3181_1921: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella sp ANA-3 Gene: Shewana3_1877: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella sp MR-4 Gene: Shewmr4_1819: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella sp MR-7 Gene: Shewmr7_2158: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella baltica OS155 Gene: Sbal_1886: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2106: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella amazonensis SB2B Gene: Sama_1676: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella loihica PV-4 Gene: Shew_1762: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella pealeana ATCC 700345 Gene: Spea_2030: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella halifaxensis HAW-EB4 Gene: Shal_2264: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella piezotolerans WP3 Gene: swp_2642: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella sediminis HAW-EB3 Gene: Ssed_1905: Hydrogenase maturation protease (EC 3.4.24.-)	Shewanella woodyi ATCC 51908	Hydrogenase maturation protease (EC 3.4.24.-)
hyaE	Shewanella oneidensis MR-1 Gene: SO2095: NiFe hydrogenase assembly chaperone, HyaE	Shewanella putrefaciens CN-32 Gene: Sputcn32_2092: NiFe hydrogenase assembly chaperone, HyaE	Shewanella sp W3-18-1 Gene: Sputw3181_1920: NiFe hydrogenase assembly chaperone, HyaE	Shewanella sp ANA-3 Gene: Shewana3_1876: NiFe hydrogenase assembly chaperone, HyaE	Shewanella sp MR-4 Gene: Shewmr4_1818: NiFe hydrogenase assembly chaperone, HyaE	Shewanella sp MR-7 Gene: Shewmr7_2159: NiFe hydrogenase assembly chaperone, HyaE	Shewanella baltica OS155 Gene: Sbal_1885: NiFe hydrogenase assembly chaperone, HyaE	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2107: NiFe hydrogenase assembly chaperone, HyaE	Shewanella amazonensis SB2B Gene: Sama_1675: NiFe hydrogenase assembly chaperone, HyaE	Shewanella loihica PV-4 Gene: Shew_1761: NiFe hydrogenase assembly chaperone, HyaE	Shewanella pealeana ATCC 700345 Gene: Spea_2029: NiFe hydrogenase assembly chaperone, HyaE	Shewanella halifaxensis HAW-EB4 Gene: Shal_2265: NiFe hydrogenase assembly chaperone, HyaE	Shewanella piezotolerans WP3 Gene: swp_2643: NiFe hydrogenase assembly chaperone, HyaE	Shewanella sediminis HAW-EB3 Gene: Ssed_1904: NiFe hydrogenase assembly chaperone, HyaE	Shewanella woodyi ATCC 51908	NiFe hydrogenase assembly chaperone, HyaE
hyaF	Shewanella oneidensis MR-1 Gene: SO2094: NiFe hydrogenase assembly protein, HypF	Shewanella putrefaciens CN-32 Gene: Sputcn32_2093: NiFe hydrogenase assembly protein, HypF	Shewanella sp W3-18-1 Gene: Sputw3181_1919: NiFe hydrogenase assembly protein, HypF	Shewanella sp ANA-3 Gene: Shewana3_1875: NiFe hydrogenase assembly protein, HypF	Shewanella sp MR-4 Gene: Shewmr4_1817: NiFe hydrogenase assembly protein, HypF	Shewanella sp MR-7 Gene: Shewmr7_2160: NiFe hydrogenase assembly protein, HypF	Shewanella baltica OS155 Gene: Sbal_1884: NiFe hydrogenase assembly protein, HypF	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2108: NiFe hydrogenase assembly protein, HypF	Shewanella amazonensis SB2B Gene: Sama_1674: NiFe hydrogenase assembly protein, HypF	Shewanella loihica PV-4 Gene: Shew_1760: NiFe hydrogenase assembly protein, HypF	Shewanella pealeana ATCC 700345 Gene: Spea_2028: NiFe hydrogenase assembly protein, HypF	Shewanella halifaxensis HAW-EB4 Gene: Shal_2266: NiFe hydrogenase assembly protein, HypF	Shewanella piezotolerans WP3 Gene: swp_2644: NiFe hydrogenase assembly protein, HypF	Shewanella sediminis HAW-EB3 Gene: Ssed_1903: NiFe hydrogenase assembly protein, HypF	Shewanella woodyi ATCC 51908	NiFe hydrogenase assembly protein, HypF

CRON 7.
mtrC	* Shewanella oneidensis MR-1 Site: position = -190 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Site: position = -248 score = 3.6914 sequence = TGTTGTTTTTTTGCTCTCAATT Gene: SO1778: surface localized decaheme cytochrome c lipoprotein, MtrC	* Shewanella putrefaciens CN-32 Site: position = -190 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Gene: Sputcn32_1478: surface localized decaheme cytochrome c lipoprotein, MtrC	* Shewanella sp W3-18-1 Site: position = -190 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Gene: Sputw3181_2623: surface localized decaheme cytochrome c lipoprotein, MtrC	* Shewanella sp ANA-3 Site: position = -189 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Gene: Shewana3_2676: surface localized decaheme cytochrome c lipoprotein, MtrC	* Shewanella sp MR-4 Site: position = -189 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Gene: Shewmr4_2510: surface localized decaheme cytochrome c lipoprotein, MtrC	* Shewanella sp MR-7 Site: position = -189 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Gene: Shewmr7_2578: surface localized decaheme cytochrome c lipoprotein, MtrC	* Shewanella baltica OS155 Site: position = -190 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Gene: Sbal_1589: surface localized decaheme cytochrome c lipoprotein, MtrC	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -164 score = 3.7709 sequence = TAGGCTGATCATCATCACACAA Gene: Sfri_2637: surface localized decaheme cytochrome c lipoprotein, MtrC	* Shewanella amazonensis SB2B Site: position = -230 score = 3.85699 sequence = TTTTTTGATCTGAAACAGCTTT Site: position = -178 score = 3.63907 sequence = TAGCCGGATCCAGTTCACACAT Gene: Sama_1208: surface localized decaheme cytochrome c lipoprotein, MtrC	* Shewanella loihica PV-4 Site: position = -179 score = 3.59173 sequence = TAGAAAGATCTCGGTCACACAT Gene: Shew_2525: surface localized decaheme cytochrome c lipoprotein, MtrC	Shewanella pealeana ATCC 700345 Gene: Spea_2698: surface localized decaheme cytochrome c lipoprotein, MtrC	* Shewanella halifaxensis HAW-EB4 Site: position = -264 score = 4.00452 sequence = TTTTATTACATTTATCACGTAT Gene: Shal_2784: surface localized decaheme cytochrome c lipoprotein, MtrC	Shewanella piezotolerans WP3 Gene: swp_3278: surface localized decaheme cytochrome c lipoprotein, MtrC	* Shewanella sediminis HAW-EB3 Site: position = -191 score = 4.01918 sequence = TAGGCTGATCTAGGTCACACAT Gene: Ssed_1525: surface localized decaheme cytochrome c lipoprotein, MtrC	* Shewanella woodyi ATCC 51908 Site: position = -288 score = 3.71936 sequence = ATGAGTTACAACTTTCACACAT Gene: Swoo_3125: surface localized decaheme cytochrome c lipoprotein, MtrC	surface localized decaheme cytochrome c lipoprotein, MtrC
mtrA	Shewanella oneidensis MR-1 Gene: SO1777: periplasmic decaheme cytochrome c, MtrA	Shewanella putrefaciens CN-32 Gene: Sputcn32_1477: periplasmic decaheme cytochrome c, MtrA	Shewanella sp W3-18-1 Gene: Sputw3181_2624: periplasmic decaheme cytochrome c, MtrA	Shewanella sp ANA-3 Gene: Shewana3_2677: periplasmic decaheme cytochrome c, MtrA	Shewanella sp MR-4 Gene: Shewmr4_2511: periplasmic decaheme cytochrome c, MtrA	Shewanella sp MR-7 Gene: Shewmr7_2579: periplasmic decaheme cytochrome c, MtrA	Shewanella baltica OS155 Gene: Sbal_1588: periplasmic decaheme cytochrome c, MtrA	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2638: periplasmic decaheme cytochrome c, MtrA	Shewanella amazonensis SB2B Gene: Sama_1207: periplasmic decaheme cytochrome c, MtrA	Shewanella loihica PV-4 Gene: Shew_2526: periplasmic decaheme cytochrome c, MtrA	Shewanella pealeana ATCC 700345 Gene: Spea_2699: periplasmic decaheme cytochrome c, MtrA	Shewanella halifaxensis HAW-EB4 Gene: Shal_2785: periplasmic decaheme cytochrome c, MtrA	Shewanella piezotolerans WP3 Gene: swp_3279: periplasmic decaheme cytochrome c, MtrA	Shewanella sediminis HAW-EB3 Gene: Ssed_1524: periplasmic decaheme cytochrome c, MtrA	Shewanella woodyi ATCC 51908 Gene: Swoo_3126: periplasmic decaheme cytochrome c, MtrA	periplasmic decaheme cytochrome c, MtrA
mtrB	Shewanella oneidensis MR-1 Gene: SO1776: outer membrane protein, MtrB	Shewanella putrefaciens CN-32 Gene: Sputcn32_1476: outer membrane protein, MtrB	Shewanella sp W3-18-1 Gene: Sputw3181_2625: outer membrane protein, MtrB	Shewanella sp ANA-3 Gene: Shewana3_2678: outer membrane protein, MtrB	Shewanella sp MR-4 Gene: Shewmr4_2512: outer membrane protein, MtrB	Shewanella sp MR-7 Gene: Shewmr7_2580: outer membrane protein, MtrB	Shewanella baltica OS155 Gene: Sbal_1587: outer membrane protein, MtrB	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2639: outer membrane protein, MtrB	Shewanella amazonensis SB2B Gene: Sama_1206: outer membrane protein, MtrB	Shewanella loihica PV-4 Gene: Shew_2527: outer membrane protein, MtrB	Shewanella pealeana ATCC 700345 Gene: Spea_2700: outer membrane protein, MtrB	Shewanella halifaxensis HAW-EB4 Gene: Shal_2786: outer membrane protein, MtrB	Shewanella piezotolerans WP3 Gene: swp_3280: outer membrane protein, MtrB	Shewanella sediminis HAW-EB3 Gene: Ssed_1523: outer membrane protein, MtrB	Shewanella woodyi ATCC 51908 Gene: Swoo_3127: outer membrane protein, MtrB	outer membrane protein, MtrB

CRON 8.
SO0939	* Shewanella oneidensis MR-1 Site: position = -382 score = 4.3436 sequence = TACTGTGATCCCGTTAACCCAA Site: position = -217 score = 4.55008 sequence = TATCGTGCCTTCGCTCACATTA Gene: SO0939: split-soret diheme cytochrome c	* Shewanella putrefaciens CN-32 Site: position = -388 score = 4.40149 sequence = TACTGTGATCTTGCTAACCCAA Gene: Sputcn32_0879: split-soret diheme cytochrome c	* Shewanella sp W3-18-1 Site: position = -388 score = 4.40149 sequence = TACTGTGATCTTGCTAACCCAA Site: position = -253 score = 3.48068 sequence = AAATGGATTTAAATTCACATAA Gene: Sputw3181_3294: split-soret diheme cytochrome c	* Shewanella sp ANA-3 Site: position = -217 score = 3.77595 sequence = TAATGTGCGCTGCCGCAAATTG Site: position = -384 score = 4.3436 sequence = TACTGTGATCCCGTTAACCCAA Gene: Shewana3_3344: split-soret diheme cytochrome c	* Shewanella sp MR-4 Site: position = -383 score = 4.3436 sequence = TACTGTGATCCCGTTAACCCAA Site: position = -217 score = 4.04131 sequence = TAATGTGCGTTGATGCACATTG Gene: Shewmr4_0782: split-soret diheme cytochrome c	* Shewanella sp MR-7 Site: position = -383 score = 4.3436 sequence = TACTGTGATCCCGTTAACCCAA Site: position = -217 score = 3.86944 sequence = TAATGTGCGCAGGCACACATTG Gene: Shewmr7_3241: split-soret diheme cytochrome c	Shewanella baltica OS155	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -147 score = 4.43897 sequence = TTATCTGCTTTGAATCACATTT Site: position = -325 score = 4.52262 sequence = ATTTGTGAGCGATATCACGTCA Gene: Sfri_3633: split-soret diheme cytochrome c	* Shewanella amazonensis SB2B Site: position = -297 score = 3.9359 sequence = AATTGTGATATTGAACAATATG Gene: Sama_2750: split-soret diheme cytochrome c	* Shewanella loihica PV-4 Site: position = -246 score = 4.11479 sequence = TAGAGTGATCAGCTTCACATCG Gene: Shew_0759: split-soret diheme cytochrome c	* Shewanella pealeana ATCC 700345 Site: position = -327 score = 4.02021 sequence = AAATGAGACGTTAGTCACACTC Site: position = -249 score = 4.53098 sequence = TAATGTGACATCGTTCATGAAA Gene: Spea_3437: split-soret diheme cytochrome c	* Shewanella halifaxensis HAW-EB4 Site: position = -328 score = 4.17432 sequence = AAATGAGAGGTTAATCACACAG Site: position = -250 score = 4.69242 sequence = TAATGTGCTATCGGTCACAGAA Gene: Shal_3518: split-soret diheme cytochrome c	Shewanella piezotolerans WP3	* Shewanella sediminis HAW-EB3 Site: position = -349 score = 4.10731 sequence = TTTTGCGAACAAAATCACACTG Gene: Ssed_0882: split-soret diheme cytochrome c	* Shewanella woodyi ATCC 51908 Site: position = -250 score = 4.48942 sequence = TAACATGATCCAGCTCACCATT Site: position = -337 score = 3.74538 sequence = GTTTGCGAAGAGGATCACATTG Gene: Swoo_0884: split-soret diheme cytochrome c	split-soret diheme cytochrome c
SO0938	Shewanella oneidensis MR-1 Gene: SO0938: hypothetical protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_0878: hypothetical protein	Shewanella sp W3-18-1 Gene: Sputw3181_3295: hypothetical protein	Shewanella sp ANA-3 Gene: Shewana3_3345: hypothetical protein	Shewanella sp MR-4 Gene: Shewmr4_0781: hypothetical protein	Shewanella sp MR-7 Gene: Shewmr7_3242: hypothetical protein	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3634: hypothetical protein	Shewanella amazonensis SB2B Gene: Sama_2751: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_0758: hypothetical protein	Shewanella pealeana ATCC 700345 Gene: Spea_3436: hypothetical protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_3517: hypothetical protein	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_0881: hypothetical protein	Shewanella woodyi ATCC 51908 Gene: Swoo_0883: hypothetical protein	hypothetical protein

CRON 9.
SO3119	* Shewanella oneidensis MR-1 Site: position = -166 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: SO3119: hypothetical protein	* Shewanella putrefaciens CN-32 Site: position = -171 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: Sputcn32_2489: hypothetical protein	* Shewanella sp W3-18-1 Site: position = -171 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: Sputw3181_1519: hypothetical protein	* Shewanella sp ANA-3 Site: position = -171 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: Shewana3_1429: hypothetical protein	* Shewanella sp MR-4 Site: position = -171 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: Shewmr4_1376: hypothetical protein	* Shewanella sp MR-7 Site: position = -171 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: Shewmr7_1441: hypothetical protein	* Shewanella baltica OS155 Site: position = -171 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: Sbal_2792: hypothetical protein	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	* Shewanella amazonensis SB2B Site: position = -151 score = 4.4095 sequence = AATAGTGATTAAGCTCGCGTTT Gene: Sama_2198: hypothetical protein	Shewanella loihica PV-4	* Shewanella pealeana ATCC 700345 Site: position = -148 score = 4.0596 sequence = GAAAGTGATTTATATCGCGTTT Gene: Spea_1466: hypothetical protein	* Shewanella halifaxensis HAW-EB4 Site: position = -148 score = 4.0596 sequence = GAAAGTGATTTATATCGCGTTT Gene: Shal_1549: hypothetical protein	* Shewanella piezotolerans WP3 Site: position = -220 score = 3.76309 sequence = GAAAGTGACTTAAATCGCGTTT Gene: swp_1671: hypothetical protein	* Shewanella sediminis HAW-EB3 Site: position = -173 score = 4.73553 sequence = TAAAGTGATTTAGATCGCGTTT Gene: Ssed_2897: hypothetical protein	* Shewanella woodyi ATCC 51908 Site: position = -148 score = 4.42972 sequence = TTAAGTGACTTAGATCGCGTTT Gene: Swoo_1750: hypothetical protein	hypothetical protein

CRON 10.
mtrD	* Shewanella oneidensis MR-1 Site: position = -339 score = 3.80688 sequence = TTATGTGACAAAAATCTCTATG Gene: SO1782: periplasmic decaheme cytochrome c, MtrD	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	* Shewanella sp ANA-3 Site: position = -295 score = 4.35955 sequence = TTATGTGACAAAAATCTCAATG Site: position = -172 score = 4.26694 sequence = AAGTGAGAACAAGATCACACTT Gene: Shewana3_2672: periplasmic decaheme cytochrome c, MtrD	* Shewanella sp MR-4 Site: position = -295 score = 4.35955 sequence = TTATGTGACAAAAATCTCAATG Site: position = -172 score = 4.26694 sequence = AAGTGAGAACAAGATCACACTT Gene: Shewmr4_2506: periplasmic decaheme cytochrome c, MtrD	* Shewanella sp MR-7 Site: position = -295 score = 4.35955 sequence = TTATGTGACAAAAATCTCAATG Site: position = -172 score = 4.26694 sequence = AAGTGAGAACAAGATCACACTT Gene: Shewmr7_2574: periplasmic decaheme cytochrome c, MtrD	* Shewanella baltica OS155 Site: position = -304 score = 3.76559 sequence = TTATGTGACAAAAATACCAATG Site: position = -181 score = 4.77529 sequence = AAACGTGATCAACATCACGCTT Gene: Sbal_1593: periplasmic decaheme cytochrome c, MtrD	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	* Shewanella amazonensis SB2B Site: position = -189 score = 3.93967 sequence = CGGCGTGACACTCATCACACTT Gene: Sama_1213: periplasmic decaheme cytochrome c, MtrD	* Shewanella loihica PV-4 Site: position = -170 score = 5.28415 sequence = CAACGTGATCTAGATCACATAT Site: position = -260 score = 4.45471 sequence = TTATGTGACAGATATCTCAATC Gene: Shew_2519: periplasmic decaheme cytochrome c, MtrD	* Shewanella pealeana ATCC 700345 Site: position = -286 score = 4.12663 sequence = TTATGTGACAAAACTCTCAACT Site: position = -197 score = 5.43359 sequence = AAGTGTGATACGCATCACATAA Gene: Spea_2692: periplasmic decaheme cytochrome c, MtrD	* Shewanella halifaxensis HAW-EB4 Site: position = -305 score = 4.5247 sequence = TTATGTGATAAATATCTCAACT Site: position = -184 score = 4.56732 sequence = AAACTTGACACAGATCACACTT Gene: Shal_2778: periplasmic decaheme cytochrome c, MtrD	* Shewanella piezotolerans WP3 Site: position = -308 score = 4.16651 sequence = TTATGTGACAAATCTCTCAACT Site: position = -185 score = 4.56511 sequence = CAGTGTGACGTAGATCACGCTT Gene: swp_3272: periplasmic decaheme cytochrome c, MtrD	* Shewanella sediminis HAW-EB3 Site: position = -174 score = 4.76284 sequence = TAGCGTGACCAAGATCACACTT Site: position = -291 score = 4.01107 sequence = TTATGTGACAAAAGTCTCAACT Gene: Ssed_1530: periplasmic decaheme cytochrome c, MtrD	Shewanella woodyi ATCC 51908	periplasmic decaheme cytochrome c, MtrD
mtrE	Shewanella oneidensis MR-1 Gene: SO1781: outer membrane protein, MtrE	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3 Gene: Shewana3_2673: outer membrane protein, MtrE	Shewanella sp MR-4 Gene: Shewmr4_2507: outer membrane protein, MtrE	Shewanella sp MR-7 Gene: Shewmr7_2575: outer membrane protein, MtrE	Shewanella baltica OS155 Gene: Sbal_1592: outer membrane protein, MtrE	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_1212: outer membrane protein, MtrE	Shewanella loihica PV-4 Gene: Shew_2520: outer membrane protein, MtrE	Shewanella pealeana ATCC 700345 Gene: Spea_2693: outer membrane protein, MtrE	Shewanella halifaxensis HAW-EB4 Gene: Shal_2779: outer membrane protein, MtrE	Shewanella piezotolerans WP3 Gene: swp_3273: outer membrane protein, MtrE	Shewanella sediminis HAW-EB3 Gene: Ssed_1529: outer membrane protein, MtrE	Shewanella woodyi ATCC 51908	outer membrane protein, MtrE
mtrF	Shewanella oneidensis MR-1 Gene: SO1780: surface localized decaheme cytochrome c lipoprotein, MtrF	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3 Gene: Shewana3_2674: surface localized decaheme cytochrome c lipoprotein, MtrF	Shewanella sp MR-4 Gene: Shewmr4_2508: surface localized decaheme cytochrome c lipoprotein, MtrF	Shewanella sp MR-7 Gene: Shewmr7_2576: surface localized decaheme cytochrome c lipoprotein, MtrF	Shewanella baltica OS155 Gene: Sbal_1591: surface localized decaheme cytochrome c lipoprotein, MtrF	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_1211: surface localized decaheme cytochrome c lipoprotein, MtrF	Shewanella loihica PV-4 Gene: Shew_2521: surface localized decaheme cytochrome c lipoprotein, MtrF	Shewanella pealeana ATCC 700345 Gene: Spea_2694: surface localized decaheme cytochrome c lipoprotein, MtrF	Shewanella halifaxensis HAW-EB4 Gene: Shal_2780: surface localized decaheme cytochrome c lipoprotein, MtrF	Shewanella piezotolerans WP3 Gene: swp_3274: surface localized decaheme cytochrome c lipoprotein, MtrF	Shewanella sediminis HAW-EB3 Gene: Ssed_1528: surface localized decaheme cytochrome c lipoprotein, MtrF	Shewanella woodyi ATCC 51908	surface localized decaheme cytochrome c lipoprotein, MtrF
omcA	Shewanella oneidensis MR-1 Gene: SO1779: surface localized decaheme cytochrome c lipoprotein, OmcA	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3 Gene: Shewana3_2675: surface localized decaheme cytochrome c lipoprotein, OmcA	Shewanella sp MR-4 Gene: Shewmr4_2509: surface localized decaheme cytochrome c lipoprotein, OmcA	Shewanella sp MR-7 Gene: Shewmr7_2577: surface localized decaheme cytochrome c lipoprotein, OmcA	Shewanella baltica OS155 Gene: Sbal_1590: surface localized decaheme cytochrome c lipoprotein, OmcA	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2636: surface localized decaheme cytochrome c lipoprotein, OmcA	Shewanella amazonensis SB2B Gene: Sama_1210: surface localized decaheme cytochrome c lipoprotein, OmcA	Shewanella loihica PV-4 Gene: Shew_2522: surface localized decaheme cytochrome c lipoprotein, OmcA	Shewanella pealeana ATCC 700345 Gene: Spea_2695: surface localized decaheme cytochrome c lipoprotein, OmcA	Shewanella halifaxensis HAW-EB4 Gene: Shal_2781: surface localized decaheme cytochrome c lipoprotein, OmcA	Shewanella piezotolerans WP3 Gene: swp_3275: surface localized decaheme cytochrome c lipoprotein, OmcA	Shewanella sediminis HAW-EB3 Gene: Ssed_1527: surface localized decaheme cytochrome c lipoprotein, OmcA	Shewanella woodyi ATCC 51908	surface localized decaheme cytochrome c lipoprotein, OmcA

CRON 11.
cyaC	* Shewanella oneidensis MR-1 Site: position = -162 score = 4.6576 sequence = TGTATTGATCCAGATCACAAAT Gene: SO1329: Adenylate cyclase (EC 4.6.1.1)	* Shewanella putrefaciens CN-32 Site: position = -101 score = 4.6576 sequence = TGTATTGATCCAGATCACAAAT Gene: Sputcn32_1140: Adenylate cyclase (EC 4.6.1.1)	* Shewanella sp W3-18-1 Site: position = -101 score = 4.6576 sequence = TGTATTGATCCAGATCACAAAT Gene: Sputw3181_3024: Adenylate cyclase (EC 4.6.1.1)	* Shewanella sp ANA-3 Site: position = -162 score = 4.43072 sequence = TGGATTGATCCAGATCACAAAT Gene: Shewana3_3045: Adenylate cyclase (EC 4.6.1.1)	* Shewanella sp MR-4 Site: position = -162 score = 4.43072 sequence = TGGATTGATCCAGATCACAAAT Gene: Shewmr4_2867: Adenylate cyclase (EC 4.6.1.1)	* Shewanella sp MR-7 Site: position = -162 score = 4.43072 sequence = TGGATTGATCCAGATCACAAAT Gene: Shewmr7_2949: Adenylate cyclase (EC 4.6.1.1)	* Shewanella baltica OS155 Site: position = -101 score = 4.7278 sequence = TAGATTGATCCAGATCACAAAT Gene: Sbal_1182: Adenylate cyclase (EC 4.6.1.1)	* Shewanella denitrificans OS217 Site: position = -157 score = 4.80677 sequence = TGAATTGATCTAGATCACATTT Gene: Sden_2784: Adenylate cyclase (EC 4.6.1.1)	* Shewanella frigidimarina NCIMB 400 Site: position = -158 score = 4.40292 sequence = TCTATTGATCTAAATCACAAAT Gene: Sfri_2947: Adenylate cyclase (EC 4.6.1.1)	* Shewanella amazonensis SB2B Site: position = -102 score = 4.2287 sequence = TGAATTGATTCAGATCACGTTA Gene: Sama_0861: Adenylate cyclase (EC 4.6.1.1)	* Shewanella loihica PV-4 Site: position = -162 score = 4.57561 sequence = TCATTTGACTTAGATCACAAAT Gene: Shew_1036: Adenylate cyclase (EC 4.6.1.1)	* Shewanella pealeana ATCC 700345 Site: position = -100 score = 4.57561 sequence = TCATTTGACTTAGATCACAAAT Gene: Spea_1019: Adenylate cyclase (EC 4.6.1.1)	* Shewanella halifaxensis HAW-EB4 Site: position = -99 score = 5.05535 sequence = TTATTTGACTTAGATCACAAAT Gene: Shal_1065: Adenylate cyclase (EC 4.6.1.1)	* Shewanella piezotolerans WP3 Site: position = -98 score = 4.57561 sequence = TCATTTGACTTAGATCACAAAT Gene: swp_3798: Adenylate cyclase (EC 4.6.1.1)	* Shewanella sediminis HAW-EB3 Site: position = -103 score = 4.3353 sequence = TCATTTGACAAAGATCACAAAT Gene: Ssed_1130: Adenylate cyclase (EC 4.6.1.1)	* Shewanella woodyi ATCC 51908 Site: position = -96 score = 4.3353 sequence = TCATTTGACTAAGATCACAAAT Gene: Swoo_1225: Adenylate cyclase (EC 4.6.1.1)	Adenylate cyclase (EC 4.6.1.1)

CRON 12.
resA	* Shewanella oneidensis MR-1 Site: position = -265 score = 4.09062 sequence = ATTATTGATGCATATCAAGAAT Gene: SO2100: C-type cytochrome biogenesis protein ResA (thioredoxin)	* Shewanella putrefaciens CN-32 Site: position = -279 score = 4.17976 sequence = ATTATTGATGTATATCAAGAAT Site: position = -219 score = 3.94856 sequence = TAACATGACGCAGATCTAATTT Gene: Sputcn32_2087: C-type cytochrome biogenesis protein ResA (thioredoxin)	* Shewanella sp W3-18-1 Site: position = -219 score = 3.94856 sequence = TAACATGACGCAGATCTAATTT Site: position = -279 score = 4.17976 sequence = ATTATTGATGTATATCAAGAAT Gene: Sputw3181_1925: C-type cytochrome biogenesis protein ResA (thioredoxin)	* Shewanella sp ANA-3 Site: position = -251 score = 4.20702 sequence = ATTCTTGATGCATATCAAGAAT Site: position = -191 score = 4.2052 sequence = TAACATGATGCAGATCTAATTT Gene: Shewana3_1881: C-type cytochrome biogenesis protein ResA (thioredoxin)	* Shewanella sp MR-4 Site: position = -206 score = 4.2052 sequence = TAACATGATGCAGATCTAATTT Site: position = -266 score = 4.20702 sequence = ATTCTTGATGCATATCAAGAAT Gene: Shewmr4_1823: C-type cytochrome biogenesis protein ResA (thioredoxin)	* Shewanella sp MR-7 Site: position = -191 score = 4.2052 sequence = TAACATGATGCAGATCTAATTT Site: position = -251 score = 4.20702 sequence = ATTCTTGATGCATATCAAGAAT Gene: Shewmr7_2154: C-type cytochrome biogenesis protein ResA (thioredoxin)	* Shewanella baltica OS155 Site: position = -301 score = 4.29616 sequence = ATTCTTGATGTATATCAAGAAT Site: position = -241 score = 4.03771 sequence = TAACATGACGTAGATCTAATTT Gene: Sbal_1890: C-type cytochrome biogenesis protein ResA (thioredoxin)	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1124: C-type cytochrome biogenesis protein ResA (thioredoxin)	Shewanella amazonensis SB2B Gene: Sama_1680: C-type cytochrome biogenesis protein ResA (thioredoxin)	Shewanella loihica PV-4 Gene: Shew_1895: C-type cytochrome biogenesis protein ResA (thioredoxin)	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_3819: C-type cytochrome biogenesis protein ResA (thioredoxin)	* Shewanella woodyi ATCC 51908 Site: position = -140 score = 4.05319 sequence = ATTTTTGATGCTAATCAAATGA Gene: Swoo_2219: C-type cytochrome biogenesis protein ResA (thioredoxin)	C-type cytochrome biogenesis protein ResA (thioredoxin)
SO2101	Shewanella oneidensis MR-1 Gene: SO2101: lipoprotein, putative	Shewanella putrefaciens CN-32 Gene: Sputcn32_2086: lipoprotein, putative	Shewanella sp W3-18-1 Gene: Sputw3181_1926: lipoprotein, putative	Shewanella sp ANA-3 Gene: Shewana3_1882: lipoprotein, putative	Shewanella sp MR-4 Gene: Shewmr4_1824: lipoprotein, putative	Shewanella sp MR-7 Gene: Shewmr7_2153: lipoprotein, putative	Shewanella baltica OS155 Gene: Sbal_1891: lipoprotein, putative	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1125: lipoprotein, putative	Shewanella amazonensis SB2B Gene: Sama_1681: lipoprotein, putative	Shewanella loihica PV-4 Gene: Shew_1896: lipoprotein, putative	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_3818: lipoprotein, putative	Shewanella woodyi ATCC 51908 Gene: Swoo_2220: lipoprotein, putative	lipoprotein, putative
SO2102	Shewanella oneidensis MR-1 Gene: SO2102: hypothetical protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_2085: hypothetical protein	Shewanella sp W3-18-1 Gene: Sputw3181_1927: hypothetical protein	Shewanella sp ANA-3 Gene: Shewana3_1883: hypothetical protein	Shewanella sp MR-4 Gene: Shewmr4_1825: hypothetical protein	Shewanella sp MR-7 Gene: Shewmr7_2152: hypothetical protein	Shewanella baltica OS155 Gene: Sbal_1892: hypothetical protein	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1126: hypothetical protein	Shewanella amazonensis SB2B Gene: Sama_1682: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_1897: hypothetical protein	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_3817: hypothetical protein	Shewanella woodyi ATCC 51908 Gene: Swoo_2221: hypothetical protein	hypothetical protein
apbE	Shewanella oneidensis MR-1 Gene: SO2103: thiamin biosynthesis lipoprotein ApbE	Shewanella putrefaciens CN-32 Gene: Sputcn32_2084: thiamin biosynthesis lipoprotein ApbE	Shewanella sp W3-18-1 Gene: Sputw3181_1928: thiamin biosynthesis lipoprotein ApbE	Shewanella sp ANA-3 Gene: Shewana3_1884: thiamin biosynthesis lipoprotein ApbE	Shewanella sp MR-4 Gene: Shewmr4_1826: thiamin biosynthesis lipoprotein ApbE	Shewanella sp MR-7 Gene: Shewmr7_2151: thiamin biosynthesis lipoprotein ApbE	Shewanella baltica OS155 Gene: Sbal_1893: thiamin biosynthesis lipoprotein ApbE	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1127: thiamin biosynthesis lipoprotein ApbE	Shewanella amazonensis SB2B Gene: Sama_1683: thiamin biosynthesis lipoprotein ApbE	Shewanella loihica PV-4 Gene: Shew_1898: thiamin biosynthesis lipoprotein ApbE	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_3816: thiamin biosynthesis lipoprotein ApbE	Shewanella woodyi ATCC 51908 Gene: Swoo_3407: thiamin biosynthesis lipoprotein ApbE	thiamin biosynthesis lipoprotein ApbE
SO2104	Shewanella oneidensis MR-1 Gene: SO2104: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase	Shewanella putrefaciens CN-32 Gene: Sputcn32_2083: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase	Shewanella sp W3-18-1 Gene: Sputw3181_1929: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase	Shewanella sp ANA-3 Gene: Shewana3_1885: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase	Shewanella sp MR-4 Gene: Shewmr4_1827: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase	Shewanella sp MR-7 Gene: Shewmr7_2150: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase	Shewanella baltica OS155 Gene: Sbal_1894: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1128: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase
SO2105	Shewanella oneidensis MR-1 Gene: SO2105: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted	Shewanella putrefaciens CN-32 Gene: Sputcn32_2082: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted	Shewanella sp W3-18-1 Gene: Sputw3181_1930: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted	Shewanella sp ANA-3 Gene: Shewana3_1886: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted	Shewanella sp MR-4 Gene: Shewmr4_1828: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted	Shewanella sp MR-7 Gene: Shewmr7_2149: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted	Shewanella baltica OS155 Gene: Sbal_1895: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1129: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
Swoo_2222	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_2222: transposase and inactivated derivative	transposase and inactivated derivative

CRON 13.
Sputcn32_0777	Shewanella oneidensis MR-1	* Shewanella putrefaciens CN-32 Site: position = -140 score = 4.46796 sequence = AAACTTGATTCGTGTCACACAA Gene: Sputcn32_0777: hypothetical protein	* Shewanella sp W3-18-1 Site: position = -140 score = 4.46796 sequence = AAACTTGATTCGTGTCACACAA Gene: Sputw3181_3398: hypothetical protein	* Shewanella sp ANA-3 Site: position = -140 score = 4.42397 sequence = AAATTTGAACCACATCACACAG Gene: Shewana3_0738: hypothetical protein	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155 Gene: Sbal_3565: hypothetical protein	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -129 score = 4.15093 sequence = TTTTGTGAGCTAATTGGCAATT Gene: Sfri_0507: hypothetical protein	* Shewanella amazonensis SB2B Site: position = -139 score = 4.26481 sequence = AAAGTTGATTCACATCAAATTA Gene: Sama_0549: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_3247: hypothetical protein	Shewanella pealeana ATCC 700345 Gene: Spea_0593: hypothetical protein	* Shewanella halifaxensis HAW-EB4 Site: position = -79 score = 3.85574 sequence = GTTTTTGACTAAGATCAAAAAA Gene: Shal_0680: hypothetical protein	* Shewanella piezotolerans WP3 Site: position = -64 score = 4.09572 sequence = AAACGTGATCAACAGCATCTTT Gene: swp_4510: hypothetical protein	Shewanella sediminis HAW-EB3 Gene: Ssed_4003: hypothetical protein	* Shewanella woodyi ATCC 51908 Site: position = -81 score = 3.91436 sequence = TTTATTGATCGAGATCAGCTTA Gene: Swoo_4146: hypothetical protein	hypothetical protein

CRON 14.
pepQ	* Shewanella oneidensis MR-1 Site: position = -237 score = 4.40096 sequence = CTTTGTGATACACTGCACAAAG Gene: SO0022: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	* Shewanella putrefaciens CN-32 Site: position = -302 score = 4.1807 sequence = CTTTGTGATACACTGCACAGAG Gene: Sputcn32_0014: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	* Shewanella sp W3-18-1 Site: position = -302 score = 4.1807 sequence = CTTTGTGATACACTGCACAGAG Gene: Sputw3181_0014: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	* Shewanella sp ANA-3 Site: position = -255 score = 4.40096 sequence = CTTTGTGATACACTGCACAAAG Gene: Shewana3_0025: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	* Shewanella sp MR-4 Site: position = -255 score = 4.40096 sequence = CTTTGTGATACACTGCACAAAG Gene: Shewmr4_0019: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	* Shewanella sp MR-7 Site: position = -255 score = 4.40096 sequence = CTTTGTGATACACTGCACAAAG Gene: Shewmr7_0017: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	* Shewanella baltica OS155 Site: position = -302 score = 4.1807 sequence = CTTTGTGATACACTGCACAGAG Gene: Sbal_0022: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	Shewanella denitrificans OS217 Gene: Sden_0016: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0014: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	* Shewanella amazonensis SB2B Site: position = -109 score = 4.02086 sequence = CTTTGTGATACACTGCACAGCA Gene: Sama_0033: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	Shewanella loihica PV-4 Gene: Shew_0020: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	* Shewanella pealeana ATCC 700345 Site: position = -252 score = 4.08273 sequence = CAGTGTGCGACGAATCACAAAA Gene: Spea_0019: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	* Shewanella halifaxensis HAW-EB4 Site: position = -250 score = 4.00906 sequence = CAGTGTGCGACTAATCACAAAA Gene: Shal_0017: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	Shewanella piezotolerans WP3 Gene: swp_0046: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	Shewanella sediminis HAW-EB3 Gene: Ssed_0024: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	Shewanella woodyi ATCC 51908 Gene: Swoo_0022: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)	Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
SO0023	Shewanella oneidensis MR-1 Gene: SO0023: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0015: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella sp W3-18-1 Gene: Sputw3181_0015: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella sp ANA-3 Gene: Shewana3_0026: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella sp MR-4 Gene: Shewmr4_0020: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella sp MR-7 Gene: Shewmr7_0018: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella baltica OS155 Gene: Sbal_0023: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella denitrificans OS217 Gene: Sden_0017: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0015: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella amazonensis SB2B Gene: Sama_0034: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella loihica PV-4 Gene: Shew_0021: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella pealeana ATCC 700345 Gene: Spea_0020: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0018: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella piezotolerans WP3 Gene: swp_0047: FIG000605: protein co-occurring with transport systems (COG1739)	* Shewanella sediminis HAW-EB3 Site: position = -48 score = 3.80986 sequence = TTTTCTGATAGATTTTACATCA Gene: Ssed_0025: FIG000605: protein co-occurring with transport systems (COG1739)	Shewanella woodyi ATCC 51908 Gene: Swoo_0023: FIG000605: protein co-occurring with transport systems (COG1739)	FIG000605: protein co-occurring with transport systems (COG1739)
trkH-1	Shewanella oneidensis MR-1 Gene: SO0024: potassium uptake protein TrkH	Shewanella putrefaciens CN-32 Gene: Sputcn32_0016: potassium uptake protein TrkH	Shewanella sp W3-18-1 Gene: Sputw3181_0016: potassium uptake protein TrkH	Shewanella sp ANA-3 Gene: Shewana3_0027: potassium uptake protein TrkH	Shewanella sp MR-4 Gene: Shewmr4_0021: potassium uptake protein TrkH	Shewanella sp MR-7 Gene: Shewmr7_0019: potassium uptake protein TrkH	Shewanella baltica OS155 Gene: Sbal_0024: potassium uptake protein TrkH	Shewanella denitrificans OS217 Gene: Sden_0018: potassium uptake protein TrkH	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0016: potassium uptake protein TrkH	Shewanella amazonensis SB2B Gene: Sama_0035: potassium uptake protein TrkH	Shewanella loihica PV-4 Gene: Shew_0022: potassium uptake protein TrkH	Shewanella pealeana ATCC 700345 Gene: Spea_0021: potassium uptake protein TrkH	Shewanella halifaxensis HAW-EB4 Gene: Shal_0019: potassium uptake protein TrkH	Shewanella piezotolerans WP3 Gene: swp_0048: potassium uptake protein TrkH	Shewanella sediminis HAW-EB3 Gene: Ssed_0026: potassium uptake protein TrkH	Shewanella woodyi ATCC 51908 Gene: Swoo_0024: potassium uptake protein TrkH	potassium uptake protein TrkH
hemG	Shewanella oneidensis MR-1 Gene: SO0025: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0017: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella sp W3-18-1 Gene: Sputw3181_0017: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella sp ANA-3 Gene: Shewana3_0028: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella sp MR-4 Gene: Shewmr4_0022: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella sp MR-7 Gene: Shewmr7_0020: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella baltica OS155 Gene: Sbal_0025: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella denitrificans OS217 Gene: Sden_0019: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0017: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella amazonensis SB2B Gene: Sama_0036: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella loihica PV-4 Gene: Shew_0023: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella pealeana ATCC 700345 Gene: Spea_0022: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0020: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella piezotolerans WP3 Gene: swp_0049: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella sediminis HAW-EB3 Gene: Ssed_0027: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella woodyi ATCC 51908 Gene: Swoo_0025: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)

CRON 15.
fadB	* Shewanella oneidensis MR-1 Site: position = -210 score = 4.0994 sequence = CTTTGTGCAGTGTATCACAAAG Gene: SO0021: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	* Shewanella putrefaciens CN-32 Site: position = -210 score = 3.70346 sequence = CTCTGTGCAGTGTATCACAAAG Gene: Sputcn32_0013: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	* Shewanella sp W3-18-1 Site: position = -210 score = 3.70346 sequence = CTCTGTGCAGTGTATCACAAAG Gene: Sputw3181_0013: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	* Shewanella sp ANA-3 Site: position = -210 score = 4.0994 sequence = CTTTGTGCAGTGTATCACAAAG Gene: Shewana3_0024: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	* Shewanella sp MR-4 Site: position = -210 score = 4.0994 sequence = CTTTGTGCAGTGTATCACAAAG Gene: Shewmr4_0018: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	* Shewanella sp MR-7 Site: position = -210 score = 4.0994 sequence = CTTTGTGCAGTGTATCACAAAG Gene: Shewmr7_0016: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	* Shewanella baltica OS155 Site: position = -210 score = 3.70346 sequence = CTCTGTGCAGTGTATCACAAAG Gene: Sbal_0021: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella denitrificans OS217 Gene: Sden_0015: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0013: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	* Shewanella amazonensis SB2B Site: position = -193 score = 3.83321 sequence = TGCTGTGCAGTGTATCACAAAG Gene: Sama_0032: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella loihica PV-4 Gene: Shew_0019: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	* Shewanella pealeana ATCC 700345 Site: position = -134 score = 4.5914 sequence = TTTTGTGATTCGTCGCACACTG Gene: Spea_0018: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	* Shewanella halifaxensis HAW-EB4 Site: position = -134 score = 4.44023 sequence = TTTTGTGATTAGTCGCACACTG Gene: Shal_0016: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	* Shewanella piezotolerans WP3 Site: position = -127 score = 4.41781 sequence = TTATGTGATTAGTCGCACACTG Gene: swp_0035: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella sediminis HAW-EB3 Gene: Ssed_0023: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella woodyi ATCC 51908 Gene: Swoo_0021: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
fadA	Shewanella oneidensis MR-1 Gene: SO0020: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0012: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella sp W3-18-1 Gene: Sputw3181_0012: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella sp ANA-3 Gene: Shewana3_0023: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella sp MR-4 Gene: Shewmr4_0017: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella sp MR-7 Gene: Shewmr7_0015: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella baltica OS155 Gene: Sbal_0020: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella denitrificans OS217 Gene: Sden_0014: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0012: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella amazonensis SB2B Gene: Sama_0031: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella loihica PV-4 Gene: Shew_0018: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella pealeana ATCC 700345 Gene: Spea_0017: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0015: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella piezotolerans WP3 Gene: swp_0034: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella sediminis HAW-EB3 Gene: Ssed_0022: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	Shewanella woodyi ATCC 51908 Gene: Swoo_0020: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)	3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)

CRON 16.
SO2010	* Shewanella oneidensis MR-1 Site: position = -70 score = 4.66386 sequence = TTTTGTGATCTTCGTCACTGTA Gene: SO2010: hypothetical protein	* Shewanella putrefaciens CN-32 Site: position = -65 score = 5.08961 sequence = TTTTGTGATCTCCATCACCGTT Gene: Sputcn32_2305: hypothetical protein	* Shewanella sp W3-18-1 Site: position = -65 score = 5.08961 sequence = TTTTGTGATCTCCATCACCGTT Gene: Sputw3181_1703: hypothetical protein	Shewanella sp ANA-3	* Shewanella sp MR-4 Site: position = -65 score = 4.85361 sequence = TTTTGTGATCTTAATCACTGTA Gene: Shewmr4_2257: hypothetical protein	* Shewanella sp MR-7 Site: position = -65 score = 4.85361 sequence = TTTTGTGATCTTAATCACTGTA Gene: Shewmr7_2329: hypothetical protein	* Shewanella baltica OS155 Site: position = -65 score = 4.96559 sequence = TTTTGTGATCTAAATCACTGTA Gene: Sbal_2577: hypothetical protein	* Shewanella denitrificans OS217 Site: position = -81 score = 4.80876 sequence = AAATGTGATCCAGCTCAGCTTT Gene: Sden_2384: hypothetical protein	* Shewanella frigidimarina NCIMB 400 Site: position = -116 score = 4.84249 sequence = TTTTGTGATCGACTTCACGTCT Gene: Sfri_2410: hypothetical protein	* Shewanella amazonensis SB2B Site: position = -51 score = 4.3278 sequence = TTTTGTGAGCTGCATCACGGCA Gene: Sama_1307: hypothetical protein	* Shewanella loihica PV-4 Site: position = -48 score = 4.08426 sequence = AAAATTGATCTAGATCAATAAA Gene: Shew_2238: hypothetical protein	* Shewanella pealeana ATCC 700345 Site: position = -51 score = 4.08426 sequence = AAAATTGATCTAGATCAATAAA Gene: Spea_1505: hypothetical protein	* Shewanella halifaxensis HAW-EB4 Site: position = -80 score = 4.02505 sequence = TAGTGTGATTGATATCTATAAT Gene: Shal_1587: hypothetical protein	* Shewanella piezotolerans WP3 Site: position = -21 score = 4.08426 sequence = AAAATTGATCTAGATCAATAAA Gene: swp_1711: hypothetical protein	* Shewanella sediminis HAW-EB3 Site: position = -49 score = 4.08426 sequence = AAAATTGATCTAGATCAATAAA Gene: Ssed_2855: hypothetical protein	* Shewanella woodyi ATCC 51908 Site: position = -48 score = 4.09084 sequence = TAAATTGATCTAGATCAATAAA Gene: Swoo_1790: hypothetical protein	hypothetical protein

CRON 17.
SO3553	* Shewanella oneidensis MR-1 Site: position = -70 score = 3.91137 sequence = TTTTGCAACTATGATCACACAA Gene: SO3553: putative sulfate permease	* Shewanella putrefaciens CN-32 Site: position = -81 score = 3.95475 sequence = ATTTGCAATCATGATCACACAG Gene: Sputcn32_1042: putative sulfate permease	* Shewanella sp W3-18-1 Site: position = -81 score = 3.95475 sequence = ATTTGCAATCATGATCACACAG Gene: Sputw3181_3123: putative sulfate permease	* Shewanella sp ANA-3 Site: position = -70 score = 3.91137 sequence = TTTTGCAACTATGATCACACAA Gene: Shewana3_3154: putative sulfate permease	* Shewanella sp MR-4 Site: position = -70 score = 4.47087 sequence = TTTTGTAACTATGATCACACAA Gene: Shewmr4_2974: putative sulfate permease	* Shewanella sp MR-7 Site: position = -70 score = 4.47087 sequence = TTTTGTAACTATGATCACACAA Gene: Shewmr7_3056: putative sulfate permease	Shewanella baltica OS155 Gene: Sbal_1037: putative sulfate permease	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -116 score = 4.47739 sequence = TAATGTGATGATAATTATATTA Gene: Sfri_3674: putative sulfate permease	* Shewanella amazonensis SB2B Site: position = -82 score = 4.12356 sequence = AAATTTGCCAAAGCTCACACAT Gene: Sama_1067: putative sulfate permease	Shewanella loihica PV-4 Gene: Shew_0497: putative sulfate permease	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	* Shewanella sediminis HAW-EB3 Site: position = -233 score = 4.0599 sequence = GTAAGTGCTACGCATCACATTT Gene: Ssed_1334: putative sulfate permease	* Shewanella woodyi ATCC 51908 Site: position = -288 score = 3.72381 sequence = TCCAGCGACTTAGATCACATTT Gene: Swoo_3320: putative sulfate permease	putative sulfate permease
Sama_1066	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_1066: hypothetical protein	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	hypothetical protein
Shewana3_2597	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_1065: L-sorbosone dehydrogenase	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	L-sorbosone dehydrogenase
purE	Shewanella oneidensis MR-1 Gene: SO3554: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	Shewanella putrefaciens CN-32 Gene: Sputcn32_1041: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	Shewanella sp W3-18-1 Gene: Sputw3181_3124: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	Shewanella sp ANA-3 Gene: Shewana3_3155: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	Shewanella sp MR-4 Gene: Shewmr4_2975: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	Shewanella sp MR-7 Gene: Shewmr7_3057: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	Shewanella baltica OS155 Gene: Sbal_1036: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	* Shewanella denitrificans OS217 Site: position = -315 score = 3.73258 sequence = AATTCTGACTCATCTTAAATTA Gene: Sden_1224: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1076: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	Shewanella amazonensis SB2B Gene: Sama_1064: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	2 Shewanella loihica PV-4 Gene: Shew_1248: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) Gene: Shew_1230: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	Shewanella pealeana ATCC 700345 Gene: Spea_1211: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	* Shewanella halifaxensis HAW-EB4 Site: position = -269 score = 4.35424 sequence = TTGTGGGATCTAGGTAACATTT Gene: Shal_1245: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	Shewanella piezotolerans WP3 Gene: swp_1396: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	* Shewanella sediminis HAW-EB3 Site: position = -217 score = 3.77583 sequence = TATTGTGAAGTCATCCGGATAT Gene: Ssed_1333: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	Shewanella woodyi ATCC 51908 Gene: Swoo_3321: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)	phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
purK	Shewanella oneidensis MR-1 Gene: SO3555: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)	Shewanella putrefaciens CN-32 Gene: Sputcn32_1040: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)	Shewanella sp W3-18-1 Gene: Sputw3181_3125: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)	Shewanella sp ANA-3 Gene: Shewana3_3156: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)	Shewanella sp MR-4 Gene: Shewmr4_2976: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)	Shewanella sp MR-7 Gene: Shewmr7_3058: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)	Shewanella baltica OS155 Gene: Sbal_1035: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)	Shewanella denitrificans OS217 Gene: Sden_1223: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1075: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)	Shewanella amazonensis SB2B Gene: Sama_1063: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)	Shewanella loihica PV-4 Gene: Shew_1249: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_3322: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)	phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
SO3556	Shewanella oneidensis MR-1 Gene: SO3556: cyclic nucleotide phosphodiesterase, putative	Shewanella putrefaciens CN-32 Gene: Sputcn32_1039: cyclic nucleotide phosphodiesterase, putative	Shewanella sp W3-18-1 Gene: Sputw3181_3126: cyclic nucleotide phosphodiesterase, putative	Shewanella sp ANA-3 Gene: Shewana3_3157: cyclic nucleotide phosphodiesterase, putative	Shewanella sp MR-4 Gene: Shewmr4_2977: cyclic nucleotide phosphodiesterase, putative	Shewanella sp MR-7 Gene: Shewmr7_3059: cyclic nucleotide phosphodiesterase, putative	Shewanella baltica OS155	Shewanella denitrificans OS217 Gene: Sden_1222: cyclic nucleotide phosphodiesterase, putative	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_1062: cyclic nucleotide phosphodiesterase, putative	Shewanella loihica PV-4 Gene: Shew_2953: cyclic nucleotide phosphodiesterase, putative	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_3724: cyclic nucleotide phosphodiesterase, putative	cyclic nucleotide phosphodiesterase, putative

CRON 18.
SO0543	* Shewanella oneidensis MR-1 Site: position = -192 score = 3.7012 sequence = CGTTATGCGCTAAATCACAAAA Gene: SO0543: hypothetical protein	* Shewanella putrefaciens CN-32 Site: position = -88 score = 4.16514 sequence = ATTTTTACTCTAATTCACAAAA Gene: Sputcn32_3331: hypothetical protein	* Shewanella sp W3-18-1 Site: position = -88 score = 4.16514 sequence = ATTTTTACTCTAATTCACAAAA Gene: Sputw3181_0610: hypothetical protein	* Shewanella sp ANA-3 Site: position = -193 score = 4.07227 sequence = AGTTATGCGCTAAATCACAAAA Gene: Shewana3_0541: hypothetical protein	* Shewanella sp MR-4 Site: position = -192 score = 3.96029 sequence = AGTTATGCGCTTAATCACAAAA Gene: Shewmr4_0542: hypothetical protein	* Shewanella sp MR-7 Site: position = -191 score = 3.96029 sequence = AGTTATGCGCTTAATCACAAAA Gene: Shewmr7_3488: hypothetical protein	* Shewanella baltica OS155 Site: position = -201 score = 4.84616 sequence = TGTTGTGCTCTCAATCACAAAA Site: position = -88 score = 3.91937 sequence = AATTTTACCCTGATTCACAAAA Gene: Sbal_0501: hypothetical protein	* Shewanella denitrificans OS217 Site: position = -34 score = 3.93206 sequence = TAATATGACTAGAGTCAAACAT Gene: Sden_0657: hypothetical protein	* Shewanella frigidimarina NCIMB 400 Site: position = -200 score = 4.0127 sequence = ATATTTGATCACAAGCACACTC Gene: Sfri_3534: hypothetical protein	* Shewanella amazonensis SB2B Site: position = -240 score = 3.88591 sequence = CATTGTTACTCACTTCATACAT Site: position = -126 score = 3.94973 sequence = ATTTATGACCATACTCACAGAG Gene: Sama_3164: hypothetical protein	* Shewanella loihica PV-4 Site: position = -190 score = 4.1607 sequence = TAGTGTTAACTCGATCAAACAA Gene: Shew_0428: hypothetical protein	* Shewanella pealeana ATCC 700345 Site: position = -197 score = 4.17892 sequence = TTTTGCTACATAGATCGCATAT Gene: Spea_3733: hypothetical protein	* Shewanella halifaxensis HAW-EB4 Site: position = -235 score = 4.70012 sequence = TTTTGTTACATGGATCGCATAT Gene: Shal_3818: hypothetical protein	* Shewanella piezotolerans WP3 Site: position = -156 score = 4.64928 sequence = TTTTGTTACACAGATCGCATAT Gene: swp_0532: hypothetical protein	* Shewanella sediminis HAW-EB3 Site: position = -213 score = 4.19313 sequence = TAATGTTAAATCGATCTCACTT Gene: Ssed_0598: hypothetical protein	* Shewanella woodyi ATCC 51908 Site: position = -215 score = 3.83055 sequence = AATTGCTAGATAGATCTCACTT Gene: Swoo_4355: hypothetical protein	hypothetical protein

CRON 19.
hmgA	* Shewanella oneidensis MR-1 Site: position = -92 score = 3.81693 sequence = AATTGATAAGAAGATCACAGTA Gene: SO1963: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	* Shewanella putrefaciens CN-32 Site: position = -66 score = 4.14896 sequence = AATTGATAACAAGATCACATAA Gene: Sputcn32_1671: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	* Shewanella sp W3-18-1 Site: position = -66 score = 4.14896 sequence = AATTGATAACAAGATCACATAA Gene: Sputw3181_2354: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	* Shewanella sp ANA-3 Site: position = -144 score = 3.88015 sequence = TTTTTAGATTGAGATAACAGAT Site: position = -88 score = 3.92208 sequence = AATTGATAAGAAGATCACACTA Gene: Shewana3_2481: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	* Shewanella sp MR-4 Site: position = -144 score = 3.88015 sequence = TTTTTAGATTGAGATAACAGAT Site: position = -88 score = 3.92208 sequence = AATTGATAAGAAGATCACACTA Gene: Shewmr4_2291: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	* Shewanella sp MR-7 Site: position = -88 score = 3.92208 sequence = AATTGATAAGAAGATCACACTA Site: position = -144 score = 3.88015 sequence = TTTTTAGATAGAGATAACAGAT Gene: Shewmr7_2363: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	* Shewanella baltica OS155 Site: position = -88 score = 3.95142 sequence = AATTGATAACAAGATCACACTA Site: position = -144 score = 3.52271 sequence = TTTTTAGATTGAGATAACGGAT Gene: Sbal_2615: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	* Shewanella denitrificans OS217 Site: position = -122 score = 3.58168 sequence = AATTGATAGCTAGATCACAACG Gene: Sden_2162: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	* Shewanella frigidimarina NCIMB 400 Site: position = -106 score = 4.99586 sequence = AATTGTAAGTTAGATCACATAT Site: position = -126 score = 3.52118 sequence = TTTGTTGATCTTTACCACTAAA Gene: Sfri_2326: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	* Shewanella amazonensis SB2B Site: position = -78 score = 4.47858 sequence = AATTGATACCCAGATCACATAT Gene: Sama_1569: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	* Shewanella loihica PV-4 Site: position = -61 score = 5.10196 sequence = AATTGTTACTTAGATCACATAA Gene: Shew_2154: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	* Shewanella pealeana ATCC 700345 Site: position = -63 score = 3.95532 sequence = AAATTGAACCTAGATCACATTA Gene: Spea_1874: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	* Shewanella halifaxensis HAW-EB4 Site: position = -63 score = 3.9407 sequence = AAATTAAAGCTAGATCACATTA Gene: Shal_2409: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	* Shewanella piezotolerans WP3 Site: position = -61 score = 4.14896 sequence = AATTGATAACAAGATCACATTA Site: position = -84 score = 3.48834 sequence = TTTTTTGCTGTTGTTAGCAACT Gene: swp_2870: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Homogentisate 1,2-dioxygenase (EC 1.13.11.5)

CRON 20.
SO2806	* Shewanella oneidensis MR-1 Site: position = -95 score = 4.26651 sequence = TCTTGTGAATTGAGTCACATAG Gene: SO2806: hypothetical protein	* Shewanella putrefaciens CN-32 Site: position = -95 score = 3.96381 sequence = TCTTGTGAATTGAGTCACAGAG Gene: Sputcn32_1554: hypothetical protein	* Shewanella sp W3-18-1 Site: position = -95 score = 3.96381 sequence = TCTTGTGAATTGAGTCACAGAG Gene: Sputw3181_2545: hypothetical protein	* Shewanella sp ANA-3 Site: position = -95 score = 3.96381 sequence = TCTTGTGAATTGAGTCACAGAG Gene: Shewana3_2588: hypothetical protein	* Shewanella sp MR-4 Site: position = -95 score = 3.96381 sequence = TCTTGTGAATTGAGTCACAGAG Gene: Shewmr4_2426: hypothetical protein	* Shewanella sp MR-7 Site: position = -95 score = 3.96381 sequence = TCTTGTGAATTGAGTCACAGAG Gene: Shewmr7_2496: hypothetical protein	* Shewanella baltica OS155 Site: position = -94 score = 4.18448 sequence = ATCTGTGAATTAAGTCACACAG Gene: Sbal_1679: hypothetical protein	* Shewanella denitrificans OS217 Site: position = -35 score = 3.92596 sequence = ATATTTTATGCCGTTCACTCAT Gene: Sden_1453: hypothetical protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2429: hypothetical protein	* Shewanella amazonensis SB2B Site: position = -85 score = 4.0245 sequence = AATTGTGAAGCCAGTCACGGTG Gene: Sama_1287: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_2323: hypothetical protein	* Shewanella pealeana ATCC 700345 Site: position = -84 score = 4.41665 sequence = AATTGTGAATAACGTCACACAG Gene: Spea_1483: hypothetical protein	* Shewanella halifaxensis HAW-EB4 Site: position = -84 score = 4.73677 sequence = AATTGTGAACAACATCACACAG Gene: Shal_1567: hypothetical protein	* Shewanella piezotolerans WP3 Site: position = 27 score = 4.26731 sequence = AACTGTGAAAGGTATCACACAC Gene: swp_1689: hypothetical protein	* Shewanella sediminis HAW-EB3 Site: position = -82 score = 4.45071 sequence = TAATGTGAATGGCGTCACACAG Gene: Ssed_2877: hypothetical protein	* Shewanella woodyi ATCC 51908 Site: position = -81 score = 4.61656 sequence = TATTGTGAAAGTCATCACACAG Gene: Swoo_1771: hypothetical protein	hypothetical protein

CRON 21.
map	Shewanella oneidensis MR-1 Gene: SO1627: methionine aminopeptidase (EC 3.4.11.18)	Shewanella putrefaciens CN-32 Gene: Sputcn32_1347: methionine aminopeptidase (EC 3.4.11.18)	Shewanella sp W3-18-1 Gene: Sputw3181_2756: methionine aminopeptidase (EC 3.4.11.18)	Shewanella sp ANA-3 Gene: Shewana3_2816: methionine aminopeptidase (EC 3.4.11.18)	Shewanella sp MR-4 Gene: Shewmr4_2642: methionine aminopeptidase (EC 3.4.11.18)	Shewanella sp MR-7 Gene: Shewmr7_2709: methionine aminopeptidase (EC 3.4.11.18)	Shewanella baltica OS155 Gene: Sbal_1449: methionine aminopeptidase (EC 3.4.11.18)	Shewanella denitrificans OS217 Gene: Sden_1553: methionine aminopeptidase (EC 3.4.11.18)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1269: methionine aminopeptidase (EC 3.4.11.18)	Shewanella amazonensis SB2B Gene: Sama_1138: methionine aminopeptidase (EC 3.4.11.18)	Shewanella loihica PV-4 Gene: Shew_2636: methionine aminopeptidase (EC 3.4.11.18)	* Shewanella pealeana ATCC 700345 Site: position = -104 score = 4.17206 sequence = TAATTTGAAAAAAAGCACAAAT Gene: Spea_2886: methionine aminopeptidase (EC 3.4.11.18)	* Shewanella halifaxensis HAW-EB4 Site: position = -92 score = 3.70075 sequence = TAATATGAAAAAAAGCACAAAC Gene: Shal_2982: methionine aminopeptidase (EC 3.4.11.18)	* Shewanella piezotolerans WP3 Site: position = -93 score = 4.19448 sequence = TATTTTGAAAAAAAGCACAAAT Gene: swp_3524: methionine aminopeptidase (EC 3.4.11.18)	* Shewanella sediminis HAW-EB3 Site: position = -91 score = 3.88528 sequence = TATTGAGAGAGCAAACACAAAT Gene: Ssed_3162: methionine aminopeptidase (EC 3.4.11.18)	Shewanella woodyi ATCC 51908 Gene: Swoo_3282: methionine aminopeptidase (EC 3.4.11.18)	methionine aminopeptidase (EC 3.4.11.18)

CRON 22.
SO3895	Shewanella oneidensis MR-1 Gene: SO3895: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella putrefaciens CN-32 Site: position = -317 score = 4.86557 sequence = AAATGCGATATAGATCACAAAC Gene: Sputcn32_0780: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella sp W3-18-1 Site: position = -317 score = 4.86557 sequence = AAATGCGATATAGATCACAAAC Gene: Sputw3181_3395: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella sp ANA-3 Site: position = -308 score = 4.54871 sequence = AAATGTGATCTTGATCACTTGA Gene: Shewana3_0735: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella sp MR-4 Site: position = -309 score = 3.87278 sequence = AAATGTGATCTGGATCATTGGA Gene: Shewmr4_3226: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella sp MR-7 Site: position = -309 score = 3.87278 sequence = AAATGTGATCTGGATCATTGGA Gene: Shewmr7_0763: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella baltica OS155 Site: position = -321 score = 5.03197 sequence = AAGTGTGATCTGGATCAAGTTT Gene: Sbal_3568: HesA/MoeB/ThiF family protein related to EC-YgdL	Shewanella denitrificans OS217 Gene: Sden_0542: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella frigidimarina NCIMB 400 Site: position = -251 score = 3.95131 sequence = TATCTTGATGAGTTTAACCAAT Gene: Sfri_0504: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella amazonensis SB2B Site: position = -214 score = 4.83968 sequence = AAGTGTGATCACTATCACATCA Gene: Sama_0546: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella loihica PV-4 Site: position = -226 score = 4.63153 sequence = AGGTGTGATCCGTGTCGCAAAT Site: position = -196 score = 3.83046 sequence = TTACGTGAGTTTTATCATGTTG Gene: Shew_3251: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella pealeana ATCC 700345 Site: position = -259 score = 4.2915 sequence = ATGTGTGACGCTTGTCACGGTT Gene: Spea_0591: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella halifaxensis HAW-EB4 Site: position = -253 score = 4.77168 sequence = GTTTGTGATGTCTATCACGTTT Gene: Shal_0678: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella piezotolerans WP3 Site: position = -215 score = 3.91162 sequence = ATGTGTGATATTAATCATAGGT Site: position = -245 score = 3.77242 sequence = CGATGTGATCTTGATCTGGTTT Gene: swp_4512: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella sediminis HAW-EB3 Site: position = -200 score = 3.77358 sequence = TTTTGTGAACTTGATTAACAAG Site: position = -324 score = 5.03019 sequence = TTTTGTGATTCTTATCACGCAT Site: position = -294 score = 4.58816 sequence = TTGTGTGATATCAATCATCTTT Gene: Ssed_4007: HesA/MoeB/ThiF family protein related to EC-YgdL	* Shewanella woodyi ATCC 51908 Site: position = -290 score = 5.13082 sequence = CTTTGTGATATCAATCACAATA Gene: Swoo_4150: HesA/MoeB/ThiF family protein related to EC-YgdL	HesA/MoeB/ThiF family protein related to EC-YgdL

CRON 23.
SO4126	* Shewanella oneidensis MR-1 Site: position = -92 score = 4.13908 sequence = TTAATTGACCTAAATCAAACTT Gene: SO4126: hypothetical protein	* Shewanella putrefaciens CN-32 Site: position = -90 score = 4.63786 sequence = TAATTTGACCTAGATCAAAGTT Gene: Sputcn32_0548: hypothetical protein	* Shewanella sp W3-18-1 Site: position = -90 score = 4.63786 sequence = TAATTTGACCTAGATCAAAGTT Gene: Sputw3181_3624: hypothetical protein	* Shewanella sp ANA-3 Site: position = -93 score = 4.25106 sequence = TTAATTGACCTAGATCAAACTT Gene: Shewana3_3675: hypothetical protein	* Shewanella sp MR-4 Site: position = -187 score = 4.23469 sequence = AACATTGAACTAGATCACAATT Site: position = -93 score = 4.25106 sequence = TTAATTGACCTAGATCAAACTT Gene: Shewmr4_3498: hypothetical protein	* Shewanella sp MR-7 Site: position = -93 score = 4.25106 sequence = TTAATTGACCTAGATCAAACTT Site: position = -187 score = 4.23469 sequence = AACATTGAACTAGATCACAATT Gene: Shewmr7_0454: hypothetical protein	* Shewanella baltica OS155 Site: position = -90 score = 4.25106 sequence = TTAATTGACCTAGATCAAACTT Gene: Sbal_3847: hypothetical protein	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	hypothetical protein

CRON 24.
etfD	* Shewanella oneidensis MR-1 Site: position = -171 score = 4.25014 sequence = ATCTGTGACAGTGCTCACCCAA Gene: SO4453: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella putrefaciens CN-32 Site: position = -171 score = 4.16552 sequence = ATCTGTGACAGTCCTCACCCAA Gene: Sputcn32_0388: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella sp W3-18-1 Site: position = -171 score = 4.16552 sequence = ATCTGTGACAGTCCTCACCCAA Gene: Sputw3181_0242: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella sp ANA-3 Site: position = -175 score = 4.25014 sequence = ATCTGTGACAGTGCTCACCCAA Gene: Shewana3_0273: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella sp MR-4 Site: position = -175 score = 4.28426 sequence = AACTGTGACAGCGCTCACCCAA Gene: Shewmr4_0272: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella sp MR-7 Site: position = -175 score = 4.28426 sequence = AACTGTGACAGCGCTCACCCAA Gene: Shewmr7_3749: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella baltica OS155 Site: position = -170 score = 4.36307 sequence = ATCTGTGACAGTCCTCACCTAA Gene: Sbal_0283: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella denitrificans OS217 Site: position = -130 score = 4.55565 sequence = TTTTGTGACACAGCTCACCTCA Gene: Sden_0100: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella frigidimarina NCIMB 400 Site: position = -159 score = 4.67074 sequence = ATTTGTGACTCGACTCACGCTA Gene: Sfri_0081: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella amazonensis SB2B Site: position = -157 score = 4.31194 sequence = AATTGTGACGCCGCTCACTCAG Gene: Sama_3523: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella loihica PV-4 Site: position = -148 score = 4.53276 sequence = TAATGTGACACCGCTCACGAAG Gene: Shew_0086: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella pealeana ATCC 700345 Site: position = -181 score = 4.10743 sequence = TTTTGTGACAGTTATCACGGCA Gene: Spea_4121: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella halifaxensis HAW-EB4 Site: position = -180 score = 4.21259 sequence = TTTTGTGACAGTTATCACGCCA Gene: Shal_0121: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella piezotolerans WP3 Site: position = -176 score = 4.43323 sequence = TTTTGTGACACTAATCACCTCA Gene: swp_5010: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella sediminis HAW-EB3 Site: position = -150 score = 4.82835 sequence = TTTTGTGACACCCCTCACATAC Gene: Ssed_4403: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Shewanella woodyi ATCC 51908 Site: position = -135 score = 4.72349 sequence = TTTTGTGACGACACTCACATTC Gene: Swoo_4794: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)

CRON 25.
omp35	* Shewanella oneidensis MR-1 Site: position = -67 score = 4.14845 sequence = AAATGTGTTAAACCACACAAAA Gene: SO3896: outer membrane porin	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	* Shewanella sp ANA-3 Site: position = -67 score = 4.14845 sequence = AAATGTGTTAAACCACACAAAA Gene: Shewana3_0733: outer membrane porin	* Shewanella sp MR-4 Site: position = -67 score = 3.74184 sequence = AAATGTGTAAAACCACACAAAA Gene: Shewmr4_3228: outer membrane porin	* Shewanella sp MR-7 Site: position = -67 score = 3.74184 sequence = AAATGTGTAAAACCACACAAAA Gene: Shewmr7_0761: outer membrane porin	* Shewanella baltica OS155 Site: position = -67 score = 3.58895 sequence = AAATGCGTTAAACCACACAAAA Gene: Sbal_3570: outer membrane porin	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -145 score = 4.52387 sequence = TTATTTGATCTAGGCCACACTA Gene: Sfri_0503: outer membrane porin	Shewanella amazonensis SB2B	* Shewanella loihica PV-4 Site: position = -150 score = 4.10094 sequence = AAATTTGATCTGCGCCACACTC Gene: Shew_3260: outer membrane porin	* Shewanella pealeana ATCC 700345 Site: position = -150 score = 4.4453 sequence = AAACATGATCTAGTCCACAATT Gene: Spea_0589: outer membrane porin	* Shewanella halifaxensis HAW-EB4 Site: position = -150 score = 4.4453 sequence = AAACATGATCTAGTCCACAATT Gene: Shal_0676: outer membrane porin	* Shewanella piezotolerans WP3 Site: position = -150 score = 4.12815 sequence = AAACTTGATCTAGCCCACAATC Gene: swp_4514: outer membrane porin	* Shewanella sediminis HAW-EB3 Site: position = -151 score = 4.4453 sequence = AAACATGATCTAGTCCACAATT Gene: Ssed_4009: outer membrane porin	2 Shewanella woodyi ATCC 51908* Site: position = -149 score = 4.29639 sequence = AAGTTTGATCTAGTCCACAATC Gene: Swoo_4151: outer membrane porin Site: position = -241 score = 3.31103 sequence = AATTATTAACTCTTTCTTAAAT Gene: Swoo_4152: outer membrane porin	outer membrane porin

CRON 26.
SO3421	* Shewanella oneidensis MR-1 Site: position = -244 score = 4.22439 sequence = AAACGAGAGTTAAATCACACTT Gene: SO3421: b-type cytochrome, putative	* Shewanella putrefaciens CN-32 Site: position = -242 score = 4.76659 sequence = AAACGAGATCTAAATCACAAAA Gene: Sputcn32_2739: b-type cytochrome, putative	* Shewanella sp W3-18-1 Site: position = -242 score = 4.76659 sequence = AAACGAGATCTAAATCACAAAA Gene: Sputw3181_1273: b-type cytochrome, putative	* Shewanella sp ANA-3 Site: position = -241 score = 4.87751 sequence = AAACGAGATCTAAATCACATTT Gene: Shewana3_1134: b-type cytochrome, putative	* Shewanella sp MR-4 Site: position = -241 score = 4.87751 sequence = AAACGAGATCTAAATCACATTT Gene: Shewmr4_1133: b-type cytochrome, putative	* Shewanella sp MR-7 Site: position = -241 score = 4.87751 sequence = AAACGAGATCTAAATCACATTT Gene: Shewmr7_1204: b-type cytochrome, putative	* Shewanella baltica OS155 Site: position = -244 score = 4.98949 sequence = AAACGAGATCTAGATCACATTT Gene: Sbal_1222: b-type cytochrome, putative	* Shewanella denitrificans OS217 Site: position = -291 score = 4.6838 sequence = AAGCGTGATCAAAGTCACACTT Gene: Sden_2745: b-type cytochrome, putative	* Shewanella frigidimarina NCIMB 400 Site: position = -383 score = 5.24076 sequence = AATAGTGATCTGCATCACACTT Gene: Sfri_2911: b-type cytochrome, putative	* Shewanella amazonensis SB2B Site: position = -234 score = 4.21525 sequence = AGTCGTGAGTAAAATCACGTTT Gene: Sama_0900: b-type cytochrome, putative	* Shewanella loihica PV-4 Site: position = -208 score = 4.94835 sequence = AAACGTGATCTAGATCAACTTT Gene: Shew_1074: b-type cytochrome, putative	* Shewanella pealeana ATCC 700345 Site: position = -255 score = 4.91113 sequence = AGTCGTGATCTAAATCACGTTT Gene: Spea_1061: b-type cytochrome, putative	* Shewanella halifaxensis HAW-EB4 Site: position = -255 score = 4.91113 sequence = AGTCGTGATCTAAATCACGTTT Gene: Shal_1109: b-type cytochrome, putative	* Shewanella piezotolerans WP3 Site: position = -366 score = 4.91113 sequence = AGTCGTGATCTAAATCACGTTT Gene: swp_3756: b-type cytochrome, putative	* Shewanella sediminis HAW-EB3 Site: position = -236 score = 4.91113 sequence = AGTCGTGATCTAAATCACGTTT Gene: Ssed_1170: b-type cytochrome, putative	* Shewanella woodyi ATCC 51908 Site: position = -234 score = 4.91113 sequence = AGTCGTGATCTTGATCACGTTT Gene: Swoo_1265: b-type cytochrome, putative	b-type cytochrome, putative

CRON 27.
hutC	* Shewanella oneidensis MR-1 Site: position = -151 score = 4.14677 sequence = TTATGTGAGCTAGCTTGTATTT Gene: SO0096: histidine utilization repressor	* Shewanella putrefaciens CN-32 Site: position = -178 score = 4.10847 sequence = TTATGTGAGCTGGCTTGTATTT Gene: Sputcn32_0078: histidine utilization repressor	* Shewanella sp W3-18-1 Site: position = -178 score = 4.10847 sequence = TTATGTGAGCTGGCTTGTATTT Gene: Sputw3181_3999: histidine utilization repressor	* Shewanella sp ANA-3 Site: position = -142 score = 4.14677 sequence = TTATGTGAGCTAGCTTGTATTT Gene: Shewana3_0099: histidine utilization repressor	* Shewanella sp MR-4 Site: position = -142 score = 4.05763 sequence = TTATGTGAGCCAGCTTGTATTT Gene: Shewmr4_0098: histidine utilization repressor	* Shewanella sp MR-7 Site: position = -142 score = 4.14677 sequence = TTATGTGAGCTAGCTTGTATTT Gene: Shewmr7_0093: histidine utilization repressor	* Shewanella baltica OS155 Site: position = -177 score = 4.14677 sequence = TTATGTGAGCTAGCTTGTATTT Gene: Sbal_4253: histidine utilization repressor	Shewanella denitrificans OS217 Gene: Sden_0082: histidine utilization repressor	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3954: histidine utilization repressor	Shewanella amazonensis SB2B Gene: Sama_0081: histidine utilization repressor	* Shewanella loihica PV-4 Site: position = -138 score = 4.14677 sequence = TTATGTGAGCTAGCTTGTATTT Gene: Shew_3758: histidine utilization repressor	* Shewanella pealeana ATCC 700345 Site: position = -106 score = 3.80517 sequence = ATTTGTGAGCTAGCTTGTGTTT Gene: Spea_4170: histidine utilization repressor	* Shewanella halifaxensis HAW-EB4 Site: position = -106 score = 3.94642 sequence = ATTTGTGAGCCCGCTTGTATTT Gene: Shal_0072: histidine utilization repressor	* Shewanella piezotolerans WP3 Site: position = -177 score = 4.16261 sequence = ATTTGTGAGCTAGCTTGTATTT Gene: swp_0132: histidine utilization repressor	* Shewanella sediminis HAW-EB3 Site: position = -150 score = 4.06614 sequence = AGTTGTGATCCAACTTGTATTT Gene: Ssed_4448: histidine utilization repressor	* Shewanella woodyi ATCC 51908 Site: position = -201 score = 4.13634 sequence = AAGTGTGATCCAACTTGTATTT Gene: Swoo_4839: histidine utilization repressor	histidine utilization repressor
hutU	Shewanella oneidensis MR-1 Gene: SO0097: urocanate hydratase (EC 4.2.1.49)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0079: urocanate hydratase (EC 4.2.1.49)	Shewanella sp W3-18-1 Gene: Sputw3181_3998: urocanate hydratase (EC 4.2.1.49)	Shewanella sp ANA-3 Gene: Shewana3_0100: urocanate hydratase (EC 4.2.1.49)	Shewanella sp MR-4 Gene: Shewmr4_0099: urocanate hydratase (EC 4.2.1.49)	Shewanella sp MR-7 Gene: Shewmr7_0094: urocanate hydratase (EC 4.2.1.49)	Shewanella baltica OS155 Gene: Sbal_4252: urocanate hydratase (EC 4.2.1.49)	Shewanella denitrificans OS217 Gene: Sden_0083: urocanate hydratase (EC 4.2.1.49)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3953: urocanate hydratase (EC 4.2.1.49)	Shewanella amazonensis SB2B Gene: Sama_1632: urocanate hydratase (EC 4.2.1.49)	Shewanella loihica PV-4 Gene: Shew_3757: urocanate hydratase (EC 4.2.1.49)	Shewanella pealeana ATCC 700345 Gene: Spea_4169: urocanate hydratase (EC 4.2.1.49)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0073: urocanate hydratase (EC 4.2.1.49)	Shewanella piezotolerans WP3 Gene: swp_0133: urocanate hydratase (EC 4.2.1.49)	Shewanella sediminis HAW-EB3 Gene: Ssed_4447: urocanate hydratase (EC 4.2.1.49)	Shewanella woodyi ATCC 51908 Gene: Swoo_4838: urocanate hydratase (EC 4.2.1.49)	urocanate hydratase (EC 4.2.1.49)
hutH	Shewanella oneidensis MR-1 Gene: SO0098: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0080: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella sp W3-18-1 Gene: Sputw3181_3997: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella sp ANA-3 Gene: Shewana3_0101: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella sp MR-4 Gene: Shewmr4_0100: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella sp MR-7 Gene: Shewmr7_0095: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella baltica OS155 Gene: Sbal_4251: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella denitrificans OS217 Gene: Sden_0084: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3952: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella amazonensis SB2B Gene: Sama_1631: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella loihica PV-4 Gene: Shew_3756: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella pealeana ATCC 700345 Gene: Spea_4168: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0074: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella piezotolerans WP3 Gene: swp_0134: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella sediminis HAW-EB3 Gene: Ssed_4446: histidine ammonia-lyase (EC 4.3.1.3)	Shewanella woodyi ATCC 51908 Gene: Swoo_4837: histidine ammonia-lyase (EC 4.3.1.3)	histidine ammonia-lyase (EC 4.3.1.3)

CRON 28.
yfiA-2	* Shewanella oneidensis MR-1 Site: position = -78 score = 4.65624 sequence = AAGTGTGATTTAACTCTCGTTT Gene: SO3422: Ribosome hibernation protein YfiA	* Shewanella putrefaciens CN-32 Site: position = -77 score = 5.05406 sequence = TTTTGTGATTTAGATCTCGTTT Gene: Sputcn32_2740: Ribosome hibernation protein YfiA	* Shewanella sp W3-18-1 Site: position = -77 score = 5.05406 sequence = TTTTGTGATTTAGATCTCGTTT Gene: Sputw3181_1272: Ribosome hibernation protein YfiA	* Shewanella sp ANA-3 Site: position = -78 score = 5.07423 sequence = AAATGTGATTTAGATCTCGTTT Gene: Shewana3_1133: Ribosome hibernation protein YfiA	* Shewanella sp MR-4 Site: position = -78 score = 5.07423 sequence = AAATGTGATTTAGATCTCGTTT Gene: Shewmr4_1132: Ribosome hibernation protein YfiA	* Shewanella sp MR-7 Site: position = -78 score = 5.07423 sequence = AAATGTGATTTAGATCTCGTTT Gene: Shewmr7_1203: Ribosome hibernation protein YfiA	* Shewanella baltica OS155 Site: position = -77 score = 5.17724 sequence = AAATGTGATCTAGATCTCGTTT Gene: Sbal_1221: Ribosome hibernation protein YfiA	* Shewanella denitrificans OS217 Site: position = -77 score = 4.75052 sequence = AAGTGTGACTTTGATCACGCTT Site: position = -38 score = 4.14028 sequence = TAATCTGAAGTTAAGCACATAA Gene: Sden_2746: Ribosome hibernation protein YfiA	* Shewanella frigidimarina NCIMB 400 Site: position = -77 score = 5.02355 sequence = AAGTGTGATGCAGATCACTATT Gene: Sfri_2912: Ribosome hibernation protein YfiA	* Shewanella amazonensis SB2B Site: position = -78 score = 4.31728 sequence = AAACGTGATTTTACTCACGACT Gene: Sama_0899: Ribosome hibernation protein YfiA	* Shewanella loihica PV-4 Site: position = -76 score = 4.56203 sequence = AAAGTTGATCTAGATCACGTTT Gene: Shew_1073: Ribosome hibernation protein YfiA	* Shewanella pealeana ATCC 700345 Site: position = -76 score = 4.6428 sequence = AAACGTGATTTAGATCACGACT Gene: Spea_1060: Ribosome hibernation protein YfiA	2 Shewanella halifaxensis HAW-EB4* Site: position = -83 score = 4.63076 sequence = AAACATGACCTAGATCACACTA Site: position = -58 score = 3.78531 sequence = TAATGTGATTGGACTATTGTAA Gene: Shal_4284: Ribosome hibernation protein YfiA Site: position = -76 score = 4.6428 sequence = AAACGTGATTTAGATCACGACT Gene: Shal_1108: Ribosome hibernation protein YfiA	* Shewanella piezotolerans WP3 Site: position = -76 score = 4.6428 sequence = AAACGTGATTTAGATCACGACT Gene: swp_3757: Ribosome hibernation protein YfiA	* Shewanella sediminis HAW-EB3 Site: position = -222 score = 3.83618 sequence = TTTTGAGAGGCAAATAAAAAAA Site: position = -76 score = 4.6428 sequence = AAACGTGATTTAGATCACGACT Gene: Ssed_1169: Ribosome hibernation protein YfiA	* Shewanella woodyi ATCC 51908 Site: position = -76 score = 4.50549 sequence = AAACGTGATCAAGATCACGACT Gene: Swoo_1264: Ribosome hibernation protein YfiA	Ribosome hibernation protein YfiA

CRON 29.
fahA	* Shewanella oneidensis MR-1 Site: position = -200 score = 5.1279 sequence = AAATGTGATTTTGTTCACGCTA Gene: SO1670: Fumarylacetoacetate hydrolase family protein	* Shewanella putrefaciens CN-32 Site: position = -229 score = 4.9676 sequence = AAATGTGATTTGTGTCACGCTA Gene: Sputcn32_1389: Fumarylacetoacetate hydrolase family protein	* Shewanella sp W3-18-1 Site: position = -229 score = 4.9676 sequence = AAATGTGATTTGTGTCACGCTA Gene: Sputw3181_2712: Fumarylacetoacetate hydrolase family protein	* Shewanella sp ANA-3 Site: position = -197 score = 5.08159 sequence = AAATGTGATTTTGCTCACGCTA Gene: Shewana3_2778: Fumarylacetoacetate hydrolase family protein	* Shewanella sp MR-4 Site: position = -196 score = 5.08159 sequence = AAATGTGATTTTGCTCACGCTA Gene: Shewmr4_2604: Fumarylacetoacetate hydrolase family protein	* Shewanella sp MR-7 Site: position = -196 score = 5.08159 sequence = AAATGTGATTTTGCTCACGCTA Gene: Shewmr7_2671: Fumarylacetoacetate hydrolase family protein	* Shewanella baltica OS155 Site: position = -235 score = 4.96603 sequence = AAATGTGATTTTGGTCACGCTA Gene: Sbal_1487: Fumarylacetoacetate hydrolase family protein	* Shewanella denitrificans OS217 Site: position = -107 score = 4.65138 sequence = AAATGTGATTTTGCGCACGCTA Gene: Sden_2592: Fumarylacetoacetate hydrolase family protein	* Shewanella frigidimarina NCIMB 400 Site: position = -116 score = 4.13475 sequence = AAATGTGATTTGGTACTTACTA Gene: Sfri_1331: Fumarylacetoacetate hydrolase family protein	* Shewanella amazonensis SB2B Site: position = -111 score = 4.95014 sequence = AATTGTGATTTGAGTCACGCTA Gene: Sama_2219: Fumarylacetoacetate hydrolase family protein	* Shewanella loihica PV-4 Site: position = -130 score = 4.38301 sequence = GAGTGTGATTTGTATCACGCTA Gene: Shew_1438: Fumarylacetoacetate hydrolase family protein	* Shewanella pealeana ATCC 700345 Site: position = -158 score = 5.26583 sequence = AAGTGTGATTTCGTTCACACTA Gene: Spea_1451: Fumarylacetoacetate hydrolase family protein	* Shewanella halifaxensis HAW-EB4 Site: position = -144 score = 4.54594 sequence = CAGTGTGATTTATCTCACGCTA Gene: Shal_1534: Fumarylacetoacetate hydrolase family protein	* Shewanella piezotolerans WP3 Site: position = -140 score = 4.9957 sequence = TAGTGTGATTTAGCTCACGCTA Gene: swp_1653: Fumarylacetoacetate hydrolase family protein	* Shewanella sediminis HAW-EB3 Site: position = -116 score = 4.14612 sequence = GAGCGTGATTCATGTCACACTA Gene: Ssed_2927: Fumarylacetoacetate hydrolase family protein	* Shewanella woodyi ATCC 51908 Site: position = -133 score = 4.9966 sequence = TATTGTGATTTGTGTCACGCTA Gene: Swoo_1718: Fumarylacetoacetate hydrolase family protein	Fumarylacetoacetate hydrolase family protein
maiA	Shewanella oneidensis MR-1 Gene: SO1671: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella putrefaciens CN-32 Gene: Sputcn32_1390: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella sp W3-18-1 Gene: Sputw3181_2711: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella sp ANA-3 Gene: Shewana3_2777: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella sp MR-4 Gene: Shewmr4_2603: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella sp MR-7 Gene: Shewmr7_2670: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella baltica OS155 Gene: Sbal_1488: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella denitrificans OS217 Gene: Sden_2591: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1332: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella amazonensis SB2B Gene: Sama_2218: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella loihica PV-4 Gene: Shew_1439: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella pealeana ATCC 700345 Gene: Spea_1452: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella halifaxensis HAW-EB4 Gene: Shal_1535: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella piezotolerans WP3 Gene: swp_1654: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella sediminis HAW-EB3 Gene: Ssed_2926: Maleylacetoacetate isomerase (EC 5.2.1.2)	Shewanella woodyi ATCC 51908 Gene: Swoo_1719: Maleylacetoacetate isomerase (EC 5.2.1.2)	Maleylacetoacetate isomerase (EC 5.2.1.2)

CRON 30.
purH	* Shewanella oneidensis MR-1 Site: position = -180 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: SO0442: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella putrefaciens CN-32 Site: position = -193 score = 3.99458 sequence = TATTGTGAAATCACGCAGAAAA Gene: Sputcn32_3401: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella sp W3-18-1 Site: position = -193 score = 3.99458 sequence = TATTGTGAAATCACGCAGAAAA Gene: Sputw3181_0542: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella sp ANA-3 Site: position = -181 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: Shewana3_0441: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella sp MR-4 Site: position = -181 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: Shewmr4_0445: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella sp MR-7 Site: position = -181 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: Shewmr7_3584: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella baltica OS155 Site: position = -195 score = 3.99458 sequence = TATTGTGAAATCACGCAGAAAA Gene: Sbal_0420: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	Shewanella denitrificans OS217 Gene: Sden_3407: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella frigidimarina NCIMB 400 Site: position = -195 score = 3.89434 sequence = TATTGTGAAATCACACAGAAAA Gene: Sfri_0493: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella amazonensis SB2B Site: position = -194 score = 3.99458 sequence = TATTGTGAAATCACGCAGAAAA Gene: Sama_0395: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella loihica PV-4 Site: position = -182 score = 4.00632 sequence = TATTGTGAAATCGCACAGAAAA Gene: Shew_3412: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella pealeana ATCC 700345 Site: position = -181 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: Spea_0432: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella halifaxensis HAW-EB4 Site: position = -182 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: Shal_0488: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella piezotolerans WP3 Site: position = -181 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: swp_4724: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella sediminis HAW-EB3 Site: position = -282 score = 4.04029 sequence = GAGTGTGACGCTCTGCACAAAT Site: position = -191 score = 4.15287 sequence = TATTGTGAAATCGTGCAGAAAA Gene: Ssed_0444: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	* Shewanella woodyi ATCC 51908 Site: position = -192 score = 3.55881 sequence = TATTGTGAAATCACATATAAAT Gene: Swoo_0296: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)	IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
purD	Shewanella oneidensis MR-1 Gene: SO0441: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella putrefaciens CN-32 Gene: Sputcn32_3402: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella sp W3-18-1 Gene: Sputw3181_0541: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella sp ANA-3 Gene: Shewana3_0440: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella sp MR-4 Gene: Shewmr4_0444: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella sp MR-7 Gene: Shewmr7_3585: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella baltica OS155 Gene: Sbal_0419: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella denitrificans OS217 Gene: Sden_3406: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0492: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella amazonensis SB2B Gene: Sama_0394: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella loihica PV-4 Gene: Shew_3413: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella pealeana ATCC 700345 Gene: Spea_0431: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0487: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella piezotolerans WP3 Gene: swp_4725: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella sediminis HAW-EB3 Gene: Ssed_0443: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Shewanella woodyi ATCC 51908 Gene: Swoo_0295: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)	Phosphoribosylamine--glycine ligase (EC 6.3.4.13)

CRON 31.
SO1328	* Shewanella oneidensis MR-1 Site: position = -109 score = 3.99519 sequence = AAAATCGATTTTGCTCACACAA Gene: SO1328: transcriptional regulator, LysR family	* Shewanella putrefaciens CN-32 Site: position = -109 score = 3.84964 sequence = AATGGCGATTCTGCTCACACTC Gene: Sputcn32_1139: transcriptional regulator, LysR family	* Shewanella sp W3-18-1 Site: position = -109 score = 3.92332 sequence = AATGGCGATTCGGCTCACACTC Gene: Sputw3181_3025: transcriptional regulator, LysR family	* Shewanella sp ANA-3 Site: position = -109 score = 3.89004 sequence = AAAATCGATTTTGCTCACAGTA Gene: Shewana3_3046: transcriptional regulator, LysR family	* Shewanella sp MR-4 Site: position = -109 score = 3.99519 sequence = AAAATCGATTTTGCTCACACTA Gene: Shewmr4_2868: transcriptional regulator, LysR family	* Shewanella sp MR-7 Site: position = -109 score = 3.99519 sequence = AAAATCGATTTTGCTCACACAA Gene: Shewmr7_2950: transcriptional regulator, LysR family	Shewanella baltica OS155 Gene: Sbal_1181: transcriptional regulator, LysR family	Shewanella denitrificans OS217 Gene: Sden_2788: transcriptional regulator, LysR family	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2948: transcriptional regulator, LysR family	Shewanella amazonensis SB2B Gene: Sama_0860: transcriptional regulator, LysR family	* Shewanella loihica PV-4 Site: position = -110 score = 3.79618 sequence = TTTTGGGCAGCGCTTCACACTT Gene: Shew_1035: transcriptional regulator, LysR family	* Shewanella pealeana ATCC 700345 Site: position = -89 score = 4.81238 sequence = ATTTTTGATTCAGTTCACAAAC Gene: Spea_1016: transcriptional regulator, LysR family	* Shewanella halifaxensis HAW-EB4 Site: position = -89 score = 4.59212 sequence = ATTTTTGATTCAGTTCACAGTC Gene: Shal_1064: transcriptional regulator, LysR family	Shewanella piezotolerans WP3 Gene: swp_3799: transcriptional regulator, LysR family	Shewanella sediminis HAW-EB3 Gene: Ssed_1129: transcriptional regulator, LysR family	* Shewanella woodyi ATCC 51908 Site: position = -111 score = 4.29044 sequence = ATTTTAGAGATAGCTCACATTT Gene: Swoo_1224: transcriptional regulator, LysR family	transcriptional regulator, LysR family

CRON 32.
SO1389	* Shewanella oneidensis MR-1 Site: position = -150 score = 3.77881 sequence = AACTGTTAGCTTTATCACTCAA Gene: SO1389: ROK family protein, in a cluster with chitinase	Shewanella putrefaciens CN-32 Gene: Sputcn32_1199: ROK family protein, in a cluster with chitinase	Shewanella sp W3-18-1 Gene: Sputw3181_2965: ROK family protein, in a cluster with chitinase	* Shewanella sp ANA-3 Site: position = -150 score = 4.19521 sequence = AAATGTTATCTTTATCACTCAG Gene: Shewana3_2985: ROK family protein, in a cluster with chitinase	* Shewanella sp MR-4 Site: position = -150 score = 4.19521 sequence = AAATGTTATCTTTATCACTCAG Gene: Shewmr4_2806: ROK family protein, in a cluster with chitinase	* Shewanella sp MR-7 Site: position = -150 score = 4.50488 sequence = AAATGTTATCTTTATCACTCAA Gene: Shewmr7_2889: ROK family protein, in a cluster with chitinase	* Shewanella baltica OS155 Site: position = -180 score = 4.37027 sequence = TTGTGTGATTCTTAGCATAAAA Gene: Sbal_3084: ROK family protein, in a cluster with chitinase	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_0686: ROK family protein, in a cluster with chitinase	Shewanella loihica PV-4 Gene: Shew_0954: ROK family protein, in a cluster with chitinase	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3 Gene: swp_4198: ROK family protein, in a cluster with chitinase	Shewanella sediminis HAW-EB3 Gene: Ssed_1026: ROK family protein, in a cluster with chitinase	Shewanella woodyi ATCC 51908 Gene: Swoo_1098: ROK family protein, in a cluster with chitinase	ROK family protein, in a cluster with chitinase

CRON 33.
ilvC	* Shewanella oneidensis MR-1 Site: position = -86 score = 4.04611 sequence = TATAGTGACTTCAATCACAACC Gene: SO4349: Ketol-acid reductoisomerase (EC 1.1.1.86)	* Shewanella putrefaciens CN-32 Site: position = -86 score = 4.30275 sequence = TATAGTGATTTCAATCACAACC Gene: Sputcn32_3615: Ketol-acid reductoisomerase (EC 1.1.1.86)	* Shewanella sp W3-18-1 Site: position = -86 score = 4.30275 sequence = TATAGTGATTTCAATCACAACC Gene: Sputw3181_3755: Ketol-acid reductoisomerase (EC 1.1.1.86)	* Shewanella sp ANA-3 Site: position = -86 score = 4.30275 sequence = TATAGTGATTTCAATCACAACC Gene: Shewana3_0355: Ketol-acid reductoisomerase (EC 1.1.1.86)	* Shewanella sp MR-4 Site: position = -86 score = 4.30275 sequence = TATAGTGATTTCAATCACAACC Gene: Shewmr4_0361: Ketol-acid reductoisomerase (EC 1.1.1.86)	* Shewanella sp MR-7 Site: position = -86 score = 4.30275 sequence = TATAGTGATTTCAATCACAACC Gene: Shewmr7_3665: Ketol-acid reductoisomerase (EC 1.1.1.86)	* Shewanella baltica OS155 Site: position = -85 score = 4.30275 sequence = TATAGTGATTTCAATCACAACC Gene: Sbal_4032: Ketol-acid reductoisomerase (EC 1.1.1.86)	Shewanella denitrificans OS217 Gene: Sden_3415: Ketol-acid reductoisomerase (EC 1.1.1.86)	* Shewanella frigidimarina NCIMB 400 Site: position = -85 score = 4.07903 sequence = TATAGTGACTTCAATCACAACG Gene: Sfri_0421: Ketol-acid reductoisomerase (EC 1.1.1.86)	* Shewanella amazonensis SB2B Site: position = -88 score = 4.41971 sequence = TATAGTGAGTTCAATCACAATC Gene: Sama_3282: Ketol-acid reductoisomerase (EC 1.1.1.86)	* Shewanella loihica PV-4 Site: position = -77 score = 3.80381 sequence = ATAGTTGATCTCATTCACAGCT Site: position = -126 score = 3.74563 sequence = CAATGTGACGTTTCGAATATAT Gene: Shew_0288: Ketol-acid reductoisomerase (EC 1.1.1.86)	Shewanella pealeana ATCC 700345 Gene: Spea_0344: Ketol-acid reductoisomerase (EC 1.1.1.86)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3945: Ketol-acid reductoisomerase (EC 1.1.1.86)	* Shewanella piezotolerans WP3 Site: position = -77 score = 4.55657 sequence = TATAGTGATCTCAATCACAGCT Gene: swp_0358: Ketol-acid reductoisomerase (EC 1.1.1.86)	* Shewanella sediminis HAW-EB3 Site: position = -78 score = 4.0039 sequence = TATAGTGATCTCAATCACTGCT Gene: Ssed_4166: Ketol-acid reductoisomerase (EC 1.1.1.86)	* Shewanella woodyi ATCC 51908 Site: position = -78 score = 3.49429 sequence = TATAGTGAATTCAATCACTGCT Gene: Swoo_0441: Ketol-acid reductoisomerase (EC 1.1.1.86)	Ketol-acid reductoisomerase (EC 1.1.1.86)

CRON 34.
SO3090	* Shewanella oneidensis MR-1 Site: position = -165 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: SO3090: MoxR-like ATPase in aerotolerance operon	* Shewanella putrefaciens CN-32 Site: position = -97 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Sputcn32_2461: MoxR-like ATPase in aerotolerance operon	* Shewanella sp W3-18-1 Site: position = -97 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Sputw3181_1547: MoxR-like ATPase in aerotolerance operon	* Shewanella sp ANA-3 Site: position = -160 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Shewana3_1459: MoxR-like ATPase in aerotolerance operon	* Shewanella sp MR-4 Site: position = -160 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Shewmr4_1406: MoxR-like ATPase in aerotolerance operon	* Shewanella sp MR-7 Site: position = -160 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Shewmr7_1471: MoxR-like ATPase in aerotolerance operon	* Shewanella baltica OS155 Site: position = -148 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Sbal_2762: MoxR-like ATPase in aerotolerance operon	* Shewanella denitrificans OS217 Site: position = -157 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Sden_1528: MoxR-like ATPase in aerotolerance operon	* Shewanella frigidimarina NCIMB 400 Site: position = -167 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Sfri_2678: MoxR-like ATPase in aerotolerance operon	* Shewanella amazonensis SB2B Site: position = -137 score = 4.23195 sequence = AAGTGTGACCCGATTCTAACTT Gene: Sama_2169: MoxR-like ATPase in aerotolerance operon	* Shewanella loihica PV-4 Site: position = -296 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Shew_2427: MoxR-like ATPase in aerotolerance operon	* Shewanella pealeana ATCC 700345 Site: position = -306 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Spea_2600: MoxR-like ATPase in aerotolerance operon	* Shewanella halifaxensis HAW-EB4 Site: position = -319 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Shal_2672: MoxR-like ATPase in aerotolerance operon	* Shewanella piezotolerans WP3 Site: position = -97 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: swp_3141: MoxR-like ATPase in aerotolerance operon	* Shewanella sediminis HAW-EB3 Site: position = -316 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Ssed_1627: MoxR-like ATPase in aerotolerance operon	* Shewanella woodyi ATCC 51908 Site: position = -306 score = 4.78219 sequence = AAATGTGATCTGATTCTAACTT Gene: Swoo_3028: MoxR-like ATPase in aerotolerance operon	MoxR-like ATPase in aerotolerance operon
SO3091	Shewanella oneidensis MR-1 Gene: SO3091: Conserved hypothetical protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_2462: Conserved hypothetical protein	Shewanella sp W3-18-1 Gene: Sputw3181_1546: Conserved hypothetical protein	Shewanella sp ANA-3 Gene: Shewana3_1458: Conserved hypothetical protein	Shewanella sp MR-4 Gene: Shewmr4_1405: Conserved hypothetical protein	Shewanella sp MR-7 Gene: Shewmr7_1470: Conserved hypothetical protein	Shewanella baltica OS155 Gene: Sbal_2763: Conserved hypothetical protein	Shewanella denitrificans OS217 Gene: Sden_1527: Conserved hypothetical protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2679: Conserved hypothetical protein	Shewanella amazonensis SB2B Gene: Sama_2170: Conserved hypothetical protein	Shewanella loihica PV-4 Gene: Shew_2428: Conserved hypothetical protein	Shewanella pealeana ATCC 700345 Gene: Spea_2601: Conserved hypothetical protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_2673: Conserved hypothetical protein	Shewanella piezotolerans WP3 Gene: swp_3143: Conserved hypothetical protein	Shewanella sediminis HAW-EB3 Gene: Ssed_1626: Conserved hypothetical protein	Shewanella woodyi ATCC 51908 Gene: Swoo_3029: Conserved hypothetical protein	Conserved hypothetical protein
SO3092	Shewanella oneidensis MR-1 Gene: SO3092: hypothetical protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_2463: hypothetical protein	Shewanella sp W3-18-1 Gene: Sputw3181_1545: hypothetical protein	Shewanella sp ANA-3 Gene: Shewana3_1457: hypothetical protein	Shewanella sp MR-4 Gene: Shewmr4_1404: hypothetical protein	Shewanella sp MR-7 Gene: Shewmr7_1469: hypothetical protein	Shewanella baltica OS155 Gene: Sbal_2764: hypothetical protein	Shewanella denitrificans OS217 Gene: Sden_1526: hypothetical protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2680: hypothetical protein	Shewanella amazonensis SB2B Gene: Sama_2171: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_2429: hypothetical protein	Shewanella pealeana ATCC 700345 Gene: Spea_2602: hypothetical protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_2674: hypothetical protein	Shewanella piezotolerans WP3 Gene: swp_3144: hypothetical protein	Shewanella sediminis HAW-EB3 Gene: Ssed_1625: hypothetical protein	Shewanella woodyi ATCC 51908 Gene: Swoo_3030: hypothetical protein	hypothetical protein
SO3093	Shewanella oneidensis MR-1 Gene: SO3093: von Willebrand factor type A domain protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_2464: von Willebrand factor type A domain protein	Shewanella sp W3-18-1 Gene: Sputw3181_1544: von Willebrand factor type A domain protein	Shewanella sp ANA-3 Gene: Shewana3_1456: von Willebrand factor type A domain protein	Shewanella sp MR-4 Gene: Shewmr4_1403: von Willebrand factor type A domain protein	Shewanella sp MR-7 Gene: Shewmr7_1468: von Willebrand factor type A domain protein	Shewanella baltica OS155 Gene: Sbal_2765: von Willebrand factor type A domain protein	Shewanella denitrificans OS217 Gene: Sden_1525: von Willebrand factor type A domain protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2681: von Willebrand factor type A domain protein	Shewanella amazonensis SB2B Gene: Sama_2172: von Willebrand factor type A domain protein	Shewanella loihica PV-4 Gene: Shew_2430: von Willebrand factor type A domain protein	Shewanella pealeana ATCC 700345 Gene: Spea_2603: von Willebrand factor type A domain protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_2675: von Willebrand factor type A domain protein	Shewanella piezotolerans WP3 Gene: swp_3145: von Willebrand factor type A domain protein	Shewanella sediminis HAW-EB3 Gene: Ssed_1624: von Willebrand factor type A domain protein	Shewanella woodyi ATCC 51908 Gene: Swoo_3031: von Willebrand factor type A domain protein	von Willebrand factor type A domain protein
SO3094	Shewanella oneidensis MR-1 Gene: SO3094: TPR domain protein in aerotolerance operon	Shewanella putrefaciens CN-32 Gene: Sputcn32_2465: TPR domain protein in aerotolerance operon	Shewanella sp W3-18-1 Gene: Sputw3181_1543: TPR domain protein in aerotolerance operon	Shewanella sp ANA-3 Gene: Shewana3_1455: TPR domain protein in aerotolerance operon	Shewanella sp MR-4 Gene: Shewmr4_1402: TPR domain protein in aerotolerance operon	Shewanella sp MR-7 Gene: Shewmr7_1467: TPR domain protein in aerotolerance operon	Shewanella baltica OS155 Gene: Sbal_2766: TPR domain protein in aerotolerance operon	Shewanella denitrificans OS217 Gene: Sden_1524: TPR domain protein in aerotolerance operon	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2682: TPR domain protein in aerotolerance operon	Shewanella amazonensis SB2B Gene: Sama_2173: TPR domain protein in aerotolerance operon	Shewanella loihica PV-4 Gene: Shew_2431: TPR domain protein in aerotolerance operon	Shewanella pealeana ATCC 700345 Gene: Spea_2604: TPR domain protein in aerotolerance operon	Shewanella halifaxensis HAW-EB4 Gene: Shal_2676: TPR domain protein in aerotolerance operon	Shewanella piezotolerans WP3 Gene: swp_3146: TPR domain protein in aerotolerance operon	Shewanella sediminis HAW-EB3 Gene: Ssed_1623: TPR domain protein in aerotolerance operon	Shewanella woodyi ATCC 51908 Gene: Swoo_3032: TPR domain protein in aerotolerance operon	TPR domain protein in aerotolerance operon
SO3095	Shewanella oneidensis MR-1 Gene: SO3095: hypothetical protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_2466: hypothetical protein	Shewanella sp W3-18-1 Gene: Sputw3181_1542: hypothetical protein	Shewanella sp ANA-3 Gene: Shewana3_1454: hypothetical protein	Shewanella sp MR-4 Gene: Shewmr4_1401: hypothetical protein	Shewanella sp MR-7 Gene: Shewmr7_1466: hypothetical protein	Shewanella baltica OS155 Gene: Sbal_2767: hypothetical protein	Shewanella denitrificans OS217 Gene: Sden_1523: hypothetical protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2683: hypothetical protein	Shewanella amazonensis SB2B Gene: Sama_2174: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_2432: hypothetical protein	Shewanella pealeana ATCC 700345 Gene: Spea_2605: hypothetical protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_2677: hypothetical protein	Shewanella piezotolerans WP3 Gene: swp_3148: hypothetical protein	Shewanella sediminis HAW-EB3 Gene: Ssed_1622: hypothetical protein	Shewanella woodyi ATCC 51908 Gene: Swoo_3033: hypothetical protein	hypothetical protein

CRON 35.
crp	* Shewanella oneidensis MR-1 Site: position = -174 score = 3.54123 sequence = TTAGTTGACTAATATCACTAAA Gene: SO0624: Cyclic AMP receptor protein Crp	* Shewanella putrefaciens CN-32 Site: position = -174 score = 3.54123 sequence = TTAGTTGACTAATATCACTAAA Gene: Sputcn32_0652: Cyclic AMP receptor protein Crp	* Shewanella sp W3-18-1 Site: position = -174 score = 3.54123 sequence = TTAGTTGACTAATATCACTAAA Gene: Sputw3181_3522: Cyclic AMP receptor protein Crp	* Shewanella sp ANA-3 Site: position = -174 score = 3.54123 sequence = TTAGTTGACTAATATCACTAAA Gene: Shewana3_0617: Cyclic AMP receptor protein Crp	* Shewanella sp MR-4 Site: position = -174 score = 3.54123 sequence = TTAGTTGACTAATATCACTAAA Gene: Shewmr4_0618: Cyclic AMP receptor protein Crp	* Shewanella sp MR-7 Site: position = -174 score = 3.54123 sequence = TTAGTTGACTAATATCACTAAA Gene: Shewmr7_3412: Cyclic AMP receptor protein Crp	* Shewanella baltica OS155 Site: position = -174 score = 3.74166 sequence = TTAGTTGACTTAAATCACTAAA Gene: Sbal_0578: Cyclic AMP receptor protein Crp	* Shewanella denitrificans OS217 Site: position = -94 score = 3.5727 sequence = AAACACGATCTTGGTCAAAGTT Gene: Sden_3190: Cyclic AMP receptor protein Crp	* Shewanella frigidimarina NCIMB 400 Site: position = -97 score = 4.02903 sequence = AAATACGATCTCTATCAAAGTT Gene: Sfri_3292: Cyclic AMP receptor protein Crp	* Shewanella amazonensis SB2B Site: position = -96 score = 3.77298 sequence = AATTTCGATCTGCATCATGGTT Gene: Sama_3004: Cyclic AMP receptor protein Crp	* Shewanella loihica PV-4 Site: position = -238 score = 4.04133 sequence = AGATGTGATATGGGCAACATTG Gene: Shew_0585: Cyclic AMP receptor protein Crp	* Shewanella pealeana ATCC 700345 Site: position = -225 score = 3.58749 sequence = AGATGTGATATAAGCCTAATTG Gene: Spea_3509: Cyclic AMP receptor protein Crp	* Shewanella halifaxensis HAW-EB4 Site: position = -226 score = 3.49835 sequence = AGATGTGATACAAGCCTAATTG Gene: Shal_3603: Cyclic AMP receptor protein Crp	* Shewanella piezotolerans WP3 Site: position = -309 score = 4.17988 sequence = TTTATTGATAAGGTTCAAAAAA Gene: swp_0755: Cyclic AMP receptor protein Crp	* Shewanella sediminis HAW-EB3 Site: position = -173 score = 3.81001 sequence = TTAGTTGACTTATATCACTAAT Gene: Ssed_3873: Cyclic AMP receptor protein Crp	* Shewanella woodyi ATCC 51908 Site: position = -173 score = 3.81001 sequence = TTAGTTGACTTATATCACTAAT Gene: Swoo_0662: Cyclic AMP receptor protein Crp	Cyclic AMP receptor protein Crp

CRON 36.
SO2858	* Shewanella oneidensis MR-1 Site: position = -105 score = 4.82761 sequence = TATTGTGAGTAAGTTCGCAAAT Gene: SO2858: hypothetical protein	* Shewanella putrefaciens CN-32 Site: position = -75 score = 4.21636 sequence = AGTCGTGATTGTGCTCACACCA Gene: Sputcn32_2359: hypothetical protein	* Shewanella sp W3-18-1 Site: position = -75 score = 4.21636 sequence = AGTCGTGATTGTGCTCACACCA Gene: Sputw3181_1650: hypothetical protein	* Shewanella sp ANA-3 Site: position = -105 score = 4.03554 sequence = GGATGTGAGCCGCTTCGCAAAT Gene: Shewana3_1574: hypothetical protein	* Shewanella sp MR-4 Site: position = -105 score = 3.93606 sequence = CCGTGTGAGGTATTTCGCAAAT Gene: Shewmr4_1513: hypothetical protein	* Shewanella sp MR-7 Site: position = -105 score = 3.93606 sequence = CCGTGTGAGGTATTTCGCAAAT Gene: Shewmr7_1580: hypothetical protein	* Shewanella baltica OS155 Site: position = -75 score = 4.21636 sequence = AGTCGTGATTGTGCTCACACCA Gene: Sbal_2639: hypothetical protein	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -237 score = 4.94252 sequence = TTTTGTGATGCAGATCTCAATC Gene: Sfri_1546: hypothetical protein	Shewanella amazonensis SB2B Gene: Sama_1522: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_2372: hypothetical protein	Shewanella pealeana ATCC 700345 Gene: Spea_1695: hypothetical protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_2566: hypothetical protein	Shewanella piezotolerans WP3 Gene: swp_1973: hypothetical protein	Shewanella sediminis HAW-EB3 Gene: Ssed_1745: hypothetical protein	Shewanella woodyi ATCC 51908 Gene: Swoo_2839: hypothetical protein	hypothetical protein
SO2857	Shewanella oneidensis MR-1 Gene: SO2857: sodium solute symporter family protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_2358: sodium solute symporter family protein	Shewanella sp W3-18-1 Gene: Sputw3181_1651: sodium solute symporter family protein	Shewanella sp ANA-3 Gene: Shewana3_1575: sodium solute symporter family protein	Shewanella sp MR-4 Gene: Shewmr4_1514: sodium solute symporter family protein	Shewanella sp MR-7 Gene: Shewmr7_1581: sodium solute symporter family protein	Shewanella baltica OS155 Gene: Sbal_2638: sodium solute symporter family protein	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1547: sodium solute symporter family protein	Shewanella amazonensis SB2B Gene: Sama_1523: sodium solute symporter family protein	Shewanella loihica PV-4 Gene: Shew_2371: sodium solute symporter family protein	Shewanella pealeana ATCC 700345 Gene: Spea_1696: sodium solute symporter family protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_2565: sodium solute symporter family protein	Shewanella piezotolerans WP3 Gene: swp_1974: sodium solute symporter family protein	Shewanella sediminis HAW-EB3 Gene: Ssed_1746: sodium solute symporter family protein	Shewanella woodyi ATCC 51908 Gene: Swoo_2838: sodium solute symporter family protein	sodium solute symporter family protein
SO2856	Shewanella oneidensis MR-1 Gene: SO2856: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella putrefaciens CN-32 Gene: Sputcn32_2357: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella sp W3-18-1 Gene: Sputw3181_1652: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella sp ANA-3 Gene: Shewana3_1576: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella sp MR-4 Gene: Shewmr4_1515: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella sp MR-7 Gene: Shewmr7_1582: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella baltica OS155 Gene: Sbal_2637: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1548: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella amazonensis SB2B Gene: Sama_1524: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella loihica PV-4 Gene: Shew_2369: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella pealeana ATCC 700345 Gene: Spea_1697: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella halifaxensis HAW-EB4 Gene: Shal_2564: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella piezotolerans WP3 Gene: swp_1975: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella sediminis HAW-EB3 Gene: Ssed_1751: predicted signal-transduction protein containing cAMP-binding and CBS domains	Shewanella woodyi ATCC 51908 Gene: Swoo_2835: predicted signal-transduction protein containing cAMP-binding and CBS domains	predicted signal-transduction protein containing cAMP-binding and CBS domains
SO2855	Shewanella oneidensis MR-1 Gene: SO2855: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella putrefaciens CN-32 Gene: Sputcn32_2356: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella sp W3-18-1 Gene: Sputw3181_1653: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella sp ANA-3 Gene: Shewana3_1577: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella sp MR-4 Gene: Shewmr4_1516: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella sp MR-7 Gene: Shewmr7_1583: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella baltica OS155 Gene: Sbal_2636: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1549: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella amazonensis SB2B Gene: Sama_1525: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella loihica PV-4 Gene: Shew_2368: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella pealeana ATCC 700345 Gene: Spea_1698: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella halifaxensis HAW-EB4 Gene: Shal_2563: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella piezotolerans WP3 Gene: swp_1976: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella sediminis HAW-EB3 Gene: Ssed_1752: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Shewanella woodyi ATCC 51908 Gene: Swoo_2834: DNA polymerase III epsilon subunit (EC 2.7.7.7)	DNA polymerase III epsilon subunit (EC 2.7.7.7)
SO2854	Shewanella oneidensis MR-1 Gene: SO2854: hypothetical protein	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3 Gene: Shewana3_1580: hypothetical protein	Shewanella sp MR-4 Gene: Shewmr4_1519: hypothetical protein	Shewanella sp MR-7 Gene: Shewmr7_1586: hypothetical protein	Shewanella baltica OS155 Gene: Sbal_2635: hypothetical protein	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_1526: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_2367: hypothetical protein	Shewanella pealeana ATCC 700345 Gene: Spea_1699: hypothetical protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_2560: hypothetical protein	Shewanella piezotolerans WP3 Gene: swp_1979: hypothetical protein	Shewanella sediminis HAW-EB3 Gene: Ssed_1755: hypothetical protein	Shewanella woodyi ATCC 51908 Gene: Swoo_2832: hypothetical protein	hypothetical protein

CRON 37.
SO4142	* Shewanella oneidensis MR-1 Site: position = -121 score = 3.92872 sequence = GAAAGTGACACACCTCAAATAA Gene: SO4142: cytochrome c family protein	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	* Shewanella sp ANA-3 Site: position = -118 score = 4.18536 sequence = GAAAGTGATACACCTCAAATAA Gene: Shewana3_3688: cytochrome c family protein	* Shewanella sp MR-4 Site: position = -118 score = 4.18536 sequence = GAAAGTGATACACCTCAAATAA Gene: Shewmr4_3511: cytochrome c family protein	* Shewanella sp MR-7 Site: position = -122 score = 4.00757 sequence = GAAGGTGATACACCTCAAATAA Gene: Shewmr7_0441: cytochrome c family protein	Shewanella baltica OS155	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -112 score = 4.02774 sequence = GGATATGATCTACTTCAAATTA Gene: Sfri_3554: cytochrome c family protein	* Shewanella amazonensis SB2B Site: position = -268 score = 3.8573 sequence = AAACGTCACATAGATCACACAC Gene: Sama_3178: cytochrome c family protein	* Shewanella loihica PV-4 Site: position = -113 score = 4.08943 sequence = GAAGGTGATCAACATCAAATTT Gene: Shew_0516: cytochrome c family protein	Shewanella pealeana ATCC 700345	* Shewanella halifaxensis HAW-EB4 Site: position = -289 score = 3.78179 sequence = AAGTGTGATCTAGATCTGTTAC Gene: Shal_0616: cytochrome c family protein	* Shewanella piezotolerans WP3 Site: position = -133 score = 3.98105 sequence = GAAAGTGATCGAGCTCAACTAT Gene: swp_4577: cytochrome c family protein	* Shewanella sediminis HAW-EB3 Site: position = -112 score = 4.68668 sequence = AAAGGTGATCAACATCAAATTT Gene: Ssed_4058: cytochrome c family protein	Shewanella woodyi ATCC 51908	cytochrome c family protein
SO4143	Shewanella oneidensis MR-1 Gene: SO4143: hypothetical protein	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3 Gene: Shewana3_3689: hypothetical protein	Shewanella sp MR-4 Gene: Shewmr4_3512: hypothetical protein	Shewanella sp MR-7 Gene: Shewmr7_0440: hypothetical protein	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3555: hypothetical protein	Shewanella amazonensis SB2B Gene: Sama_3179: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_0515: hypothetical protein	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4 Gene: Shal_0615: hypothetical protein	Shewanella piezotolerans WP3 Gene: swp_4578: hypothetical protein	Shewanella sediminis HAW-EB3 Gene: Ssed_4059: hypothetical protein	Shewanella woodyi ATCC 51908	hypothetical protein
SO4144	Shewanella oneidensis MR-1 Gene: SO4144: octaheme tetrathionate reductase	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3 Gene: Shewana3_3690: octaheme tetrathionate reductase	Shewanella sp MR-4 Gene: Shewmr4_3513: octaheme tetrathionate reductase	Shewanella sp MR-7 Gene: Shewmr7_0439: octaheme tetrathionate reductase	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3556: octaheme tetrathionate reductase	Shewanella amazonensis SB2B Gene: Sama_3180: octaheme tetrathionate reductase	Shewanella loihica PV-4 Gene: Shew_0514: octaheme tetrathionate reductase	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4 Gene: Shal_0614: octaheme tetrathionate reductase	Shewanella piezotolerans WP3 Gene: swp_4579: octaheme tetrathionate reductase	Shewanella sediminis HAW-EB3 Gene: Ssed_4060: octaheme tetrathionate reductase	Shewanella woodyi ATCC 51908	octaheme tetrathionate reductase

CRON 38.
Sputcn32_0539	Shewanella oneidensis MR-1	* Shewanella putrefaciens CN-32 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Sputcn32_0539: mechanosensitive ion channel	* Shewanella sp W3-18-1 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Sputw3181_3633: mechanosensitive ion channel	* Shewanella sp ANA-3 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Shewana3_3684: mechanosensitive ion channel	* Shewanella sp MR-4 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Shewmr4_3509: mechanosensitive ion channel	* Shewanella sp MR-7 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Shewmr7_0443: mechanosensitive ion channel	* Shewanella baltica OS155 Site: position = -95 score = 4.50296 sequence = TTACATGATACGCTTCACACAT Gene: Sbal_3856: mechanosensitive ion channel	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3406: mechanosensitive ion channel	Shewanella amazonensis SB2B Gene: Sama_0408: mechanosensitive ion channel	* Shewanella loihica PV-4 Site: position = -144 score = 4.10197 sequence = TTGCTTGATATGCTTCACGCTA Gene: Shew_3394: mechanosensitive ion channel	* Shewanella pealeana ATCC 700345 Site: position = -138 score = 4.08475 sequence = AAGCTTGATCCTCTTCACGCTA Gene: Spea_0457: mechanosensitive ion channel	* Shewanella halifaxensis HAW-EB4 Site: position = -137 score = 3.96946 sequence = AAGCATGATCCCCTTCACGCTA Gene: Shal_0532: mechanosensitive ion channel	Shewanella piezotolerans WP3 Gene: swp_4706: mechanosensitive ion channel	* Shewanella sediminis HAW-EB3 Site: position = -154 score = 4.16207 sequence = ATTCATGATCCACTTCACCTAG Gene: Ssed_0457: mechanosensitive ion channel	* Shewanella woodyi ATCC 51908 Site: position = -127 score = 3.85254 sequence = ATTCATGATCCTCTTCACGCAG Gene: Swoo_4512: mechanosensitive ion channel	mechanosensitive ion channel
SO4139	* Shewanella oneidensis MR-1 Site: position = -162 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: SO4139: tetratricopeptide repeat family protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_0538: tetratricopeptide repeat family protein	Shewanella sp W3-18-1 Gene: Sputw3181_3634: tetratricopeptide repeat family protein	Shewanella sp ANA-3 Gene: Shewana3_3685: tetratricopeptide repeat family protein	Shewanella sp MR-4 Gene: Shewmr4_3510: tetratricopeptide repeat family protein	Shewanella sp MR-7 Gene: Shewmr7_0442: tetratricopeptide repeat family protein	Shewanella baltica OS155 Gene: Sbal_3857: tetratricopeptide repeat family protein	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4 Gene: Shew_2985: tetratricopeptide repeat family protein	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	tetratricopeptide repeat family protein

CRON 39.
icd	* Shewanella oneidensis MR-1 Site: position = -149 score = 4.6768 sequence = ATTCGTGATATTGCTCACTATT Gene: SO1538: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella putrefaciens CN-32 Site: position = -148 score = 4.71092 sequence = AATCGTGATATCGCTCACTATT Gene: Sputcn32_1286: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella sp W3-18-1 Site: position = -148 score = 4.71092 sequence = AATCGTGATATCGCTCACTATT Gene: Sputw3181_2820: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella sp ANA-3 Site: position = -149 score = 4.72598 sequence = AATCGTGATATTGCTCACTATT Gene: Shewana3_2890: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella sp MR-4 Site: position = -149 score = 4.72598 sequence = AATCGTGATATTGCTCACTATT Gene: Shewmr4_2720: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella sp MR-7 Site: position = -149 score = 4.72598 sequence = AATCGTGATATTGCTCACTATT Gene: Shewmr7_2791: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella baltica OS155 Site: position = -149 score = 4.72598 sequence = AATCGTGATATTGCTCACTATT Gene: Sbal_1368: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella denitrificans OS217 Site: position = -143 score = 3.76803 sequence = AAAAGGGATATTTCTCACTAAT Gene: Sden_2561: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella frigidimarina NCIMB 400 Site: position = -148 score = 4.68422 sequence = TAATGTGATAATACTCACTATT Gene: Sfri_2779: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella amazonensis SB2B Site: position = -89 score = 4.51181 sequence = AATCGAGACATAAATCACATAA Gene: Sama_2423: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella loihica PV-4 Site: position = -150 score = 4.351 sequence = AAACGTGAGATTGCTCACTATT Gene: Shew_2760: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella pealeana ATCC 700345 Site: position = -146 score = 4.22084 sequence = AAACGTGAGATCGCTCACTCTT Gene: Spea_2980: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella halifaxensis HAW-EB4 Site: position = -149 score = 4.351 sequence = AAACGTGAGATTGCTCACTATT Gene: Shal_3069: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella piezotolerans WP3 Site: position = -293 score = 4.62867 sequence = AAACGTGAGATTGCTCACCTTT Gene: swp_3606: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella sediminis HAW-EB3 Site: position = -151 score = 4.67738 sequence = AAATGTGAGATTGCTCACTATT Gene: Ssed_3318: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	* Shewanella woodyi ATCC 51908 Site: position = -148 score = 4.26186 sequence = AAACGTGAGACTGCTCACTATT Gene: Swoo_3466: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)	Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)

CRON 40.
SO2427	* Shewanella oneidensis MR-1 Site: position = -319 score = 5.12428 sequence = AAGTGTGATTAAAATCACACTT Gene: SO2427: TonB-dependent receptor	* Shewanella putrefaciens CN-32 Site: position = -274 score = 4.02843 sequence = AAATGTTATTTTATTAACAGAG Site: position = -318 score = 5.67063 sequence = TAGTGTGATCTACATCACATAA Gene: Sputcn32_1940: TonB-dependent receptor	* Shewanella sp W3-18-1 Site: position = -318 score = 4.5504 sequence = GCGTGTGATCTATATCACATAA Gene: Sputw3181_2068: TonB-dependent receptor	* Shewanella sp ANA-3 Site: position = -276 score = 4.39394 sequence = AAATGTTATTTTCTTAACAGTT Site: position = -320 score = 5.24373 sequence = AAGTGTGACACACATCACATAT Gene: Shewana3_1958: TonB-dependent receptor	* Shewanella sp MR-4 Site: position = -275 score = 3.89706 sequence = AAATGTTATTTTATTAACAGCT Site: position = -319 score = 5.61222 sequence = AAATGTGATGTGCGTCACATTT Gene: Shewmr4_1903: TonB-dependent receptor	* Shewanella sp MR-7 Site: position = -319 score = 5.16364 sequence = AAGTGTGACGTGTGTCACATTT Site: position = -275 score = 4.33811 sequence = AAATGTTATTTTATTAACAGTA Gene: Shewmr7_2075: TonB-dependent receptor	* Shewanella baltica OS155 Site: position = -317 score = 5.12323 sequence = AAGCGTGATCTGTGTCACATTT Gene: Sbal_2044: TonB-dependent receptor	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -149 score = 5.04528 sequence = AAATGTGATGTTGTTCACATGT Site: position = -4 score = 4.14649 sequence = ATTCATGAGTTCAGTCACATTA Gene: Sfri_2416: TonB-dependent receptor	* Shewanella amazonensis SB2B Site: position = -301 score = 5.24601 sequence = AAGTGTGATGCACGTCACAAAA Site: position = -324 score = 3.80556 sequence = TTAATCGATATGGGTCACAGAA Gene: Sama_1838: TonB-dependent receptor	* Shewanella loihica PV-4 Site: position = -308 score = 5.09145 sequence = TTTTGTGATAATGGTCACACTT Gene: Shew_2074: TonB-dependent receptor	Shewanella pealeana ATCC 700345	* Shewanella halifaxensis HAW-EB4 Site: position = -199 score = 4.10655 sequence = ACTTGTGCTGTTTGTCACAATG Site: position = -306 score = 5.46305 sequence = AATTGTGATGCGCGTCACAATT Gene: Shal_1923: TonB-dependent receptor	* Shewanella piezotolerans WP3 Site: position = -310 score = 4.66904 sequence = AAGCGTGACCTGTGTCACACTT Gene: swp_2362: TonB-dependent receptor	* Shewanella sediminis HAW-EB3 Site: position = -316 score = 4.61719 sequence = TTTCGTGACGCGCGTCACAGTT Gene: Ssed_2036: TonB-dependent receptor	* Shewanella woodyi ATCC 51908 Site: position = -321 score = 4.8704 sequence = TTCTGTGACCTGTGTCACAAAA Gene: Swoo_2565: TonB-dependent receptor	TonB-dependent receptor

CRON 41.
SO1388	* Shewanella oneidensis MR-1 Site: position = -232 score = 4.12802 sequence = TTGAGTGATAAAGCTAACAGTT Gene: SO1388: Xaa-Pro aminopeptidase (EC 3.4.11.9)	Shewanella putrefaciens CN-32 Gene: Sputcn32_1198: Xaa-Pro aminopeptidase (EC 3.4.11.9)	Shewanella sp W3-18-1 Gene: Sputw3181_2966: Xaa-Pro aminopeptidase (EC 3.4.11.9)	* Shewanella sp ANA-3 Site: position = -233 score = 4.15463 sequence = CTGAGTGATAAAGATAACATTT Gene: Shewana3_2986: Xaa-Pro aminopeptidase (EC 3.4.11.9)	* Shewanella sp MR-4 Site: position = -233 score = 4.15463 sequence = CTGAGTGATAAAGATAACATTT Gene: Shewmr4_2807: Xaa-Pro aminopeptidase (EC 3.4.11.9)	* Shewanella sp MR-7 Site: position = -233 score = 4.53228 sequence = TTGAGTGATAAAGATAACATTT Gene: Shewmr7_2890: Xaa-Pro aminopeptidase (EC 3.4.11.9)	* Shewanella baltica OS155 Site: position = -234 score = 4.18258 sequence = TTTTATGCTAAGAATCACACAA Gene: Sbal_3085: Xaa-Pro aminopeptidase (EC 3.4.11.9)	* Shewanella denitrificans OS217 Site: position = -161 score = 3.69078 sequence = TATTGTATACAATATCACGTTA Gene: Sden_0887: Xaa-Pro aminopeptidase (EC 3.4.11.9)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3047: Xaa-Pro aminopeptidase (EC 3.4.11.9)	Shewanella amazonensis SB2B Gene: Sama_0684: Xaa-Pro aminopeptidase (EC 3.4.11.9)	Shewanella loihica PV-4 Gene: Shew_0952: Xaa-Pro aminopeptidase (EC 3.4.11.9)	Shewanella pealeana ATCC 700345 Gene: Spea_0920: Xaa-Pro aminopeptidase (EC 3.4.11.9)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0972: Xaa-Pro aminopeptidase (EC 3.4.11.9)	Shewanella piezotolerans WP3 Gene: swp_4202: Xaa-Pro aminopeptidase (EC 3.4.11.9)	Shewanella sediminis HAW-EB3 Gene: Ssed_1024: Xaa-Pro aminopeptidase (EC 3.4.11.9)	Shewanella woodyi ATCC 51908 Gene: Swoo_1096: Xaa-Pro aminopeptidase (EC 3.4.11.9)	Xaa-Pro aminopeptidase (EC 3.4.11.9)

CRON 42.
napD	* Shewanella oneidensis MR-1 Site: position = -150 score = 3.89406 sequence = AACTTTGATCCCGATCGACTAT Site: position = -260 score = 3.931 sequence = TAATGTGATTGGTATAAACCTC Gene: SO0849: periplasmic nitrate reductase component NapD	* Shewanella putrefaciens CN-32 Site: position = -147 score = 3.89406 sequence = AACTTTGATCCCGATCGACTAT Gene: Sputcn32_3147: periplasmic nitrate reductase component NapD	* Shewanella sp W3-18-1 Site: position = -147 score = 3.89406 sequence = AACTTTGATCCCGATCGACTAT Gene: Sputw3181_0796: periplasmic nitrate reductase component NapD	* Shewanella sp ANA-3 Site: position = -149 score = 3.89406 sequence = AACTTTGATCCCGATCGACTAT Gene: Shewana3_3429: periplasmic nitrate reductase component NapD	* Shewanella sp MR-4 Site: position = -149 score = 3.89406 sequence = AACTTTGATCCCGATCGACTAT Gene: Shewmr4_0705: periplasmic nitrate reductase component NapD	* Shewanella sp MR-7 Site: position = -149 score = 3.89406 sequence = AACTTTGATCCCGATCGACTAT Gene: Shewmr7_3317: periplasmic nitrate reductase component NapD	* Shewanella baltica OS155 Site: position = -150 score = 3.98279 sequence = AACTTTGATCCGGATCGACTAT Gene: Sbal_3510: periplasmic nitrate reductase component NapD	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_2982: periplasmic nitrate reductase component NapD	* Shewanella loihica PV-4 Site: position = -154 score = 3.77479 sequence = AACTTTGATCTCGATCTACAAA Gene: Shew_3205: periplasmic nitrate reductase component NapD	* Shewanella pealeana ATCC 700345 Site: position = -173 score = 4.2894 sequence = ATTTGTGAACTAGATCAACACT Gene: Spea_0624: periplasmic nitrate reductase component NapD	* Shewanella halifaxensis HAW-EB4 Site: position = -174 score = 4.1821 sequence = ATCTGTGAATCAGATCACCATG Gene: Shal_0716: periplasmic nitrate reductase component NapD	Shewanella piezotolerans WP3 Gene: swp_4456: periplasmic nitrate reductase component NapD	* Shewanella sediminis HAW-EB3 Site: position = -187 score = 4.11887 sequence = ATCTGAGACATAGGTCACACAT Gene: Ssed_3956: periplasmic nitrate reductase component NapD	* Shewanella woodyi ATCC 51908 Site: position = -179 score = 4.43727 sequence = AAATGTGAACTCCATCACGCAC Site: position = -155 score = 3.92295 sequence = AATATTGATCTTGATCGACTAA Gene: Swoo_4109: periplasmic nitrate reductase component NapD	periplasmic nitrate reductase component NapD
napA	Shewanella oneidensis MR-1 Gene: SO0848: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella putrefaciens CN-32 Gene: Sputcn32_3148: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella sp W3-18-1 Gene: Sputw3181_0795: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella sp ANA-3 Gene: Shewana3_3430: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella sp MR-4 Gene: Shewmr4_0704: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella sp MR-7 Gene: Shewmr7_3318: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella baltica OS155 Gene: Sbal_3511: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -142 score = 4.27412 sequence = AAATGTGACCTTGCACAACTAT Site: position = -166 score = 4.2351 sequence = AAATGAGATTTACATCACGCTG Gene: Sfri_0553: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella amazonensis SB2B Gene: Sama_2983: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella loihica PV-4 Gene: Shew_3206: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella pealeana ATCC 700345 Gene: Spea_0623: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0715: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella piezotolerans WP3 Gene: swp_4457: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella sediminis HAW-EB3 Gene: Ssed_3957: periplasmic nitrate reductase precursor (EC 1.7.99.4)	Shewanella woodyi ATCC 51908 Gene: Swoo_4110: periplasmic nitrate reductase precursor (EC 1.7.99.4)	periplasmic nitrate reductase precursor (EC 1.7.99.4)
napG	Shewanella oneidensis MR-1 Gene: SO0847: ferredoxin-type protein NapG (periplasmic nitrate reductase)	Shewanella putrefaciens CN-32 Gene: Sputcn32_3149: ferredoxin-type protein NapG (periplasmic nitrate reductase)	Shewanella sp W3-18-1 Gene: Sputw3181_0794: ferredoxin-type protein NapG (periplasmic nitrate reductase)	Shewanella sp ANA-3 Gene: Shewana3_3431: ferredoxin-type protein NapG (periplasmic nitrate reductase)	Shewanella sp MR-4 Gene: Shewmr4_0703: ferredoxin-type protein NapG (periplasmic nitrate reductase)	Shewanella sp MR-7 Gene: Shewmr7_3319: ferredoxin-type protein NapG (periplasmic nitrate reductase)	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_2984: ferredoxin-type protein NapG (periplasmic nitrate reductase)	Shewanella loihica PV-4 Gene: Shew_3207: ferredoxin-type protein NapG (periplasmic nitrate reductase)	Shewanella pealeana ATCC 700345 Gene: Spea_0622: ferredoxin-type protein NapG (periplasmic nitrate reductase)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0714: ferredoxin-type protein NapG (periplasmic nitrate reductase)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_3958: ferredoxin-type protein NapG (periplasmic nitrate reductase)	Shewanella woodyi ATCC 51908	ferredoxin-type protein NapG (periplasmic nitrate reductase)
napH	Shewanella oneidensis MR-1 Gene: SO0846: polyferredoxin NapH (periplasmic nitrate reductase)	Shewanella putrefaciens CN-32 Gene: Sputcn32_3150: polyferredoxin NapH (periplasmic nitrate reductase)	Shewanella sp W3-18-1 Gene: Sputw3181_0793: polyferredoxin NapH (periplasmic nitrate reductase)	Shewanella sp ANA-3 Gene: Shewana3_3432: polyferredoxin NapH (periplasmic nitrate reductase)	Shewanella sp MR-4 Gene: Shewmr4_0702: polyferredoxin NapH (periplasmic nitrate reductase)	Shewanella sp MR-7 Gene: Shewmr7_3320: polyferredoxin NapH (periplasmic nitrate reductase)	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_2985: polyferredoxin NapH (periplasmic nitrate reductase)	Shewanella loihica PV-4 Gene: Shew_3208: polyferredoxin NapH (periplasmic nitrate reductase)	Shewanella pealeana ATCC 700345 Gene: Spea_0621: polyferredoxin NapH (periplasmic nitrate reductase)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0713: polyferredoxin NapH (periplasmic nitrate reductase)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_3959: polyferredoxin NapH (periplasmic nitrate reductase)	Shewanella woodyi ATCC 51908	polyferredoxin NapH (periplasmic nitrate reductase)
napB	Shewanella oneidensis MR-1 Gene: SO0845: nitrate reductase cytochrome c550-type subunit	Shewanella putrefaciens CN-32 Gene: Sputcn32_3151: nitrate reductase cytochrome c550-type subunit	Shewanella sp W3-18-1 Gene: Sputw3181_0792: nitrate reductase cytochrome c550-type subunit	Shewanella sp ANA-3 Gene: Shewana3_3433: nitrate reductase cytochrome c550-type subunit	Shewanella sp MR-4 Gene: Shewmr4_0701: nitrate reductase cytochrome c550-type subunit	Shewanella sp MR-7 Gene: Shewmr7_3321: nitrate reductase cytochrome c550-type subunit	Shewanella baltica OS155 Gene: Sbal_3512: nitrate reductase cytochrome c550-type subunit	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0552: nitrate reductase cytochrome c550-type subunit	Shewanella amazonensis SB2B Gene: Sama_2986: nitrate reductase cytochrome c550-type subunit	Shewanella loihica PV-4 Gene: Shew_3209: nitrate reductase cytochrome c550-type subunit	Shewanella pealeana ATCC 700345 Gene: Spea_0620: nitrate reductase cytochrome c550-type subunit	Shewanella halifaxensis HAW-EB4 Gene: Shal_0712: nitrate reductase cytochrome c550-type subunit	Shewanella piezotolerans WP3 Gene: swp_4458: nitrate reductase cytochrome c550-type subunit	Shewanella sediminis HAW-EB3 Gene: Ssed_3960: nitrate reductase cytochrome c550-type subunit	Shewanella woodyi ATCC 51908 Gene: Swoo_4111: nitrate reductase cytochrome c550-type subunit	nitrate reductase cytochrome c550-type subunit

CRON 43.
fadI	* Shewanella oneidensis MR-1 Site: position = -131 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: SO3089: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella putrefaciens CN-32 Site: position = -136 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Sputcn32_2460: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella sp W3-18-1 Site: position = -136 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Sputw3181_1548: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella sp ANA-3 Site: position = -135 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Shewana3_1460: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella sp MR-4 Site: position = -135 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Shewmr4_1407: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella sp MR-7 Site: position = -135 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Shewmr7_1472: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella baltica OS155 Site: position = -136 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Sbal_2761: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella denitrificans OS217 Site: position = -109 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Sden_1529: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella frigidimarina NCIMB 400 Site: position = -104 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Sfri_2677: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella amazonensis SB2B Site: position = -112 score = 3.61813 sequence = AAGTTAGAATCGGGTCACACTT Gene: Sama_2168: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella loihica PV-4 Site: position = -134 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Shew_2426: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella pealeana ATCC 700345 Site: position = -116 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Spea_2599: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella halifaxensis HAW-EB4 Site: position = -119 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Shal_2671: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella piezotolerans WP3 Site: position = -122 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: swp_3140: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella sediminis HAW-EB3 Site: position = -151 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Ssed_1628: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	* Shewanella woodyi ATCC 51908 Site: position = -138 score = 4.0711 sequence = AAGTTAGAATCAGATCACATTT Gene: Swoo_3027: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	3-ketoacyl-CoA thiolase (EC 2.3.1.16)
fadJ	Shewanella oneidensis MR-1 Gene: SO3088: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella putrefaciens CN-32 Gene: Sputcn32_2459: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella sp W3-18-1 Gene: Sputw3181_1549: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella sp ANA-3 Gene: Shewana3_1461: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella sp MR-4 Gene: Shewmr4_1408: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella sp MR-7 Gene: Shewmr7_1473: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella baltica OS155 Gene: Sbal_2760: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella denitrificans OS217 Gene: Sden_1530: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2676: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella amazonensis SB2B Gene: Sama_2167: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella loihica PV-4 Gene: Shew_2425: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella pealeana ATCC 700345 Gene: Spea_2598: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella halifaxensis HAW-EB4 Gene: Shal_2670: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella piezotolerans WP3 Gene: swp_3139: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella sediminis HAW-EB3 Gene: Ssed_1629: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Shewanella woodyi ATCC 51908 Gene: Swoo_3026: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)

CRON 44.
SO4606	* Shewanella oneidensis MR-1 Site: position = -317 score = 4.22767 sequence = AGAAGTGATCTTGATCAATTTT Gene: SO4606: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Shewanella putrefaciens CN-32 Site: position = -309 score = 4.39313 sequence = ATAAGTGATCTTGATCAATATT Gene: Sputcn32_3782: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Shewanella sp W3-18-1 Site: position = -309 score = 4.39313 sequence = ATAAGTGATCTTGATCAATATT Gene: Sputw3181_0133: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Shewanella sp ANA-3 Site: position = -318 score = 4.22767 sequence = AGAAGTGATCTTGATCAATTTT Gene: Shewana3_3991: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Shewanella sp MR-4 Site: position = -318 score = 4.22767 sequence = AGAAGTGATCTTGATCAATTTT Gene: Shewmr4_3791: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Shewanella sp MR-7 Site: position = -317 score = 4.22767 sequence = AGAAGTGATCTTGATCAATTTT Gene: Shewmr7_3864: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Shewanella baltica OS155 Site: position = -317 score = 4.39313 sequence = ATAAGTGATCTTGATCAATATT Gene: Sbal_0154: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Shewanella denitrificans OS217 Site: position = -316 score = 4.4423 sequence = AAAAGTGATCTTGATCAATATT Gene: Sden_3517: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Shewanella frigidimarina NCIMB 400 Site: position = -321 score = 3.85098 sequence = CAAAGTGATCTTGATCAATGTT Gene: Sfri_0258: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Shewanella amazonensis SB2B Site: position = -318 score = 4.44888 sequence = TAAAGTGATCTTGATCAATATT Gene: Sama_3483: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Shewanella loihica PV-4 Site: position = -321 score = 4.4423 sequence = AAAAGTGATCTTGATCAATATT Site: position = -264 score = 4.04584 sequence = TTATTTGTTATATCGCACAATT Gene: Shew_0125: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Shewanella pealeana ATCC 700345 Gene: Spea_3999: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0258: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Shewanella piezotolerans WP3 Gene: swp_4823: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Shewanella sediminis HAW-EB3 Gene: Ssed_0198: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Shewanella woodyi ATCC 51908 Gene: Swoo_0178: cytochrome c oxidase polypeptide II (EC 1.9.3.1)	cytochrome c oxidase polypeptide II (EC 1.9.3.1)
SO4607	Shewanella oneidensis MR-1 Gene: SO4607: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella putrefaciens CN-32 Gene: Sputcn32_3783: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella sp W3-18-1 Gene: Sputw3181_0132: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella sp ANA-3 Gene: Shewana3_3992: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella sp MR-4 Gene: Shewmr4_3792: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella sp MR-7 Gene: Shewmr7_3865: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella baltica OS155 Gene: Sbal_0153: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella denitrificans OS217 Gene: Sden_3518: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0257: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella amazonensis SB2B Gene: Sama_3484: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella loihica PV-4 Gene: Shew_0124: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella pealeana ATCC 700345 Gene: Spea_4000: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0257: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella piezotolerans WP3 Gene: swp_4824: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella sediminis HAW-EB3 Gene: Ssed_0197: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Shewanella woodyi ATCC 51908 Gene: Swoo_0177: cytochrome c oxidase polypeptide I (EC 1.9.3.1)	cytochrome c oxidase polypeptide I (EC 1.9.3.1)
coxG	Shewanella oneidensis MR-1 Gene: SO4608: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella putrefaciens CN-32 Gene: Sputcn32_3784: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella sp W3-18-1 Gene: Sputw3181_0131: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella sp ANA-3 Gene: Shewana3_3993: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella sp MR-4 Gene: Shewmr4_3793: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella sp MR-7 Gene: Shewmr7_3866: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella baltica OS155 Gene: Sbal_0152: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella denitrificans OS217 Gene: Sden_3519: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0256: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella amazonensis SB2B Gene: Sama_3485: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella loihica PV-4 Gene: Shew_0123: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella pealeana ATCC 700345 Gene: Spea_4001: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella halifaxensis HAW-EB4 Gene: Shal_0256: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella piezotolerans WP3 Gene: swp_4825: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella sediminis HAW-EB3 Gene: Ssed_0196: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Shewanella woodyi ATCC 51908 Gene: Swoo_0176: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
SO4609	Shewanella oneidensis MR-1 Gene: SO4609: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella putrefaciens CN-32 Gene: Sputcn32_3785: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella sp W3-18-1 Gene: Sputw3181_0130: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella sp ANA-3 Gene: Shewana3_3994: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella sp MR-4 Gene: Shewmr4_3794: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella sp MR-7 Gene: Shewmr7_3867: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella baltica OS155 Gene: Sbal_0151: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella denitrificans OS217 Gene: Sden_3520: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0255: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella amazonensis SB2B Gene: Sama_3486: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella loihica PV-4 Gene: Shew_0122: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella pealeana ATCC 700345 Gene: Spea_4002: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0255: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella piezotolerans WP3 Gene: swp_4826: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella sediminis HAW-EB3 Gene: Ssed_0195: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Shewanella woodyi ATCC 51908 Gene: Swoo_0175: cytochrome c oxidase polypeptide III (EC 1.9.3.1)	cytochrome c oxidase polypeptide III (EC 1.9.3.1)

CRON 45.
hemG	Shewanella oneidensis MR-1 Gene: SO3720: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	* Shewanella putrefaciens CN-32 Site: position = -207 score = 4.47294 sequence = TTTTGTGAGCAAGCTAAAATTA Site: position = -135 score = 3.91378 sequence = AATTGATATTTAAATCACCTAG Gene: Sputcn32_3038: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	* Shewanella sp W3-18-1 Site: position = -207 score = 4.47294 sequence = TTTTGTGAGCAAGCTAAAATTA Site: position = -135 score = 3.91378 sequence = AATTGATATTTAAATCACCTAG Gene: Sputw3181_0907: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	* Shewanella sp ANA-3 Site: position = -317 score = 4.12352 sequence = TTTTGTGAGCAAGCTAGAATTA Gene: Shewana3_0871: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	* Shewanella sp MR-4 Site: position = -320 score = 4.12352 sequence = TTTTGTGAGCAAGCTAGAATTA Gene: Shewmr4_3066: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	* Shewanella sp MR-7 Site: position = -318 score = 4.12352 sequence = TTTTGTGAGCAAGCTAGAATTA Gene: Shewmr7_0906: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	* Shewanella baltica OS155 Site: position = -316 score = 4.36986 sequence = TTTTGTGAGACAGTTAAAACTA Gene: Sbal_3400: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -144 score = 4.02008 sequence = TTTTGCGCGGCAGTTCACATTG Site: position = -83 score = 4.36624 sequence = TGACGTGATCTGTTTCATGTAA Gene: Sfri_0813: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	* Shewanella amazonensis SB2B Site: position = -130 score = 3.89764 sequence = AAATGTGAGGCAGTTGGAATTT Gene: Sama_2882: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	* Shewanella loihica PV-4 Site: position = -126 score = 4.09954 sequence = ATTTGTGACATCGGTAAACTTA Gene: Shew_0678: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	* Shewanella pealeana ATCC 700345 Site: position = -140 score = 4.01337 sequence = TTTTGTGAGGTAGGTAAAGCTA Site: position = -98 score = 3.77917 sequence = CCTCGTGATCTGTTTCATGTAA Gene: Spea_0673: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	* Shewanella halifaxensis HAW-EB4 Site: position = -139 score = 4.01337 sequence = TTTTGTGAGGTAGGTAAAGCTA Site: position = -97 score = 3.77917 sequence = CCTCGTGATCTGTTTCATGTAA Gene: Shal_3525: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	* Shewanella piezotolerans WP3 Site: position = -124 score = 3.90822 sequence = TTTTGTGAGGTAGGTAAAGGTA Site: position = -77 score = 3.72591 sequence = TGATCTGATTCAATTAAAAATA Gene: swp_4046: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	* Shewanella sediminis HAW-EB3 Site: position = -120 score = 4.85366 sequence = ATTTGTGATGCAGGTAAAATTT Site: position = -78 score = 3.99272 sequence = TGCCGTGATCTGTTTCATGTAA Gene: Ssed_3790: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	* Shewanella woodyi ATCC 51908 Site: position = -123 score = 4.31185 sequence = AATTGTGATATAGGTAAGAGTA Gene: Swoo_0793: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)	protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
SO3719	Shewanella oneidensis MR-1 Gene: SO3719: hypothetical protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_3037: hypothetical protein	Shewanella sp W3-18-1 Gene: Sputw3181_0908: hypothetical protein	Shewanella sp ANA-3 Gene: Shewana3_0872: hypothetical protein	Shewanella sp MR-4 Gene: Shewmr4_3065: hypothetical protein	Shewanella sp MR-7 Gene: Shewmr7_0907: hypothetical protein	Shewanella baltica OS155 Gene: Sbal_3399: hypothetical protein	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0814: hypothetical protein	Shewanella amazonensis SB2B Gene: Sama_2881: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_0679: hypothetical protein	Shewanella pealeana ATCC 700345 Gene: Spea_0674: hypothetical protein	2 Shewanella halifaxensis HAW-EB4* Gene: Shal_3524: hypothetical protein Site: position = -235 score = 5.33461 sequence = AAGTGTGATATCGCTCACAAAA Gene: Shal_2707: hypothetical protein	Shewanella piezotolerans WP3 Gene: swp_4045: hypothetical protein	Shewanella sediminis HAW-EB3 Gene: Ssed_3789: hypothetical protein	Shewanella woodyi ATCC 51908 Gene: Swoo_0794: hypothetical protein	hypothetical protein

CRON 46.
moaA	* Shewanella oneidensis MR-1 Site: position = -220 score = 3.80214 sequence = TTGGGTGAGCACTGTCACAGAT Gene: SO4452: molybdenum cofactor biosynthesis protein MoaA	* Shewanella putrefaciens CN-32 Site: position = -187 score = 3.77281 sequence = TTGGGTGAGGACTGTCACAGAT Gene: Sputcn32_0389: molybdenum cofactor biosynthesis protein MoaA	* Shewanella sp W3-18-1 Site: position = -187 score = 3.77281 sequence = TTGGGTGAGGACTGTCACAGAT Gene: Sputw3181_0243: molybdenum cofactor biosynthesis protein MoaA	* Shewanella sp ANA-3 Site: position = -187 score = 3.80214 sequence = TTGGGTGAGCACTGTCACAGAT Gene: Shewana3_0274: molybdenum cofactor biosynthesis protein MoaA	* Shewanella sp MR-4 Site: position = -187 score = 3.89034 sequence = TTGGGTGAGCGCTGTCACAGTT Gene: Shewmr4_0273: molybdenum cofactor biosynthesis protein MoaA	* Shewanella sp MR-7 Site: position = -187 score = 3.89034 sequence = TTGGGTGAGCGCTGTCACAGTT Gene: Shewmr7_3748: molybdenum cofactor biosynthesis protein MoaA	* Shewanella baltica OS155 Site: position = -187 score = 3.97727 sequence = TTAGGTGAGGACTGTCACAGAT Gene: Sbal_0284: molybdenum cofactor biosynthesis protein MoaA	* Shewanella denitrificans OS217 Site: position = -186 score = 4.27953 sequence = TGAGGTGAGCTGTGTCACAAAA Gene: Sden_0101: molybdenum cofactor biosynthesis protein MoaA	* Shewanella frigidimarina NCIMB 400 Site: position = -186 score = 4.46278 sequence = TAGCGTGAGTCGAGTCACAAAT Gene: Sfri_0082: molybdenum cofactor biosynthesis protein MoaA	* Shewanella amazonensis SB2B Site: position = -180 score = 3.98696 sequence = CTGAGTGAGCGGCGTCACAATT Gene: Sama_3524: molybdenum cofactor biosynthesis protein MoaA	* Shewanella loihica PV-4 Site: position = -189 score = 4.39672 sequence = CTTCGTGAGCGGTGTCACATTA Gene: Shew_0087: molybdenum cofactor biosynthesis protein MoaA	* Shewanella pealeana ATCC 700345 Site: position = -222 score = 4.1207 sequence = TGCCGTGATAACTGTCACAAAA Gene: Spea_4120: molybdenum cofactor biosynthesis protein MoaA	* Shewanella halifaxensis HAW-EB4 Site: position = -222 score = 4.28976 sequence = TGGCGTGATAACTGTCACAAAA Gene: Shal_0122: molybdenum cofactor biosynthesis protein MoaA	* Shewanella piezotolerans WP3 Site: position = -222 score = 4.28877 sequence = TGAGGTGATTAGTGTCACAAAA Gene: swp_5009: molybdenum cofactor biosynthesis protein MoaA	* Shewanella sediminis HAW-EB3 Site: position = -221 score = 4.36273 sequence = GTATGTGAGGGGTGTCACAAAA Gene: Ssed_4402: molybdenum cofactor biosynthesis protein MoaA	* Shewanella woodyi ATCC 51908 Site: position = -222 score = 4.25203 sequence = GAATGTGAGTGTCGTCACAAAA Gene: Swoo_4793: molybdenum cofactor biosynthesis protein MoaA	molybdenum cofactor biosynthesis protein MoaA
moaB	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_3525: molybdenum cofactor biosynthesis protein MoaB	Shewanella loihica PV-4 Gene: Shew_0088: molybdenum cofactor biosynthesis protein MoaB	Shewanella pealeana ATCC 700345 Gene: Spea_4119: molybdenum cofactor biosynthesis protein MoaB	Shewanella halifaxensis HAW-EB4 Gene: Shal_0123: molybdenum cofactor biosynthesis protein MoaB	Shewanella piezotolerans WP3 Gene: swp_5008: molybdenum cofactor biosynthesis protein MoaB	Shewanella sediminis HAW-EB3 Gene: Ssed_4401: molybdenum cofactor biosynthesis protein MoaB	Shewanella woodyi ATCC 51908 Gene: Swoo_4792: molybdenum cofactor biosynthesis protein MoaB	molybdenum cofactor biosynthesis protein MoaB
moaC	Shewanella oneidensis MR-1 Gene: SO4451: molybdenum cofactor biosynthesis protein MoaC	Shewanella putrefaciens CN-32 Gene: Sputcn32_0390: molybdenum cofactor biosynthesis protein MoaC	Shewanella sp W3-18-1 Gene: Sputw3181_0244: molybdenum cofactor biosynthesis protein MoaC	Shewanella sp ANA-3 Gene: Shewana3_0275: molybdenum cofactor biosynthesis protein MoaC	Shewanella sp MR-4 Gene: Shewmr4_0274: molybdenum cofactor biosynthesis protein MoaC	Shewanella sp MR-7 Gene: Shewmr7_3747: molybdenum cofactor biosynthesis protein MoaC	Shewanella baltica OS155 Gene: Sbal_0285: molybdenum cofactor biosynthesis protein MoaC	Shewanella denitrificans OS217 Gene: Sden_0102: molybdenum cofactor biosynthesis protein MoaC	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0083: molybdenum cofactor biosynthesis protein MoaC	Shewanella amazonensis SB2B Gene: Sama_3526: molybdenum cofactor biosynthesis protein MoaC	Shewanella loihica PV-4 Gene: Shew_0089: molybdenum cofactor biosynthesis protein MoaC	Shewanella pealeana ATCC 700345 Gene: Spea_4118: molybdenum cofactor biosynthesis protein MoaC	Shewanella halifaxensis HAW-EB4 Gene: Shal_0124: molybdenum cofactor biosynthesis protein MoaC	Shewanella piezotolerans WP3 Gene: swp_5007: molybdenum cofactor biosynthesis protein MoaC	Shewanella sediminis HAW-EB3 Gene: Ssed_4400: molybdenum cofactor biosynthesis protein MoaC	Shewanella woodyi ATCC 51908 Gene: Swoo_4791: molybdenum cofactor biosynthesis protein MoaC	molybdenum cofactor biosynthesis protein MoaC
moaD	Shewanella oneidensis MR-1 Gene: SO4450: molybdenum cofactor biosynthesis protein MoaD	Shewanella putrefaciens CN-32 Gene: Sputcn32_0391: molybdenum cofactor biosynthesis protein MoaD	Shewanella sp W3-18-1 Gene: Sputw3181_0245: molybdenum cofactor biosynthesis protein MoaD	Shewanella sp ANA-3 Gene: Shewana3_0276: molybdenum cofactor biosynthesis protein MoaD	Shewanella sp MR-4 Gene: Shewmr4_0275: molybdenum cofactor biosynthesis protein MoaD	Shewanella sp MR-7 Gene: Shewmr7_3746: molybdenum cofactor biosynthesis protein MoaD	Shewanella baltica OS155 Gene: Sbal_0286: molybdenum cofactor biosynthesis protein MoaD	Shewanella denitrificans OS217 Gene: Sden_0103: molybdenum cofactor biosynthesis protein MoaD	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0084: molybdenum cofactor biosynthesis protein MoaD	Shewanella amazonensis SB2B Gene: Sama_3527: molybdenum cofactor biosynthesis protein MoaD	Shewanella loihica PV-4 Gene: Shew_0090: molybdenum cofactor biosynthesis protein MoaD	Shewanella pealeana ATCC 700345 Gene: Spea_4117: molybdenum cofactor biosynthesis protein MoaD	Shewanella halifaxensis HAW-EB4 Gene: Shal_0125: molybdenum cofactor biosynthesis protein MoaD	Shewanella piezotolerans WP3 Gene: swp_5006: molybdenum cofactor biosynthesis protein MoaD	Shewanella sediminis HAW-EB3 Gene: Ssed_4399: molybdenum cofactor biosynthesis protein MoaD	Shewanella woodyi ATCC 51908 Gene: Swoo_4790: molybdenum cofactor biosynthesis protein MoaD	molybdenum cofactor biosynthesis protein MoaD
moaE	Shewanella oneidensis MR-1 Gene: SO4449: molybdenum cofactor biosynthesis protein MoaE	Shewanella putrefaciens CN-32 Gene: Sputcn32_0392: molybdenum cofactor biosynthesis protein MoaE	Shewanella sp W3-18-1 Gene: Sputw3181_0246: molybdenum cofactor biosynthesis protein MoaE	Shewanella sp ANA-3 Gene: Shewana3_0277: molybdenum cofactor biosynthesis protein MoaE	Shewanella sp MR-4 Gene: Shewmr4_0276: molybdenum cofactor biosynthesis protein MoaE	Shewanella sp MR-7 Gene: Shewmr7_3745: molybdenum cofactor biosynthesis protein MoaE	Shewanella baltica OS155 Gene: Sbal_0287: molybdenum cofactor biosynthesis protein MoaE	Shewanella denitrificans OS217 Gene: Sden_0104: molybdenum cofactor biosynthesis protein MoaE	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0085: molybdenum cofactor biosynthesis protein MoaE	Shewanella amazonensis SB2B Gene: Sama_3528: molybdenum cofactor biosynthesis protein MoaE	Shewanella loihica PV-4 Gene: Shew_0091: molybdenum cofactor biosynthesis protein MoaE	Shewanella pealeana ATCC 700345 Gene: Spea_4116: molybdenum cofactor biosynthesis protein MoaE	Shewanella halifaxensis HAW-EB4 Gene: Shal_0126: molybdenum cofactor biosynthesis protein MoaE	Shewanella piezotolerans WP3 Gene: swp_5005: molybdenum cofactor biosynthesis protein MoaE	Shewanella sediminis HAW-EB3 Gene: Ssed_4398: molybdenum cofactor biosynthesis protein MoaE	Shewanella woodyi ATCC 51908 Gene: Swoo_4789: molybdenum cofactor biosynthesis protein MoaE	molybdenum cofactor biosynthesis protein MoaE
modA	Shewanella oneidensis MR-1 Gene: SO4448: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0393: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella sp W3-18-1 Gene: Sputw3181_0247: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella sp ANA-3 Gene: Shewana3_0278: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella sp MR-4 Gene: Shewmr4_0277: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella sp MR-7 Gene: Shewmr7_3744: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella baltica OS155 Gene: Sbal_0288: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella denitrificans OS217 Gene: Sden_0105: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0086: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella amazonensis SB2B Gene: Sama_3529: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella loihica PV-4 Gene: Shew_0092: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella pealeana ATCC 700345 Gene: Spea_4115: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0127: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella piezotolerans WP3 Gene: swp_5004: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella sediminis HAW-EB3 Gene: Ssed_4397: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	Shewanella woodyi ATCC 51908 Gene: Swoo_4788: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)	molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
modB	Shewanella oneidensis MR-1 Gene: SO4447: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0394: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella sp W3-18-1 Gene: Sputw3181_0248: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella sp ANA-3 Gene: Shewana3_0279: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella sp MR-4 Gene: Shewmr4_0278: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella sp MR-7 Gene: Shewmr7_3743: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella baltica OS155 Gene: Sbal_0289: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella denitrificans OS217 Gene: Sden_0106: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0087: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella amazonensis SB2B Gene: Sama_3530: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella loihica PV-4 Gene: Shew_0093: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella pealeana ATCC 700345 Gene: Spea_4114: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0128: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella piezotolerans WP3 Gene: swp_5002: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella sediminis HAW-EB3 Gene: Ssed_4396: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella woodyi ATCC 51908 Gene: Swoo_4787: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC	Shewanella oneidensis MR-1 Gene: SO4446: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0395: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella sp W3-18-1 Gene: Sputw3181_0249: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella sp ANA-3 Gene: Shewana3_0280: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella sp MR-4 Gene: Shewmr4_0279: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella sp MR-7 Gene: Shewmr7_3742: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella baltica OS155 Gene: Sbal_0290: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella denitrificans OS217 Gene: Sden_0107: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0088: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella amazonensis SB2B Gene: Sama_3531: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella loihica PV-4 Gene: Shew_0094: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella pealeana ATCC 700345 Gene: Spea_4113: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0129: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella piezotolerans WP3 Gene: swp_5001: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella sediminis HAW-EB3 Gene: Ssed_4395: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella woodyi ATCC 51908 Gene: Swoo_4786: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

CRON 47.
Shewana3_0095	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	* Shewanella sp ANA-3 Site: position = -80 score = 4.84948 sequence = AAATTTGAGCTTGATCACACTA Gene: Shewana3_0095: hypothetical protein	* Shewanella sp MR-4 Site: position = -80 score = 4.84948 sequence = AAATTTGAGCTTGATCACACTA Gene: Shewmr4_0094: hypothetical protein	* Shewanella sp MR-7 Site: position = -80 score = 4.84948 sequence = AAATTTGAGCTTGATCACACTA Gene: Shewmr7_0089: hypothetical protein	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3964: hypothetical protein	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	hypothetical protein

CRON 48.
sel1	* Shewanella oneidensis MR-1 Site: position = -267 score = 4.23922 sequence = TTTAGTGATATTAGTCAACTAA Gene: SO0625: Sel1 domain protein repeat-containing protein precursor	* Shewanella putrefaciens CN-32 Site: position = -270 score = 4.23922 sequence = TTTAGTGATATTAGTCAACTAA Gene: Sputcn32_0653: Sel1 domain protein repeat-containing protein precursor	* Shewanella sp W3-18-1 Site: position = -270 score = 4.23922 sequence = TTTAGTGATATTAGTCAACTAA Gene: Sputw3181_3521: Sel1 domain protein repeat-containing protein precursor	* Shewanella sp ANA-3 Site: position = -270 score = 4.23922 sequence = TTTAGTGATATTAGTCAACTAA Gene: Shewana3_0618: Sel1 domain protein repeat-containing protein precursor	* Shewanella sp MR-4 Site: position = -270 score = 4.23922 sequence = TTTAGTGATATTAGTCAACTAA Gene: Shewmr4_0619: Sel1 domain protein repeat-containing protein precursor	* Shewanella sp MR-7 Site: position = -270 score = 4.23922 sequence = TTTAGTGATATTAGTCAACTAA Gene: Shewmr7_3411: Sel1 domain protein repeat-containing protein precursor	* Shewanella baltica OS155 Site: position = -278 score = 4.35121 sequence = TTTAGTGATTTAAGTCAACTAA Gene: Sbal_0579: Sel1 domain protein repeat-containing protein precursor	Shewanella denitrificans OS217 Gene: Sden_3189: Sel1 domain protein repeat-containing protein precursor	* Shewanella frigidimarina NCIMB 400 Site: position = -222 score = 4.11507 sequence = AACTTTGATAGAGATCGTATTT Site: position = -147 score = 4.28476 sequence = ATTTGTGATGACGGTCGACTTT Site: position = -38 score = 3.99702 sequence = TTATTTAATCAGCTTCATAAAT Gene: Sfri_3291: Sel1 domain protein repeat-containing protein precursor	* Shewanella amazonensis SB2B Site: position = -319 score = 3.84014 sequence = AACCATGATGCAGATCGAAATT Gene: Sama_3003: Sel1 domain protein repeat-containing protein precursor	* Shewanella loihica PV-4 Site: position = -279 score = 3.83192 sequence = ATTAGTAATATATGTCAACTAA Gene: Shew_0586: Sel1 domain protein repeat-containing protein precursor	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	* Shewanella piezotolerans WP3 Site: position = -153 score = 3.82702 sequence = TTTTTTGAACCTTATCAATAAA Gene: swp_0756: Sel1 domain protein repeat-containing protein precursor	* Shewanella sediminis HAW-EB3 Site: position = -296 score = 4.34462 sequence = ATTAGTGATATAAGTCAACTAA Gene: Ssed_3872: Sel1 domain protein repeat-containing protein precursor	* Shewanella woodyi ATCC 51908 Site: position = -298 score = 4.34462 sequence = ATTAGTGATATAAGTCAACTAA Gene: Swoo_0663: Sel1 domain protein repeat-containing protein precursor	Sel1 domain protein repeat-containing protein precursor

CRON 49.
argR	* Shewanella oneidensis MR-1 Site: position = -266 score = 4.53368 sequence = ATGTGTGACATGGATCTAATTT Gene: SO0769: arginine pathway regulatory protein ArgR, repressor of arg regulon	* Shewanella putrefaciens CN-32 Site: position = -259 score = 4.17624 sequence = ATGTGTGACATGGATCTAGTTT Gene: Sputcn32_3220: arginine pathway regulatory protein ArgR, repressor of arg regulon	* Shewanella sp W3-18-1 Site: position = -259 score = 4.17624 sequence = ATGTGTGACATGGATCTAGTTT Gene: Sputw3181_0721: arginine pathway regulatory protein ArgR, repressor of arg regulon	* Shewanella sp ANA-3 Site: position = -266 score = 4.53368 sequence = ATGTGTGACATGGATCTAATTT Gene: Shewana3_3510: arginine pathway regulatory protein ArgR, repressor of arg regulon	* Shewanella sp MR-4 Site: position = -266 score = 4.53368 sequence = ATGTGTGACATGGATCTAATTT Gene: Shewmr4_3340: arginine pathway regulatory protein ArgR, repressor of arg regulon	* Shewanella sp MR-7 Site: position = -266 score = 4.53368 sequence = ATGTGTGACATGGATCTAATTT Gene: Shewmr7_0613: arginine pathway regulatory protein ArgR, repressor of arg regulon	* Shewanella baltica OS155 Site: position = -270 score = 4.53368 sequence = ATGTGTGACATGGATCTAATTT Gene: Sbal_0608: arginine pathway regulatory protein ArgR, repressor of arg regulon	Shewanella denitrificans OS217 Gene: Sden_0825: arginine pathway regulatory protein ArgR, repressor of arg regulon	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0640: arginine pathway regulatory protein ArgR, repressor of arg regulon	* Shewanella amazonensis SB2B Site: position = -262 score = 4.03298 sequence = ATTTGTGAGGTAGATCCTCAAA Gene: Sama_0671: arginine pathway regulatory protein ArgR, repressor of arg regulon	* Shewanella loihica PV-4 Site: position = -282 score = 4.59978 sequence = TTATGTGATATAGATCTAGATT Gene: Shew_0866: arginine pathway regulatory protein ArgR, repressor of arg regulon	Shewanella pealeana ATCC 700345 Gene: Spea_0849: arginine pathway regulatory protein ArgR, repressor of arg regulon	Shewanella halifaxensis HAW-EB4 Gene: Shal_0902: arginine pathway regulatory protein ArgR, repressor of arg regulon	* Shewanella piezotolerans WP3 Site: position = -140 score = 3.81151 sequence = ATTTATACTCTACATCATATTT Gene: swp_4101: arginine pathway regulatory protein ArgR, repressor of arg regulon	* Shewanella sediminis HAW-EB3 Site: position = -254 score = 3.75337 sequence = ATTTTTGTTCTACATCAATAAA Gene: Ssed_0951: arginine pathway regulatory protein ArgR, repressor of arg regulon	* Shewanella woodyi ATCC 51908 Site: position = -311 score = 4.47876 sequence = TTTTGTGATGTAGGTCTACATT Gene: Swoo_1001: arginine pathway regulatory protein ArgR, repressor of arg regulon	arginine pathway regulatory protein ArgR, repressor of arg regulon

CRON 50.
SO0439	* Shewanella oneidensis MR-1 Site: position = -34 score = 4.426 sequence = ATACGTGATCTGACGCACATCA Gene: SO0439: hypothetical protein	* Shewanella putrefaciens CN-32 Site: position = -90 score = 4.48702 sequence = AAATGTGAACCAGAGCACACTC Gene: Sputcn32_3403: hypothetical protein	* Shewanella sp W3-18-1 Site: position = -90 score = 4.48702 sequence = AAATGTGAACCAGAGCACACTC Gene: Sputw3181_0540: hypothetical protein	* Shewanella sp ANA-3 Site: position = -78 score = 4.22843 sequence = AAGCGTGAGCTAACGCACACAA Gene: Shewana3_0438: hypothetical protein	* Shewanella sp MR-4 Site: position = -77 score = 3.82136 sequence = AAGCGTGAACTTAAGCACACTC Gene: Shewmr4_0442: hypothetical protein	* Shewanella sp MR-7 Site: position = -77 score = 3.82136 sequence = AAGCGTGAACTTAAGCACACTC Gene: Shewmr7_3587: hypothetical protein	* Shewanella baltica OS155 Site: position = -93 score = 4.8117 sequence = AAATGTGACCTAAAGCACATAC Gene: Sbal_0417: hypothetical protein	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -135 score = 5.2057 sequence = TTTTATGATTTAGATCACAAAA Gene: Sfri_0491: hypothetical protein	Shewanella amazonensis SB2B	Shewanella loihica PV-4	* Shewanella pealeana ATCC 700345 Site: position = -137 score = 4.75582 sequence = TTTTGTGATCTAAGTAGCAAAA Gene: Spea_0430: hypothetical protein	* Shewanella halifaxensis HAW-EB4 Site: position = -138 score = 4.74247 sequence = TTTTGTGACATAGGTAACACAA Gene: Shal_0486: hypothetical protein	Shewanella piezotolerans WP3 Gene: swp_4727: hypothetical protein	* Shewanella sediminis HAW-EB3 Site: position = -105 score = 4.32443 sequence = ATTTGTGACCAAGTTCCCAAAC Gene: Ssed_3193: hypothetical protein	* Shewanella woodyi ATCC 51908 Site: position = -78 score = 3.88288 sequence = AAACAGGACGTAGATCACACTT Gene: Swoo_0294: hypothetical protein	hypothetical protein

CRON 51.
yceI	Shewanella oneidensis MR-1 Gene: SO2893: hypothetical protein	* Shewanella putrefaciens CN-32 Site: position = -70 score = 3.77562 sequence = TAAATGGATGTAAATCACGATT Gene: Sputcn32_1651: hypothetical protein	* Shewanella sp W3-18-1 Site: position = -70 score = 3.77562 sequence = TAAATGGATGTAAATCACGATT Gene: Sputw3181_2375: hypothetical protein	* Shewanella sp ANA-3 Site: position = -102 score = 4.61453 sequence = TTAGGTGATCTTTGTCACAGAT Gene: Shewana3_1628: hypothetical protein	* Shewanella sp MR-4 Site: position = -103 score = 4.83478 sequence = TTAGGTGATCTTTGTCACAAAT Gene: Shewmr4_1561: hypothetical protein	* Shewanella sp MR-7 Site: position = -103 score = 4.83478 sequence = TTAGGTGATCTTTGTCACAAAT Gene: Shewmr7_1636: hypothetical protein	* Shewanella baltica OS155 Site: position = -105 score = 4.67624 sequence = TTAGGTGATGTGGGTCACGTTT Gene: Sbal_1772: hypothetical protein	Shewanella denitrificans OS217 Gene: Sden_2275: hypothetical protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1704: hypothetical protein	Shewanella amazonensis SB2B Gene: Sama_1959: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_2223: hypothetical protein	Shewanella pealeana ATCC 700345 Gene: Spea_2476: hypothetical protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_1807: hypothetical protein	* Shewanella piezotolerans WP3 Site: position = -42 score = 3.79306 sequence = TACATTGATATCTATCACTATT Gene: swp_3020: hypothetical protein	Shewanella sediminis HAW-EB3 Gene: Ssed_2605: hypothetical protein	Shewanella woodyi ATCC 51908 Gene: Swoo_2061: hypothetical protein	hypothetical protein
SO2891	Shewanella oneidensis MR-1 Gene: SO2891: type IIA topoisomerase, B subunit	Shewanella putrefaciens CN-32 Gene: Sputcn32_1652: type IIA topoisomerase, B subunit	Shewanella sp W3-18-1 Gene: Sputw3181_2374: type IIA topoisomerase, B subunit	Shewanella sp ANA-3 Gene: Shewana3_1629: type IIA topoisomerase, B subunit	Shewanella sp MR-4 Gene: Shewmr4_1562: type IIA topoisomerase, B subunit	Shewanella sp MR-7 Gene: Shewmr7_1637: type IIA topoisomerase, B subunit	Shewanella baltica OS155 Gene: Sbal_1773: type IIA topoisomerase, B subunit	Shewanella denitrificans OS217 Gene: Sden_2274: type IIA topoisomerase, B subunit	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1705: type IIA topoisomerase, B subunit	Shewanella amazonensis SB2B Gene: Sama_1958: type IIA topoisomerase, B subunit	Shewanella loihica PV-4 Gene: Shew_2222: type IIA topoisomerase, B subunit	* Shewanella pealeana ATCC 700345 Site: position = -166 score = 3.83614 sequence = TTACGTGCTGAATTGCAAAATT Site: position = -69 score = 3.81606 sequence = AATTGTTACGCATCTTACGCTA Gene: Spea_2475: type IIA topoisomerase, B subunit	Shewanella halifaxensis HAW-EB4 Gene: Shal_1808: type IIA topoisomerase, B subunit	Shewanella piezotolerans WP3 Gene: swp_3019: type IIA topoisomerase, B subunit	Shewanella sediminis HAW-EB3 Gene: Ssed_2604: type IIA topoisomerase, B subunit	Shewanella woodyi ATCC 51908 Gene: Swoo_2062: type IIA topoisomerase, B subunit	type IIA topoisomerase, B subunit

CRON 52.
SO3914	* Shewanella oneidensis MR-1 Site: position = -136 score = 4.01516 sequence = AACAGTGATGCTGATTAAATTA Gene: SO3914: ferrichrome-iron receptor	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	* Shewanella sp ANA-3 Site: position = -135 score = 4.1747 sequence = AATTGTGACTAAGATTAAATTG Gene: Shewana3_0716: ferrichrome-iron receptor	* Shewanella sp MR-4 Site: position = -134 score = 4.46854 sequence = TAATGTGACAAAGATTAAATTA Gene: Shewmr4_3245: ferrichrome-iron receptor	* Shewanella sp MR-7 Site: position = -134 score = 4.85508 sequence = TAATGTGATATGTATTAAATTA Gene: Shewmr7_0697: ferrichrome-iron receptor	Shewanella baltica OS155 Gene: Sbal_3635: ferrichrome-iron receptor	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	ferrichrome-iron receptor
piuC	Shewanella oneidensis MR-1 Gene: SO3913: iron-uptake factor PiuC	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3 Gene: Shewana3_0717: iron-uptake factor PiuC	Shewanella sp MR-4 Gene: Shewmr4_3244: iron-uptake factor PiuC	Shewanella sp MR-7 Gene: Shewmr7_0698: iron-uptake factor PiuC	Shewanella baltica OS155 Gene: Sbal_3634: iron-uptake factor PiuC	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	iron-uptake factor PiuC

CRON 53.
SO3811	Shewanella oneidensis MR-1 Gene: SO3811: lipoprotein, putative	* Shewanella putrefaciens CN-32 Site: position = -116 score = 4.38849 sequence = TAATGTGATTGGTATAATATAC Gene: Sputcn32_0822: lipoprotein, putative	* Shewanella sp W3-18-1 Site: position = -116 score = 4.38849 sequence = TAATGTGATTGGTATAATATAC Gene: Sputw3181_3351: lipoprotein, putative	* Shewanella sp ANA-3 Site: position = -142 score = 4.14174 sequence = AATTGTTAAGTATTTCATATTG Gene: Shewana3_0786: lipoprotein, putative	* Shewanella sp MR-4 Site: position = -142 score = 4.14174 sequence = AATTGTTAAGTATTTCATATTG Gene: Shewmr4_3152: lipoprotein, putative	* Shewanella sp MR-7 Site: position = -142 score = 4.14174 sequence = AATTGTTAAGTATTTCATATTG Gene: Shewmr7_0815: lipoprotein, putative	Shewanella baltica OS155 Gene: Sbal_0714: lipoprotein, putative	Shewanella denitrificans OS217 Gene: Sden_0774: lipoprotein, putative	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3111: lipoprotein, putative	Shewanella amazonensis SB2B Gene: Sama_2553: lipoprotein, putative	Shewanella loihica PV-4 Gene: Shew_2889: lipoprotein, putative	Shewanella pealeana ATCC 700345 Gene: Spea_3110: lipoprotein, putative	Shewanella halifaxensis HAW-EB4 Gene: Shal_3194: lipoprotein, putative	Shewanella piezotolerans WP3 Gene: swp_1154: lipoprotein, putative	* Shewanella sediminis HAW-EB3 Site: position = -203 score = 4.29747 sequence = TAACGTGATGAAAGTAAAATTT Gene: Ssed_3439: lipoprotein, putative	Shewanella woodyi ATCC 51908 Gene: Swoo_3641: lipoprotein, putative	lipoprotein, putative
ppiA	Shewanella oneidensis MR-1 Gene: SO3812: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0821: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella sp W3-18-1 Gene: Sputw3181_3352: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella sp ANA-3 Gene: Shewana3_0785: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella sp MR-4 Gene: Shewmr4_3153: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella sp MR-7 Gene: Shewmr7_0814: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella baltica OS155 Gene: Sbal_0713: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella denitrificans OS217 Gene: Sden_0773: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3112: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella amazonensis SB2B Gene: Sama_2554: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella loihica PV-4 Gene: Shew_2890: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella pealeana ATCC 700345 Gene: Spea_3111: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3195: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella piezotolerans WP3 Gene: swp_1153: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella sediminis HAW-EB3 Gene: Ssed_3440: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	Shewanella woodyi ATCC 51908 Gene: Swoo_3642: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)	peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
SO3813	Shewanella oneidensis MR-1 Gene: SO3813: hypothetical protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_0820: hypothetical protein	Shewanella sp W3-18-1 Gene: Sputw3181_3353: hypothetical protein	Shewanella sp ANA-3 Gene: Shewana3_0784: hypothetical protein	Shewanella sp MR-4 Gene: Shewmr4_3154: hypothetical protein	Shewanella sp MR-7 Gene: Shewmr7_0813: hypothetical protein	Shewanella baltica OS155 Gene: Sbal_0712: hypothetical protein	Shewanella denitrificans OS217 Gene: Sden_0772: hypothetical protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3113: hypothetical protein	Shewanella amazonensis SB2B Gene: Sama_2555: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_2891: hypothetical protein	Shewanella pealeana ATCC 700345 Gene: Spea_3112: hypothetical protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_3196: hypothetical protein	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_3441: hypothetical protein	Shewanella woodyi ATCC 51908 Gene: Swoo_3643: hypothetical protein	hypothetical protein
ampG	Shewanella oneidensis MR-1 Gene: SO3814: AmpG permease	Shewanella putrefaciens CN-32 Gene: Sputcn32_0819: AmpG permease	Shewanella sp W3-18-1 Gene: Sputw3181_3354: AmpG permease	Shewanella sp ANA-3 Gene: Shewana3_0783: AmpG permease	Shewanella sp MR-4 Gene: Shewmr4_3155: AmpG permease	Shewanella sp MR-7 Gene: Shewmr7_0812: AmpG permease	* Shewanella baltica OS155 Site: position = -218 score = 4.38656 sequence = TTTTGTGATCTCTTTTACTCAA Gene: Sbal_0711: AmpG permease	Shewanella denitrificans OS217 Gene: Sden_0771: AmpG permease	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3114: AmpG permease	Shewanella amazonensis SB2B Gene: Sama_2556: AmpG permease	Shewanella loihica PV-4 Gene: Shew_2892: AmpG permease	Shewanella pealeana ATCC 700345 Gene: Spea_3113: AmpG permease	Shewanella halifaxensis HAW-EB4 Gene: Shal_3197: AmpG permease	Shewanella piezotolerans WP3 Gene: swp_1152: AmpG permease	Shewanella sediminis HAW-EB3 Gene: Ssed_3442: AmpG permease	Shewanella woodyi ATCC 51908 Gene: Swoo_3644: AmpG permease	AmpG permease

CRON 54.
mviN	* Shewanella oneidensis MR-1 Site: position = -49 score = 4.5281 sequence = TTTTTTGAGATGAATCACCTAA Gene: SO3534: proposed peptidoglycan lipid II flippase MurJ	* Shewanella putrefaciens CN-32 Site: position = -49 score = 4.5281 sequence = TTTTTTGAGATGAATCACCTAA Gene: Sputcn32_1057: proposed peptidoglycan lipid II flippase MurJ	* Shewanella sp W3-18-1 Site: position = -49 score = 4.5281 sequence = TTTTTTGAGATGAATCACCTAA Gene: Sputw3181_3108: proposed peptidoglycan lipid II flippase MurJ	* Shewanella sp ANA-3 Site: position = -49 score = 4.5281 sequence = TTTTTTGAGATGAATCACCTAA Gene: Shewana3_3138: proposed peptidoglycan lipid II flippase MurJ	* Shewanella sp MR-4 Site: position = -49 score = 4.5281 sequence = TTTTTTGAGATGAATCACCTAA Gene: Shewmr4_2959: proposed peptidoglycan lipid II flippase MurJ	* Shewanella sp MR-7 Site: position = -49 score = 4.5281 sequence = TTTTTTGAGATGAATCACCTAA Gene: Shewmr7_3041: proposed peptidoglycan lipid II flippase MurJ	* Shewanella baltica OS155 Site: position = -49 score = 4.56797 sequence = TTTTTTGAGATGTATCACCTAA Gene: Sbal_1052: proposed peptidoglycan lipid II flippase MurJ	Shewanella denitrificans OS217 Gene: Sden_2725: proposed peptidoglycan lipid II flippase MurJ	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2892: proposed peptidoglycan lipid II flippase MurJ	Shewanella amazonensis SB2B Gene: Sama_0922: proposed peptidoglycan lipid II flippase MurJ	Shewanella loihica PV-4 Gene: Shew_1097: proposed peptidoglycan lipid II flippase MurJ	Shewanella pealeana ATCC 700345 Gene: Spea_1081: proposed peptidoglycan lipid II flippase MurJ	Shewanella halifaxensis HAW-EB4 Gene: Shal_1129: proposed peptidoglycan lipid II flippase MurJ	Shewanella piezotolerans WP3 Gene: swp_3731: proposed peptidoglycan lipid II flippase MurJ	Shewanella sediminis HAW-EB3 Gene: Ssed_1192: proposed peptidoglycan lipid II flippase MurJ	Shewanella woodyi ATCC 51908 Gene: Swoo_1289: proposed peptidoglycan lipid II flippase MurJ	proposed peptidoglycan lipid II flippase MurJ
ribF	Shewanella oneidensis MR-1 Gene: SO3533: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella putrefaciens CN-32 Gene: Sputcn32_1058: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella sp W3-18-1 Gene: Sputw3181_3107: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella sp ANA-3 Gene: Shewana3_3137: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella sp MR-4 Gene: Shewmr4_2958: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella sp MR-7 Gene: Shewmr7_3040: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella baltica OS155 Gene: Sbal_1053: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella denitrificans OS217 Gene: Sden_2724: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2891: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella amazonensis SB2B Gene: Sama_0923: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella loihica PV-4 Gene: Shew_1098: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella pealeana ATCC 700345 Gene: Spea_1082: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella halifaxensis HAW-EB4 Gene: Shal_1130: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella piezotolerans WP3 Gene: swp_3730: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella sediminis HAW-EB3 Gene: Ssed_1193: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	Shewanella woodyi ATCC 51908 Gene: Swoo_1290: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)	riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
ileS	Shewanella oneidensis MR-1 Gene: SO3532: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella putrefaciens CN-32 Gene: Sputcn32_1059: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella sp W3-18-1 Gene: Sputw3181_3106: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella sp ANA-3 Gene: Shewana3_3136: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella sp MR-4 Gene: Shewmr4_2957: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella sp MR-7 Gene: Shewmr7_3039: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella baltica OS155 Gene: Sbal_1054: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella denitrificans OS217 Gene: Sden_2723: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2890: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella amazonensis SB2B Gene: Sama_0924: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella loihica PV-4 Gene: Shew_1099: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella pealeana ATCC 700345 Gene: Spea_1083: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella halifaxensis HAW-EB4 Gene: Shal_1131: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella piezotolerans WP3 Gene: swp_3728: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella sediminis HAW-EB3 Gene: Ssed_1194: isoleucyl-tRNA synthetase (EC 6.1.1.5)	Shewanella woodyi ATCC 51908 Gene: Swoo_1291: isoleucyl-tRNA synthetase (EC 6.1.1.5)	isoleucyl-tRNA synthetase (EC 6.1.1.5)
lspA	Shewanella oneidensis MR-1 Gene: SO3531: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella putrefaciens CN-32 Gene: Sputcn32_1060: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella sp W3-18-1 Gene: Sputw3181_3105: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella sp ANA-3 Gene: Shewana3_3135: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella sp MR-4 Gene: Shewmr4_2956: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella sp MR-7 Gene: Shewmr7_3038: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella baltica OS155 Gene: Sbal_1055: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella denitrificans OS217 Gene: Sden_2722: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2889: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella amazonensis SB2B Gene: Sama_0925: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella loihica PV-4 Gene: Shew_1100: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella pealeana ATCC 700345 Gene: Spea_1084: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella halifaxensis HAW-EB4 Gene: Shal_1132: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella piezotolerans WP3 Gene: swp_3727: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella sediminis HAW-EB3 Gene: Ssed_1195: lipoprotein signal peptidase (EC 3.4.23.36)	Shewanella woodyi ATCC 51908 Gene: Swoo_1292: lipoprotein signal peptidase (EC 3.4.23.36)	lipoprotein signal peptidase (EC 3.4.23.36)
fkbP-2	Shewanella oneidensis MR-1 Gene: SO3530: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella putrefaciens CN-32 Gene: Sputcn32_1061: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella sp W3-18-1 Gene: Sputw3181_3104: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella sp ANA-3 Gene: Shewana3_3134: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella sp MR-4 Gene: Shewmr4_2955: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella sp MR-7 Gene: Shewmr7_3037: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella baltica OS155 Gene: Sbal_1056: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella denitrificans OS217 Gene: Sden_2721: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2888: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella amazonensis SB2B Gene: Sama_0926: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella loihica PV-4 Gene: Shew_1101: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella pealeana ATCC 700345 Gene: Spea_1085: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella halifaxensis HAW-EB4 Gene: Shal_1133: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella piezotolerans WP3 Gene: swp_3725: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella sediminis HAW-EB3 Gene: Ssed_1196: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	Shewanella woodyi ATCC 51908 Gene: Swoo_1293: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)	FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
lytB	Shewanella oneidensis MR-1 Gene: SO3529: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella putrefaciens CN-32 Gene: Sputcn32_1062: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella sp W3-18-1 Gene: Sputw3181_3103: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella sp ANA-3 Gene: Shewana3_3133: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella sp MR-4 Gene: Shewmr4_2954: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella sp MR-7 Gene: Shewmr7_3036: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella baltica OS155 Gene: Sbal_1057: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella denitrificans OS217 Gene: Sden_2720: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2887: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella amazonensis SB2B Gene: Sama_0927: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella loihica PV-4 Gene: Shew_1102: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella pealeana ATCC 700345 Gene: Spea_1086: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella halifaxensis HAW-EB4 Gene: Shal_1134: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella piezotolerans WP3 Gene: swp_3724: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella sediminis HAW-EB3 Gene: Ssed_1197: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	Shewanella woodyi ATCC 51908 Gene: Swoo_1294: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)	4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
pilV	Shewanella oneidensis MR-1 Gene: SO3528: type IV fimbrial biogenesis protein PilV	Shewanella putrefaciens CN-32 Gene: Sputcn32_1063: type IV fimbrial biogenesis protein PilV	Shewanella sp W3-18-1 Gene: Sputw3181_3102: type IV fimbrial biogenesis protein PilV	Shewanella sp ANA-3 Gene: Shewana3_3132: type IV fimbrial biogenesis protein PilV	Shewanella sp MR-4 Gene: Shewmr4_2953: type IV fimbrial biogenesis protein PilV	Shewanella sp MR-7 Gene: Shewmr7_3035: type IV fimbrial biogenesis protein PilV	Shewanella baltica OS155 Gene: Sbal_1058: type IV fimbrial biogenesis protein PilV	Shewanella denitrificans OS217 Gene: Sden_2719: type IV fimbrial biogenesis protein PilV	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2886: type IV fimbrial biogenesis protein PilV	* Shewanella amazonensis SB2B Site: position = -138 score = 3.85633 sequence = TATTGTTACTGGCAGCAAACAA Gene: Sama_0928: type IV fimbrial biogenesis protein PilV	Shewanella loihica PV-4 Gene: Shew_1103: type IV fimbrial biogenesis protein PilV	Shewanella pealeana ATCC 700345 Gene: Spea_1087: type IV fimbrial biogenesis protein PilV	Shewanella halifaxensis HAW-EB4 Gene: Shal_1135: type IV fimbrial biogenesis protein PilV	Shewanella piezotolerans WP3 Gene: swp_3723: type IV fimbrial biogenesis protein PilV	Shewanella sediminis HAW-EB3 Gene: Ssed_1198: type IV fimbrial biogenesis protein PilV	Shewanella woodyi ATCC 51908 Gene: Swoo_1295: type IV fimbrial biogenesis protein PilV	type IV fimbrial biogenesis protein PilV
pilW	Shewanella oneidensis MR-1 Gene: SO3527: type IV fimbrial biogenesis protein PilW	Shewanella putrefaciens CN-32 Gene: Sputcn32_1064: type IV fimbrial biogenesis protein PilW	Shewanella sp W3-18-1 Gene: Sputw3181_3101: type IV fimbrial biogenesis protein PilW	Shewanella sp ANA-3 Gene: Shewana3_3131: type IV fimbrial biogenesis protein PilW	Shewanella sp MR-4 Gene: Shewmr4_2952: type IV fimbrial biogenesis protein PilW	Shewanella sp MR-7 Gene: Shewmr7_3034: type IV fimbrial biogenesis protein PilW	Shewanella baltica OS155 Gene: Sbal_1059: type IV fimbrial biogenesis protein PilW	Shewanella denitrificans OS217 Gene: Sden_2718: type IV fimbrial biogenesis protein PilW	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2885: type IV fimbrial biogenesis protein PilW	Shewanella amazonensis SB2B Gene: Sama_0929: type IV fimbrial biogenesis protein PilW	Shewanella loihica PV-4 Gene: Shew_1104: type IV fimbrial biogenesis protein PilW	Shewanella pealeana ATCC 700345 Gene: Spea_1088: type IV fimbrial biogenesis protein PilW	Shewanella halifaxensis HAW-EB4 Gene: Shal_1136: type IV fimbrial biogenesis protein PilW	Shewanella piezotolerans WP3 Gene: swp_3722: type IV fimbrial biogenesis protein PilW	Shewanella sediminis HAW-EB3 Gene: Ssed_1199: type IV fimbrial biogenesis protein PilW	Shewanella woodyi ATCC 51908 Gene: Swoo_1296: type IV fimbrial biogenesis protein PilW	type IV fimbrial biogenesis protein PilW
pilX	Shewanella oneidensis MR-1 Gene: SO3526: type IV fimbrial biogenesis protein PilX	Shewanella putrefaciens CN-32 Gene: Sputcn32_1065: type IV fimbrial biogenesis protein PilX	Shewanella sp W3-18-1 Gene: Sputw3181_3100: type IV fimbrial biogenesis protein PilX	Shewanella sp ANA-3 Gene: Shewana3_3130: type IV fimbrial biogenesis protein PilX	Shewanella sp MR-4 Gene: Shewmr4_2951: type IV fimbrial biogenesis protein PilX	Shewanella sp MR-7 Gene: Shewmr7_3033: type IV fimbrial biogenesis protein PilX	Shewanella baltica OS155 Gene: Sbal_1060: type IV fimbrial biogenesis protein PilX	Shewanella denitrificans OS217 Gene: Sden_2717: type IV fimbrial biogenesis protein PilX	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2884: type IV fimbrial biogenesis protein PilX	Shewanella amazonensis SB2B Gene: Sama_0930: type IV fimbrial biogenesis protein PilX	Shewanella loihica PV-4 Gene: Shew_1105: type IV fimbrial biogenesis protein PilX	Shewanella pealeana ATCC 700345 Gene: Spea_1089: type IV fimbrial biogenesis protein PilX	Shewanella halifaxensis HAW-EB4 Gene: Shal_1137: type IV fimbrial biogenesis protein PilX	Shewanella piezotolerans WP3 Gene: swp_3721: type IV fimbrial biogenesis protein PilX	Shewanella sediminis HAW-EB3 Gene: Ssed_1200: type IV fimbrial biogenesis protein PilX	Shewanella woodyi ATCC 51908 Gene: Swoo_1297: type IV fimbrial biogenesis protein PilX	type IV fimbrial biogenesis protein PilX
pilY1	Shewanella oneidensis MR-1 Gene: SO3525: type IV fimbrial biogenesis protein PilY1	Shewanella putrefaciens CN-32 Gene: Sputcn32_1066: type IV fimbrial biogenesis protein PilY1	Shewanella sp W3-18-1 Gene: Sputw3181_3099: type IV fimbrial biogenesis protein PilY1	Shewanella sp ANA-3 Gene: Shewana3_3129: type IV fimbrial biogenesis protein PilY1	Shewanella sp MR-4 Gene: Shewmr4_2950: type IV fimbrial biogenesis protein PilY1	Shewanella sp MR-7 Gene: Shewmr7_3032: type IV fimbrial biogenesis protein PilY1	Shewanella baltica OS155 Gene: Sbal_1061: type IV fimbrial biogenesis protein PilY1	Shewanella denitrificans OS217 Gene: Sden_2716: type IV fimbrial biogenesis protein PilY1	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2883: type IV fimbrial biogenesis protein PilY1	Shewanella amazonensis SB2B Gene: Sama_0931: type IV fimbrial biogenesis protein PilY1	Shewanella loihica PV-4 Gene: Shew_1106: type IV fimbrial biogenesis protein PilY1	Shewanella pealeana ATCC 700345 Gene: Spea_1090: type IV fimbrial biogenesis protein PilY1	Shewanella halifaxensis HAW-EB4 Gene: Shal_1138: type IV fimbrial biogenesis protein PilY1	Shewanella piezotolerans WP3 Gene: swp_3720: type IV fimbrial biogenesis protein PilY1	Shewanella sediminis HAW-EB3 Gene: Ssed_1201: type IV fimbrial biogenesis protein PilY1	Shewanella woodyi ATCC 51908 Gene: Swoo_1298: type IV fimbrial biogenesis protein PilY1	type IV fimbrial biogenesis protein PilY1
pilE	Shewanella oneidensis MR-1 Gene: SO3524: type IV pilus biogenesis protein PilE	Shewanella putrefaciens CN-32 Gene: Sputcn32_1067: type IV pilus biogenesis protein PilE	Shewanella sp W3-18-1 Gene: Sputw3181_3098: type IV pilus biogenesis protein PilE	Shewanella sp ANA-3 Gene: Shewana3_3128: type IV pilus biogenesis protein PilE	Shewanella sp MR-4 Gene: Shewmr4_2949: type IV pilus biogenesis protein PilE	Shewanella sp MR-7 Gene: Shewmr7_3031: type IV pilus biogenesis protein PilE	Shewanella baltica OS155 Gene: Sbal_1062: type IV pilus biogenesis protein PilE	Shewanella denitrificans OS217 Gene: Sden_2715: type IV pilus biogenesis protein PilE	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2882: type IV pilus biogenesis protein PilE	Shewanella amazonensis SB2B Gene: Sama_0932: type IV pilus biogenesis protein PilE	Shewanella loihica PV-4 Gene: Shew_1107: type IV pilus biogenesis protein PilE	Shewanella pealeana ATCC 700345 Gene: Spea_1091: type IV pilus biogenesis protein PilE	Shewanella halifaxensis HAW-EB4 Gene: Shal_1139: type IV pilus biogenesis protein PilE	Shewanella piezotolerans WP3 Gene: swp_3719: type IV pilus biogenesis protein PilE	Shewanella sediminis HAW-EB3 Gene: Ssed_1202: type IV pilus biogenesis protein PilE	Shewanella woodyi ATCC 51908 Gene: Swoo_1299: type IV pilus biogenesis protein PilE	type IV pilus biogenesis protein PilE

CRON 55.
mdh	* Shewanella oneidensis MR-1 Site: position = -47 score = 4.29841 sequence = AAATTAGATCCATGTCACACAT Gene: SO0770: malate dehydrogenase (EC 1.1.1.37)	* Shewanella putrefaciens CN-32 Site: position = -46 score = 3.97202 sequence = AAACTAGATCCATGTCACACAT Gene: Sputcn32_3219: malate dehydrogenase (EC 1.1.1.37)	* Shewanella sp W3-18-1 Site: position = -46 score = 3.97202 sequence = AAACTAGATCCATGTCACACAT Gene: Sputw3181_0722: malate dehydrogenase (EC 1.1.1.37)	* Shewanella sp ANA-3 Site: position = -46 score = 4.29841 sequence = AAATTAGATCCATGTCACACAT Gene: Shewana3_3509: malate dehydrogenase (EC 1.1.1.37)	* Shewanella sp MR-4 Site: position = -46 score = 4.29841 sequence = AAATTAGATCCATGTCACACAT Gene: Shewmr4_3339: malate dehydrogenase (EC 1.1.1.37)	* Shewanella sp MR-7 Site: position = -46 score = 4.29841 sequence = AAATTAGATCCATGTCACACAT Gene: Shewmr7_0614: malate dehydrogenase (EC 1.1.1.37)	* Shewanella baltica OS155 Site: position = -46 score = 4.29841 sequence = AAATTAGATCCATGTCACACAT Gene: Sbal_0609: malate dehydrogenase (EC 1.1.1.37)	Shewanella denitrificans OS217 Gene: Sden_0826: malate dehydrogenase (EC 1.1.1.37)	* Shewanella frigidimarina NCIMB 400 Site: position = -45 score = 4.154 sequence = AATTTAGATCTATGTCACAAAC Gene: Sfri_3173: malate dehydrogenase (EC 1.1.1.37)	* Shewanella amazonensis SB2B Site: position = -46 score = 3.78342 sequence = TTTGAGGATCTACCTCACAAAT Gene: Sama_0672: malate dehydrogenase (EC 1.1.1.37)	* Shewanella loihica PV-4 Site: position = -47 score = 4.46978 sequence = AATCTAGATCTATATCACATAA Gene: Shew_0867: malate dehydrogenase (EC 1.1.1.37)	Shewanella pealeana ATCC 700345 Gene: Spea_0850: malate dehydrogenase (EC 1.1.1.37)	* Shewanella halifaxensis HAW-EB4 Site: position = -46 score = 3.88457 sequence = AAGATGGATCTGAATCACAAAA Gene: Shal_0903: malate dehydrogenase (EC 1.1.1.37)	* Shewanella piezotolerans WP3 Site: position = -46 score = 3.92088 sequence = AAAACAGATCTAAATCACAAAA Gene: swp_4100: malate dehydrogenase (EC 1.1.1.37)	* Shewanella sediminis HAW-EB3 Site: position = -136 score = 4.08545 sequence = TTTATTGATGTAGAACAAAAAT Gene: Ssed_0952: malate dehydrogenase (EC 1.1.1.37)	* Shewanella woodyi ATCC 51908 Site: position = -47 score = 3.82399 sequence = AATGTAGACCTACATCACAAAA Gene: Swoo_1002: malate dehydrogenase (EC 1.1.1.37)	malate dehydrogenase (EC 1.1.1.37)

CRON 56.
cytcB	* Shewanella oneidensis MR-1 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATTA Gene: SO4666: diheme cytochrome c4	* Shewanella putrefaciens CN-32 Site: position = -95 score = 4.32157 sequence = AAATATTACTCCGATCACATTA Gene: Sputcn32_3908: diheme cytochrome c4	* Shewanella sp W3-18-1 Site: position = -95 score = 4.32157 sequence = AAATATTACTCCGATCACATTA Gene: Sputw3181_0043: diheme cytochrome c4	* Shewanella sp ANA-3 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATTA Gene: Shewana3_4111: diheme cytochrome c4	* Shewanella sp MR-4 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATTA Gene: Shewmr4_3907: diheme cytochrome c4	* Shewanella sp MR-7 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATTA Gene: Shewmr7_3999: diheme cytochrome c4	* Shewanella baltica OS155 Site: position = -95 score = 4.32157 sequence = AAATATTACTCCGATCACATTA Gene: Sbal_0051: diheme cytochrome c4	* Shewanella denitrificans OS217 Site: position = -94 score = 3.70779 sequence = AAATATTATTTCGAGCATAATA Gene: Sden_3622: diheme cytochrome c4	* Shewanella frigidimarina NCIMB 400 Site: position = -181 score = 4.34371 sequence = AAATATTAGCCTGATCACATTA Gene: Sfri_3945: diheme cytochrome c4	* Shewanella amazonensis SB2B Site: position = -95 score = 3.70946 sequence = AAATATTGCCCCGATCACATAT Gene: Sama_0091: diheme cytochrome c4	* Shewanella loihica PV-4 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATAA Gene: Shew_3716: diheme cytochrome c4	* Shewanella pealeana ATCC 700345 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATAA Gene: Spea_0100: diheme cytochrome c4	* Shewanella halifaxensis HAW-EB4 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATAA Gene: Shal_4222: diheme cytochrome c4	* Shewanella piezotolerans WP3 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATAA Gene: swp_5075: diheme cytochrome c4	* Shewanella sediminis HAW-EB3 Site: position = -96 score = 4.51372 sequence = AAATATTACCTCGATCACATAA Gene: Ssed_0094: diheme cytochrome c4	* Shewanella woodyi ATCC 51908 Site: position = -157 score = 4.1598 sequence = AAATATGATGTTTTGCACTTTA Site: position = -96 score = 4.43127 sequence = AAATATTACCTCGATCACAATA Gene: Swoo_0057: diheme cytochrome c4	diheme cytochrome c4

CRON 57.
SO1821	Shewanella oneidensis MR-1 Gene: SO1821: outer membrane porin, putative	* Shewanella putrefaciens CN-32 Site: position = -140 score = 4.44343 sequence = TTTTGTGATGTTAATCTACATA Gene: Sputcn32_1515: outer membrane porin, putative	* Shewanella sp W3-18-1 Site: position = -140 score = 4.44343 sequence = TTTTGTGATGTTAATCTACATA Gene: Sputw3181_2585: outer membrane porin, putative	* Shewanella sp ANA-3 Site: position = -140 score = 4.38176 sequence = TTTTGTGATGTTTCTCTACATA Gene: Shewana3_2628: outer membrane porin, putative	* Shewanella sp MR-4 Site: position = -140 score = 4.38176 sequence = TTTTGTGATGTTTCTCTACATA Gene: Shewmr4_2468: outer membrane porin, putative	* Shewanella sp MR-7 Site: position = -140 score = 4.38176 sequence = TTTTGTGATGTTTCTCTACATA Gene: Shewmr7_2536: outer membrane porin, putative	* Shewanella baltica OS155 Site: position = -143 score = 4.54093 sequence = TTTTGTGATGTTAATCGACATA Gene: Sbal_1631: outer membrane porin, putative	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -307 score = 4.35854 sequence = AGTCGCGATCTACATCAAATAA Site: position = -140 score = 4.16268 sequence = TTATATGAGATATATCGCCTTT Gene: Sfri_3603: outer membrane porin, putative	* Shewanella amazonensis SB2B Site: position = -140 score = 4.53854 sequence = TGTTGTGATTTTTAACACGTTT Site: position = -168 score = 3.88342 sequence = TTATCTGATAGAGATTTCAATT Gene: Sama_1251: outer membrane porin, putative	Shewanella loihica PV-4 Gene: Shew_2481: outer membrane porin, putative	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_2557: outer membrane porin, putative	Shewanella woodyi ATCC 51908 Gene: Swoo_3084: outer membrane porin, putative	outer membrane porin, putative

CRON 58.
ygbA	* Shewanella oneidensis MR-1 Site: position = -97 score = 4.05487 sequence = TTTTGTGCGCACCTTCATAAAT Gene: SO0324: nitrosative stress induced protein	* Shewanella putrefaciens CN-32 Site: position = -96 score = 4.05487 sequence = TTTTGTGCGCACCTTCATAAAT Gene: Sputcn32_3663: nitrosative stress induced protein	* Shewanella sp W3-18-1 Site: position = -96 score = 4.05487 sequence = TTTTGTGCGCACCTTCATAAAT Gene: Sputw3181_3804: nitrosative stress induced protein	* Shewanella sp ANA-3 Site: position = -97 score = 4.06993 sequence = TTTTGTGCGCATCTTCATAAAT Gene: Shewana3_3845: nitrosative stress induced protein	* Shewanella sp MR-4 Site: position = -97 score = 4.06993 sequence = TTTTGTGCGCATCTTCATAAAT Gene: Shewmr4_3649: nitrosative stress induced protein	* Shewanella sp MR-7 Site: position = -97 score = 4.06993 sequence = TTTTGTGCGCATCTTCATAAAT Gene: Shewmr7_0295: nitrosative stress induced protein	* Shewanella baltica OS155 Site: position = -96 score = 4.05487 sequence = TTTTGTGCGCACCTTCATAAAT Gene: Sbal_4067: nitrosative stress induced protein	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -142 score = 3.98547 sequence = TTTTGCGATCCCAACCTCAAAA Gene: Sfri_0404: nitrosative stress induced protein	* Shewanella amazonensis SB2B Site: position = -94 score = 3.59739 sequence = TTTTGTGCGCATCTTCATGCTT Gene: Sama_3326: nitrosative stress induced protein	* Shewanella loihica PV-4 Site: position = -96 score = 4.06993 sequence = TTTTGTGCGCATCTTCATAATT Gene: Shew_0259: nitrosative stress induced protein	* Shewanella pealeana ATCC 700345 Site: position = -96 score = 3.89312 sequence = TTTTGTGCACATCTTCAAAGTT Gene: Spea_0303: nitrosative stress induced protein	* Shewanella halifaxensis HAW-EB4 Site: position = -96 score = 3.99827 sequence = TTTTGTGCACATCTTCAAACTT Gene: Shal_3986: nitrosative stress induced protein	* Shewanella piezotolerans WP3 Site: position = -96 score = 4.03726 sequence = TTTTGTGCGCACCTTCAAACTT Gene: swp_2171: nitrosative stress induced protein	* Shewanella sediminis HAW-EB3 Site: position = -187 score = 3.90078 sequence = TTTTGTGCACATCTTCATACTT Gene: Ssed_4199: nitrosative stress induced protein	* Shewanella woodyi ATCC 51908 Site: position = -82 score = 3.43868 sequence = TTCTGTGCGCACCTTCATAGAT Gene: Swoo_0395: nitrosative stress induced protein	nitrosative stress induced protein

CRON 59.
astC	* Shewanella oneidensis MR-1 Site: position = -142 score = 4.04968 sequence = AACTGGTATTTTGATCACAATT Gene: SO0617: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella putrefaciens CN-32 Site: position = -142 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: Sputcn32_0645: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella sp W3-18-1 Site: position = -142 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: Sputw3181_3529: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella sp ANA-3 Site: position = -142 score = 4.04968 sequence = AACTGGTATTTTGATCACAATT Gene: Shewana3_0610: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella sp MR-4 Site: position = -142 score = 4.04968 sequence = AACTGGTATTTTGATCACAATT Gene: Shewmr4_0611: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella sp MR-7 Site: position = -308 score = 3.8086 sequence = AATTGTGTAGTTATTCATATTC Gene: Shewmr7_3419: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella baltica OS155 Site: position = -142 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: Sbal_0571: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella denitrificans OS217 Site: position = -136 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: Sden_3193: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella frigidimarina NCIMB 400 Site: position = -137 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: Sfri_3299: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella amazonensis SB2B Site: position = -142 score = 4.03462 sequence = AACTGGTATTTCGATCACAATT Gene: Sama_3011: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella loihica PV-4 Site: position = -140 score = 3.77468 sequence = AACTGGTATTTTGATCACGTTT Gene: Shew_0578: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella pealeana ATCC 700345 Site: position = -138 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: Spea_3516: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella halifaxensis HAW-EB4 Site: position = -138 score = 3.68727 sequence = AACTGGCATTCTGATCACATTT Gene: Shal_3610: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella piezotolerans WP3 Site: position = -140 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: swp_0747: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella sediminis HAW-EB3 Site: position = -141 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Site: position = -121 score = 3.90743 sequence = TTTCGTTATTAATGTCACTTAA Gene: Ssed_0809: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	* Shewanella woodyi ATCC 51908 Site: position = -172 score = 4.29072 sequence = ATATGTGCTGCTGATCTTATTT Gene: Swoo_0655: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)	Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
astA	Shewanella oneidensis MR-1 Gene: SO0618: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0646: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella sp W3-18-1 Gene: Sputw3181_3528: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella sp ANA-3 Gene: Shewana3_0611: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella sp MR-4 Gene: Shewmr4_0612: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella sp MR-7 Gene: Shewmr7_3418: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella baltica OS155 Gene: Sbal_0572: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella denitrificans OS217 Gene: Sden_3192: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3298: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella amazonensis SB2B Gene: Sama_3010: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella loihica PV-4 Gene: Shew_0579: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella pealeana ATCC 700345 Gene: Spea_3515: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3609: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella piezotolerans WP3 Gene: swp_0748: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella sediminis HAW-EB3 Gene: Ssed_0810: Arginine N-succinyltransferase (EC 2.3.1.109)	Shewanella woodyi ATCC 51908 Gene: Swoo_0656: Arginine N-succinyltransferase (EC 2.3.1.109)	Arginine N-succinyltransferase (EC 2.3.1.109)
astD	Shewanella oneidensis MR-1 Gene: SO0619: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0647: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella sp W3-18-1 Gene: Sputw3181_3527: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella sp ANA-3 Gene: Shewana3_0612: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella sp MR-4 Gene: Shewmr4_0613: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella sp MR-7 Gene: Shewmr7_3417: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella baltica OS155 Gene: Sbal_0573: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella denitrificans OS217 Gene: Sden_3191: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3297: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella amazonensis SB2B Gene: Sama_3009: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella loihica PV-4 Gene: Shew_0580: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella pealeana ATCC 700345 Gene: Spea_3514: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3608: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella piezotolerans WP3 Gene: swp_0749: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella sediminis HAW-EB3 Gene: Ssed_0811: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Shewanella woodyi ATCC 51908 Gene: Swoo_0657: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)	Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
SO0620	Shewanella oneidensis MR-1 Gene: SO0620: FIG008480: hypothetical protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_0648: FIG008480: hypothetical protein	Shewanella sp W3-18-1 Gene: Sputw3181_3526: FIG008480: hypothetical protein	Shewanella sp ANA-3 Gene: Shewana3_0613: FIG008480: hypothetical protein	Shewanella sp MR-4 Gene: Shewmr4_0614: FIG008480: hypothetical protein	Shewanella sp MR-7 Gene: Shewmr7_3416: FIG008480: hypothetical protein	Shewanella baltica OS155 Gene: Sbal_0574: FIG008480: hypothetical protein	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3296: FIG008480: hypothetical protein	Shewanella amazonensis SB2B Gene: Sama_3008: FIG008480: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_0581: FIG008480: hypothetical protein	Shewanella pealeana ATCC 700345 Gene: Spea_3513: FIG008480: hypothetical protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_3607: FIG008480: hypothetical protein	Shewanella piezotolerans WP3 Gene: swp_0750: FIG008480: hypothetical protein	Shewanella sediminis HAW-EB3 Gene: Ssed_0812: FIG008480: hypothetical protein	Shewanella woodyi ATCC 51908 Gene: Swoo_0658: FIG008480: hypothetical protein	FIG008480: hypothetical protein

CRON 60.
scyA	* Shewanella oneidensis MR-1 Site: position = -234 score = 3.96983 sequence = CAATTTGATATGGTTCCAATAA Site: position = -125 score = 4.12482 sequence = TGCTGAGATTCTAATCACAAAA Gene: SO0264: cytochrome c-type protein	* Shewanella putrefaciens CN-32 Site: position = -229 score = 4.04351 sequence = CAATTTGATGTGGTTCCAATAA Site: position = -129 score = 3.74717 sequence = CGCTGAGATTCTAATCACAAAA Gene: Sputcn32_3726: cytochrome c-type protein	* Shewanella sp W3-18-1 Site: position = -229 score = 4.04351 sequence = CAATTTGATGTGGTTCCAATAA Site: position = -129 score = 3.74717 sequence = CGCTGAGATTCTAATCACAAAA Gene: Sputw3181_0189: cytochrome c-type protein	* Shewanella sp ANA-3 Site: position = -234 score = 4.04351 sequence = CAATTTGATGTGGTTCCAATAA Site: position = -125 score = 4.12482 sequence = TGCTGAGATTCTAATCACAAAA Gene: Shewana3_0232: cytochrome c-type protein	* Shewanella sp MR-4 Site: position = -234 score = 4.04351 sequence = CAATTTGATGTGGTTCCAATAA Site: position = -125 score = 4.12482 sequence = TGCTGAGATTCTAATCACAAAA Gene: Shewmr4_0232: cytochrome c-type protein	* Shewanella sp MR-7 Site: position = -234 score = 4.04351 sequence = CAATTTGATGTGGTTCCAATAA Site: position = -125 score = 3.74717 sequence = CGCTGAGATTCTAATCACAAAA Gene: Shewmr7_0227: cytochrome c-type protein	* Shewanella baltica OS155 Site: position = -228 score = 3.94327 sequence = CAATATGATGTGGTTCCAATAA Site: position = -128 score = 4.52076 sequence = TGTTGAGATTCTAATCACAAAA Gene: Sbal_0229: cytochrome c-type protein	* Shewanella denitrificans OS217 Site: position = -131 score = 3.79793 sequence = AGCTGGGAGGCTTATCACAAAA Site: position = -109 score = 4.10054 sequence = AGGTGTGATTTTATTAACTTTA Gene: Sden_3568: cytochrome c-type protein	* Shewanella frigidimarina NCIMB 400 Site: position = -233 score = 3.91585 sequence = CAATTTGATATGGTTCCAAAAT Site: position = -133 score = 4.09514 sequence = AGCTGAGATTGTTATCACAAAA Gene: Sfri_0180: cytochrome c-type protein	* Shewanella amazonensis SB2B Site: position = -225 score = 3.99267 sequence = CAATTTGATGCAGTTCCAATAA Gene: Sama_0246: cytochrome c-type protein	* Shewanella loihica PV-4 Site: position = -131 score = 4.83681 sequence = AATTCTGATATTAATCACAAAA Site: position = -242 score = 3.80276 sequence = CAATTTGATATGCTTCCAAAAA Gene: Shew_0191: cytochrome c-type protein	* Shewanella pealeana ATCC 700345 Site: position = -230 score = 4.38557 sequence = CAATTTGATGTAGTTCGAATAT Site: position = -130 score = 3.96819 sequence = TGGCGAGATTAATATCACAAAA Gene: Spea_0216: cytochrome c-type protein	* Shewanella halifaxensis HAW-EB4 Site: position = -230 score = 4.38557 sequence = CAATTTGATGTAGTTCGAATAT Gene: Shal_4103: cytochrome c-type protein	* Shewanella piezotolerans WP3 Site: position = -131 score = 4.80485 sequence = TAACGCGATTTAAATCACAAAT Site: position = -231 score = 4.38557 sequence = CAATTTGATGTAGTTCGAATAT Gene: swp_2044: cytochrome c-type protein	* Shewanella sediminis HAW-EB3 Site: position = -145 score = 4.39142 sequence = AGCTTTGATTGAAATCACAAAA Gene: Ssed_4286: cytochrome c-type protein	* Shewanella woodyi ATCC 51908 Site: position = -256 score = 3.80276 sequence = CAATTTGATATGCTTCCAAAAA Site: position = -144 score = 3.94285 sequence = TACTTTGATTAAAGTCATAAAA Gene: Swoo_4658: cytochrome c-type protein	cytochrome c-type protein

CRON 61.
sodB	* Shewanella oneidensis MR-1 Site: position = -91 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: SO2881: superoxide dismutase [Fe] (EC 1.15.1.1)	* Shewanella putrefaciens CN-32 Site: position = -91 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: Sputcn32_1687: superoxide dismutase [Fe] (EC 1.15.1.1)	* Shewanella sp W3-18-1 Site: position = -91 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: Sputw3181_2338: superoxide dismutase [Fe] (EC 1.15.1.1)	* Shewanella sp ANA-3 Site: position = -91 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: Shewana3_1639: superoxide dismutase [Fe] (EC 1.15.1.1)	* Shewanella sp MR-4 Site: position = -91 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: Shewmr4_1572: superoxide dismutase [Fe] (EC 1.15.1.1)	* Shewanella sp MR-7 Site: position = -91 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: Shewmr7_1647: superoxide dismutase [Fe] (EC 1.15.1.1)	* Shewanella baltica OS155 Site: position = -90 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: Sbal_1782: superoxide dismutase [Fe] (EC 1.15.1.1)	* Shewanella denitrificans OS217 Site: position = -106 score = 4.30949 sequence = AACAATGATGCACATCACAAAA Gene: Sden_1639: superoxide dismutase [Fe] (EC 1.15.1.1)	* Shewanella frigidimarina NCIMB 400 Site: position = -102 score = 4.23581 sequence = AACAATGATTCACATCACAAAA Gene: Sfri_1747: superoxide dismutase [Fe] (EC 1.15.1.1)	* Shewanella amazonensis SB2B Site: position = -91 score = 4.2131 sequence = AAGAATGATTCACATCACAGAT Gene: Sama_1920: superoxide dismutase [Fe] (EC 1.15.1.1)	* Shewanella loihica PV-4 Site: position = -89 score = 3.79477 sequence = AACAATGATTCACATCACAACT Gene: Shew_1834: superoxide dismutase [Fe] (EC 1.15.1.1)	Shewanella pealeana ATCC 700345 Gene: Spea_1963: superoxide dismutase [Fe] (EC 1.15.1.1)	* Shewanella halifaxensis HAW-EB4 Site: position = -93 score = 3.73953 sequence = AACAATGATACACTTCACAACT Gene: Shal_2336: superoxide dismutase [Fe] (EC 1.15.1.1)	Shewanella piezotolerans WP3 Gene: swp_2754: superoxide dismutase [Fe] (EC 1.15.1.1)	Shewanella sediminis HAW-EB3 Gene: Ssed_2445: superoxide dismutase [Fe] (EC 1.15.1.1)	Shewanella woodyi ATCC 51908 Gene: Swoo_2159: superoxide dismutase [Fe] (EC 1.15.1.1)	superoxide dismutase [Fe] (EC 1.15.1.1)

CRON 62.
ccmA	* Shewanella oneidensis MR-1 Site: position = -222 score = 4.2202 sequence = TTTTGTGATTAGAATCTCAGCA Gene: SO0263: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella putrefaciens CN-32 Site: position = -213 score = 3.91053 sequence = TTTTGTGATTAGAATCTCAGCG Gene: Sputcn32_3727: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella sp W3-18-1 Site: position = -213 score = 3.91053 sequence = TTTTGTGATTAGAATCTCAGCG Gene: Sputw3181_0188: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella sp ANA-3 Site: position = -222 score = 4.2202 sequence = TTTTGTGATTAGAATCTCAGCA Gene: Shewana3_0231: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella sp MR-4 Site: position = -222 score = 4.2202 sequence = TTTTGTGATTAGAATCTCAGCA Gene: Shewmr4_0231: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella sp MR-7 Site: position = -222 score = 3.91053 sequence = TTTTGTGATTAGAATCTCAGCG Gene: Shewmr7_0226: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella baltica OS155 Site: position = -212 score = 4.44046 sequence = TTTTGTGATTAGAATCTCAACA Gene: Sbal_0228: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella denitrificans OS217 Site: position = -186 score = 3.9967 sequence = TTTTGTGATAAGCCTCCCAGCT Gene: Sden_3569: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella frigidimarina NCIMB 400 Site: position = -213 score = 4.15994 sequence = TTTTGTGATAACAATCTCAGCT Gene: Sfri_0179: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella amazonensis SB2B Site: position = -207 score = 3.79572 sequence = TTTTGTGAGTTCCCTCCCAGCT Gene: Sama_0245: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella loihica PV-4 Site: position = -223 score = 4.83884 sequence = TTTTGTGATTAATATCAGAATT Gene: Shew_0190: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella pealeana ATCC 700345 Site: position = -112 score = 3.75256 sequence = ATATTCGAACTACATCAAATTG Site: position = -212 score = 4.13455 sequence = TTTTGTGATATTAATCTCGCCA Gene: Spea_0215: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella halifaxensis HAW-EB4 Site: position = -212 score = 3.937 sequence = TTTTGTGACATAAACCGTACTA Site: position = -112 score = 3.75256 sequence = ATATTCGAACTACATCAAATTG Gene: Shal_4104: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella piezotolerans WP3 Site: position = -112 score = 3.75256 sequence = ATATTCGAACTACATCAAATTG Site: position = -212 score = 5.00451 sequence = ATTTGTGATTTAAATCGCGTTA Gene: swp_2043: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella sediminis HAW-EB3 Site: position = -223 score = 4.49775 sequence = TTTTGTGATTTCAATCAAAGCT Gene: Ssed_4287: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	* Shewanella woodyi ATCC 51908 Site: position = -224 score = 4.15542 sequence = TTTTATGACTTTAATCAAAGTA Gene: Swoo_4659: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA	ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
ccmB	Shewanella oneidensis MR-1 Gene: SO0262: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella putrefaciens CN-32 Gene: Sputcn32_3728: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella sp W3-18-1 Gene: Sputw3181_0187: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella sp ANA-3 Gene: Shewana3_0230: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella sp MR-4 Gene: Shewmr4_0230: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella sp MR-7 Gene: Shewmr7_0225: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella baltica OS155 Gene: Sbal_0227: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella denitrificans OS217 Gene: Sden_3570: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0178: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella amazonensis SB2B Gene: Sama_0244: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella loihica PV-4 Gene: Shew_0189: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella pealeana ATCC 700345 Gene: Spea_0214: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella halifaxensis HAW-EB4 Gene: Shal_4105: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella piezotolerans WP3 Gene: swp_2042: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella sediminis HAW-EB3 Gene: Ssed_4288: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	Shewanella woodyi ATCC 51908 Gene: Swoo_4660: ABC transporter involved in cytochrome c biogenesis, CcmB subunit	ABC transporter involved in cytochrome c biogenesis, CcmB subunit
ccmC	Shewanella oneidensis MR-1 Gene: SO0261: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella putrefaciens CN-32 Gene: Sputcn32_3729: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella sp W3-18-1 Gene: Sputw3181_0186: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella sp ANA-3 Gene: Shewana3_0229: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella sp MR-4 Gene: Shewmr4_0229: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella sp MR-7 Gene: Shewmr7_0224: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella baltica OS155 Gene: Sbal_0226: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella denitrificans OS217 Gene: Sden_3571: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0177: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella amazonensis SB2B Gene: Sama_0243: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella loihica PV-4 Gene: Shew_0188: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella pealeana ATCC 700345 Gene: Spea_0213: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella halifaxensis HAW-EB4 Gene: Shal_4106: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella piezotolerans WP3 Gene: swp_2041: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella sediminis HAW-EB3 Gene: Ssed_4289: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	Shewanella woodyi ATCC 51908 Gene: Swoo_4661: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE	cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
ccmD	Shewanella oneidensis MR-1 Gene: SO0260: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella putrefaciens CN-32 Gene: Sputcn32_3730: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella sp W3-18-1 Gene: Sputw3181_0185: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella sp ANA-3 Gene: Shewana3_0228: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella sp MR-4 Gene: Shewmr4_0228: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella sp MR-7 Gene: Shewmr7_0223: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella baltica OS155 Gene: Sbal_0225: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella denitrificans OS217 Gene: Sden_3572: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0176: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella amazonensis SB2B Gene: Sama_0242: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella loihica PV-4 Gene: Shew_0187: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella pealeana ATCC 700345 Gene: Spea_0212: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella halifaxensis HAW-EB4 Gene: Shal_4107: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella piezotolerans WP3 Gene: swp_2040: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella sediminis HAW-EB3 Gene: Ssed_4290: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	Shewanella woodyi ATCC 51908 Gene: Swoo_4662: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE	cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
ccmE	Shewanella oneidensis MR-1 Gene: SO0259: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella putrefaciens CN-32 Gene: Sputcn32_3731: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella sp W3-18-1 Gene: Sputw3181_0184: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella sp ANA-3 Gene: Shewana3_0227: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella sp MR-4 Gene: Shewmr4_0227: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella sp MR-7 Gene: Shewmr7_0222: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella baltica OS155 Gene: Sbal_0224: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella denitrificans OS217 Gene: Sden_3573: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0175: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella amazonensis SB2B Gene: Sama_0241: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella loihica PV-4 Gene: Shew_0186: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella pealeana ATCC 700345 Gene: Spea_0211: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella halifaxensis HAW-EB4 Gene: Shal_4108: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella piezotolerans WP3 Gene: swp_2039: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella sediminis HAW-EB3 Gene: Ssed_4291: cytochrome c-type biogenesis protein CcmE, heme chaperone	Shewanella woodyi ATCC 51908 Gene: Swoo_4663: cytochrome c-type biogenesis protein CcmE, heme chaperone	cytochrome c-type biogenesis protein CcmE, heme chaperone

CRON 63.
rarD	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4 Gene: Shew_3322: RarD protein	* Shewanella pealeana ATCC 700345 Site: position = -85 score = 3.9001 sequence = CAAGGTGATTCAAGTCACACTC Gene: Spea_1861: RarD protein	* Shewanella halifaxensis HAW-EB4 Site: position = -85 score = 4.2445 sequence = CAGAGTGATTCAAGTCACACTT Gene: Shal_2568: RarD protein	Shewanella piezotolerans WP3	* Shewanella sediminis HAW-EB3 Site: position = -88 score = 4.77918 sequence = TAGAGTGATCCAGCTCACATAC Gene: Ssed_0706: RarD protein	* Shewanella woodyi ATCC 51908 Site: position = -44 score = 4.50668 sequence = CATAGTGATCAATATCACATTC Gene: Swoo_4258: RarD protein	RarD protein

CRON 64.
nqrA-2	* Shewanella oneidensis MR-1 Site: position = -129 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: SO1103: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella putrefaciens CN-32 Site: position = -129 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Sputcn32_0940: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella sp W3-18-1 Site: position = -129 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Sputw3181_3236: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella sp ANA-3 Site: position = -129 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Shewana3_0938: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella sp MR-4 Site: position = -129 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Shewmr4_0936: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella sp MR-7 Site: position = -129 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Shewmr7_0974: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella baltica OS155 Site: position = -128 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Sbal_0924: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella denitrificans OS217 Site: position = -128 score = 4.31963 sequence = CAGCGTGATTGCGATCGCATTA Gene: Sden_0982: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella frigidimarina NCIMB 400 Site: position = -127 score = 4.27497 sequence = CAGCGTGATTATGATCGCATTT Gene: Sfri_0949: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella amazonensis SB2B Site: position = -127 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Sama_2539: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella loihica PV-4 Site: position = -131 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Site: position = -73 score = 4.13073 sequence = ATGTTTGAAATCTATCTCATTT Gene: Shew_2881: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella pealeana ATCC 700345 Site: position = -133 score = 4.42614 sequence = CAGCGTGATTCTGATCGCATTT Gene: Spea_3103: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella halifaxensis HAW-EB4 Site: position = -127 score = 3.73326 sequence = CAGCGTGATTACAGTCGCACTT Gene: Shal_3187: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella piezotolerans WP3 Site: position = -132 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: swp_1167: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella sediminis HAW-EB3 Site: position = -130 score = 4.13099 sequence = CAGCGTGATTGCGGTCGCATTT Gene: Ssed_3431: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	* Shewanella woodyi ATCC 51908 Site: position = -46 score = 4.04855 sequence = CAGCGTGATTGCGGTCGCAAAT Gene: Swoo_3617: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)	Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
nqrB-2	Shewanella oneidensis MR-1 Gene: SO1104: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0941: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella sp W3-18-1 Gene: Sputw3181_3235: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella sp ANA-3 Gene: Shewana3_0939: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella sp MR-4 Gene: Shewmr4_0937: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella sp MR-7 Gene: Shewmr7_0975: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella baltica OS155 Gene: Sbal_0925: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella denitrificans OS217 Gene: Sden_0983: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0950: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella amazonensis SB2B Gene: Sama_2538: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella loihica PV-4 Gene: Shew_2880: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella pealeana ATCC 700345 Gene: Spea_3102: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3186: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella piezotolerans WP3 Gene: swp_1168: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella sediminis HAW-EB3 Gene: Ssed_3430: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Shewanella woodyi ATCC 51908 Gene: Swoo_3616: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)	Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
nqrC-2	Shewanella oneidensis MR-1 Gene: SO1105: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0942: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella sp W3-18-1 Gene: Sputw3181_3234: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella sp ANA-3 Gene: Shewana3_0940: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella sp MR-4 Gene: Shewmr4_0938: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella sp MR-7 Gene: Shewmr7_0976: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella baltica OS155 Gene: Sbal_0926: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella denitrificans OS217 Gene: Sden_0984: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0951: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella amazonensis SB2B Gene: Sama_2537: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella loihica PV-4 Gene: Shew_2879: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella pealeana ATCC 700345 Gene: Spea_3101: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3185: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella piezotolerans WP3 Gene: swp_1169: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella sediminis HAW-EB3 Gene: Ssed_3429: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Shewanella woodyi ATCC 51908 Gene: Swoo_3615: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)	Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
nqrD-1	Shewanella oneidensis MR-1 Gene: SO1106: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0943: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella sp W3-18-1 Gene: Sputw3181_3233: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella sp ANA-3 Gene: Shewana3_0941: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella sp MR-4 Gene: Shewmr4_0939: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella sp MR-7 Gene: Shewmr7_0977: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella baltica OS155 Gene: Sbal_0927: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella denitrificans OS217 Gene: Sden_0985: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0952: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella amazonensis SB2B Gene: Sama_2536: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella loihica PV-4 Gene: Shew_2878: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella pealeana ATCC 700345 Gene: Spea_3100: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3184: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella piezotolerans WP3 Gene: swp_1170: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella sediminis HAW-EB3 Gene: Ssed_3428: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Shewanella woodyi ATCC 51908 Gene: Swoo_3614: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)	Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
nqrE-2	Shewanella oneidensis MR-1 Gene: SO1107: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0944: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella sp W3-18-1 Gene: Sputw3181_3232: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella sp ANA-3 Gene: Shewana3_0942: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella sp MR-4 Gene: Shewmr4_0940: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella sp MR-7 Gene: Shewmr7_0978: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella baltica OS155 Gene: Sbal_0928: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella denitrificans OS217 Gene: Sden_0986: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0953: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella amazonensis SB2B Gene: Sama_2535: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella loihica PV-4 Gene: Shew_2877: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella pealeana ATCC 700345 Gene: Spea_3099: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3183: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella piezotolerans WP3 Gene: swp_1171: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella sediminis HAW-EB3 Gene: Ssed_3427: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Shewanella woodyi ATCC 51908 Gene: Swoo_3613: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)	Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
nqrF-2	Shewanella oneidensis MR-1 Gene: SO1108: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella putrefaciens CN-32 Gene: Sputcn32_0945: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella sp W3-18-1 Gene: Sputw3181_3231: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella sp ANA-3 Gene: Shewana3_0943: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella sp MR-4 Gene: Shewmr4_0941: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella sp MR-7 Gene: Shewmr7_0979: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella baltica OS155 Gene: Sbal_0929: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella denitrificans OS217 Gene: Sden_0987: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0954: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella amazonensis SB2B Gene: Sama_2534: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella loihica PV-4 Gene: Shew_2876: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella pealeana ATCC 700345 Gene: Spea_3098: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3182: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella piezotolerans WP3 Gene: swp_1172: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella sediminis HAW-EB3 Gene: Ssed_3426: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Shewanella woodyi ATCC 51908 Gene: Swoo_3612: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)	Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)

CRON 65.
hemC	* Shewanella oneidensis MR-1 Site: position = -132 score = 4.52477 sequence = AAATGAGAGGTCCATCACACTT Site: position = -172 score = 3.8681 sequence = GATTGTGCTCATGTTAACACTT Gene: SO4313: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella putrefaciens CN-32 Site: position = -173 score = 4.13546 sequence = AAGTGTGCTTATGTTAACACTT Site: position = -133 score = 5.19295 sequence = AAATGAGATCTGCATCACATTT Gene: Sputcn32_3587: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella sp W3-18-1 Site: position = -173 score = 4.13546 sequence = AAGTGTGCTTATGTTAACACTT Site: position = -133 score = 5.19295 sequence = AAATGAGATCTGCATCACATTT Gene: Sputw3181_3726: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella sp ANA-3 Site: position = -172 score = 4.23847 sequence = AAGTGTGCTCATGTTAACACTT Site: position = -132 score = 4.26867 sequence = AAATGAGAAGTTCGTCACACTT Gene: Shewana3_0386: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella sp MR-4 Site: position = -132 score = 4.26867 sequence = AAATGAGAAGTTCGTCACACTT Site: position = -172 score = 4.23847 sequence = AAGTGTGCTCATGTTAACACTT Gene: Shewmr4_0388: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella sp MR-7 Site: position = -132 score = 4.26867 sequence = AAATGAGAAGTTCGTCACACTT Site: position = -172 score = 4.23847 sequence = AAGTGTGCTCATGTTAACACTT Gene: Shewmr7_3638: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella baltica OS155 Site: position = -132 score = 4.91933 sequence = AAATGTGAAGTCCGTCACACTT Gene: Sbal_4000: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella denitrificans OS217 Site: position = -85 score = 3.90673 sequence = AAATCTGCTTTGCTTCAAACAT Gene: Sden_0388: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella frigidimarina NCIMB 400 Site: position = -167 score = 3.96383 sequence = AATGGTGATCATCGTAGCATTT Gene: Sfri_0440: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella amazonensis SB2B Site: position = -89 score = 5.14021 sequence = ATTTGCGATAGAGATCACATTT Gene: Sama_3254: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella loihica PV-4 Site: position = -119 score = 4.7007 sequence = ATTTGAGAGCTGGATCACACTT Gene: Shew_0318: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella pealeana ATCC 700345 Site: position = -133 score = 4.98423 sequence = AAATGCGATCAAGATCACACTT Gene: Spea_0373: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella halifaxensis HAW-EB4 Site: position = -133 score = 5.10167 sequence = AAATGTGATCAACATCACGCTT Gene: Shal_3917: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella piezotolerans WP3 Site: position = -40 score = 4.29959 sequence = AAATGTAATCCGTATCGCAACA Gene: swp_0402: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella sediminis HAW-EB3 Site: position = -133 score = 4.87801 sequence = AAATGAGATCAAGATCACACTT Gene: Ssed_4133: Porphobilinogen deaminase (EC 2.5.1.61)	* Shewanella woodyi ATCC 51908 Site: position = -229 score = 4.62137 sequence = AAATGAGACCAAGATCACACTT Gene: Swoo_0483: Porphobilinogen deaminase (EC 2.5.1.61)	Porphobilinogen deaminase (EC 2.5.1.61)
hemD	Shewanella oneidensis MR-1 Gene: SO4314: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella putrefaciens CN-32 Gene: Sputcn32_3588: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella sp W3-18-1 Gene: Sputw3181_3727: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella sp ANA-3 Gene: Shewana3_0385: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella sp MR-4 Gene: Shewmr4_0387: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella sp MR-7 Gene: Shewmr7_3639: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella baltica OS155 Gene: Sbal_4001: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella denitrificans OS217 Gene: Sden_0387: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0439: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella amazonensis SB2B Gene: Sama_3255: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella loihica PV-4 Gene: Shew_0317: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella pealeana ATCC 700345 Gene: Spea_0372: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3918: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella piezotolerans WP3 Gene: swp_0400: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella sediminis HAW-EB3 Gene: Ssed_4134: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Shewanella woodyi ATCC 51908 Gene: Swoo_0482: Uroporphyrinogen-III synthase (EC 4.2.1.75)	Uroporphyrinogen-III synthase (EC 4.2.1.75)
hemX	Shewanella oneidensis MR-1 Gene: SO4315: Homolog of E. coli HemX protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_3589: Homolog of E. coli HemX protein	Shewanella sp W3-18-1 Gene: Sputw3181_3728: Homolog of E. coli HemX protein	Shewanella sp ANA-3 Gene: Shewana3_0384: Homolog of E. coli HemX protein	Shewanella sp MR-4 Gene: Shewmr4_0386: Homolog of E. coli HemX protein	Shewanella sp MR-7 Gene: Shewmr7_3640: Homolog of E. coli HemX protein	Shewanella baltica OS155 Gene: Sbal_4002: Homolog of E. coli HemX protein	Shewanella denitrificans OS217 Gene: Sden_0386: Homolog of E. coli HemX protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0438: Homolog of E. coli HemX protein	Shewanella amazonensis SB2B Gene: Sama_3256: Homolog of E. coli HemX protein	Shewanella loihica PV-4 Gene: Shew_0316: Homolog of E. coli HemX protein	Shewanella pealeana ATCC 700345 Gene: Spea_0371: Homolog of E. coli HemX protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_3919: Homolog of E. coli HemX protein	Shewanella piezotolerans WP3 Gene: swp_0399: Homolog of E. coli HemX protein	Shewanella sediminis HAW-EB3 Gene: Ssed_4135: Homolog of E. coli HemX protein	Shewanella woodyi ATCC 51908 Gene: Swoo_0481: Homolog of E. coli HemX protein	Homolog of E. coli HemX protein
hemY	Shewanella oneidensis MR-1 Gene: SO4316: HemY domain-containing protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_3590: HemY domain-containing protein	Shewanella sp W3-18-1 Gene: Sputw3181_3729: HemY domain-containing protein	Shewanella sp ANA-3 Gene: Shewana3_0383: HemY domain-containing protein	Shewanella sp MR-4 Gene: Shewmr4_0385: HemY domain-containing protein	Shewanella sp MR-7 Gene: Shewmr7_3641: HemY domain-containing protein	Shewanella baltica OS155 Gene: Sbal_4003: HemY domain-containing protein	Shewanella denitrificans OS217 Gene: Sden_0385: HemY domain-containing protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0437: HemY domain-containing protein	Shewanella amazonensis SB2B Gene: Sama_3257: HemY domain-containing protein	Shewanella loihica PV-4 Gene: Shew_0315: HemY domain-containing protein	Shewanella pealeana ATCC 700345 Gene: Spea_0370: HemY domain-containing protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_3920: HemY domain-containing protein	Shewanella piezotolerans WP3 Gene: swp_0398: HemY domain-containing protein	Shewanella sediminis HAW-EB3 Gene: Ssed_4136: HemY domain-containi

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Crp - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --