Regulog Crp - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | repressor (activator) |
| Biological process: | Carbon catabolism |
| Effector: | Cyclic 3',5'-AMP |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - CRP
- By effector - Cyclic 3',5'-AMP
- By pathway - Carbon catabolism
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 286 | 150 |
| Shewanella putrefaciens CN-32 | 317 | 165 |
| Shewanella sp W3-18-1 | 316 | 164 |
| Shewanella sp ANA-3 | 335 | 178 |
| Shewanella sp MR-4 | 346 | 181 |
| Shewanella sp MR-7 | 345 | 179 |
| Shewanella baltica OS155 | 291 | 153 |
| Shewanella denitrificans OS217 | 111 | 55 |
| Shewanella frigidimarina NCIMB 400 | 233 | 120 |
| Shewanella amazonensis SB2B | 234 | 106 |
| Shewanella loihica PV-4 | 235 | 126 |
| Shewanella pealeana ATCC 700345 | 294 | 148 |
| Shewanella halifaxensis HAW-EB4 | 310 | 162 |
| Shewanella piezotolerans WP3 | 262 | 136 |
| Shewanella sediminis HAW-EB3 | 281 | 144 |
| Shewanella woodyi ATCC 51908 | 241 | 130 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| SO1419 |
*
Shewanella oneidensis MR-1 Site: position = -117 score = 3.9475 sequence = AAGTGTTAGCTAACTCATAGAT Gene: SO1419: lipoprotein, putative |
|
|
|
|
|
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -120 score = 4.46207 sequence = TTTTGTTAAGCAGATCAAAATA Gene: Shew_1972: lipoprotein, putative |
*
Shewanella pealeana ATCC 700345 Site: position = -120 score = 4.15776 sequence = TAGTGTTAACTGTGTCAAATAA Gene: Spea_2091: lipoprotein, putative |
*
Shewanella halifaxensis HAW-EB4 Site: position = -93 score = 4.09607 sequence = TTGTGTTAACTGCGTCAAATAA Gene: Shal_2064: lipoprotein, putative |
*
Shewanella piezotolerans WP3 Site: position = -119 score = 4.47596 sequence = AAATGTTATCTCTGTCAAACAA Gene: swp_2516: lipoprotein, putative |
*
Shewanella sediminis HAW-EB3 Site: position = -159 score = 4.20258 sequence = ATGTGTTAACTGGGTCAAATAT Gene: Ssed_2279: lipoprotein, putative |
|
lipoprotein, putative |
| SO1420 |
Gene: SO1420: outer membrane porin, putative |
|
|
|
|
|
|
|
|
Gene: Sama_2403: outer membrane porin, putative |
Gene: Shew_1973: outer membrane porin, putative |
Gene: Spea_2092: outer membrane porin, putative |
Gene: Shal_2065: outer membrane porin, putative |
Gene: swp_2517: outer membrane porin, putative |
Gene: Ssed_2278: outer membrane porin, putative |
|
outer membrane porin, putative |
| CRON 2. | |||||||||||||||||
| SO1247 |
Gene: SO1247: hypothetical protein |
Gene: Sputcn32_2807: hypothetical protein |
Gene: Sputw3181_1205: hypothetical protein |
Gene: Shewana3_1063: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -273 score = 4.28857 sequence = CAATGTGAGCTAGTTAACATCA Gene: Shewmr4_1059: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -273 score = 4.28857 sequence = CAATGTGAGCTAGTTAACATCA Gene: Shewmr7_1131: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -159 score = 3.83994 sequence = AATAGTGATCTTTCTCAGCATC Gene: Sbal_3204: hypothetical protein |
|
|
*
Shewanella amazonensis SB2B Site: position = -108 score = 3.79832 sequence = TCATGTGAGCCAGGTTAAAAAA Gene: Sama_0996: hypothetical protein |
Gene: Shew_2789: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -187 score = 4.05502 sequence = TTTAGTGATGTTTTTTAGATTA Gene: Spea_3022: hypothetical protein |
Gene: Shal_3112: hypothetical protein |
Gene: swp_1258: hypothetical protein |
Gene: Ssed_3352: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -312 score = 4.78872 sequence = TTTTGTGAATTGTATCACTTAT Gene: Swoo_3518: hypothetical protein |
hypothetical protein |
| CRON 3. | |||||||||||||||||
| fadD1 |
*
Shewanella oneidensis MR-1 Site: position = -155 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: SO2581: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella putrefaciens CN-32 Site: position = -154 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: Sputcn32_1761: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella sp W3-18-1 Site: position = -154 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: Sputw3181_2264: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella sp ANA-3 Site: position = -155 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: Shewana3_2386: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella sp MR-4 Site: position = -155 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: Shewmr4_2177: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella sp MR-7 Site: position = -155 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: Shewmr7_2254: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella baltica OS155 Site: position = -156 score = 5.12551 sequence = TTATGTGATGATGATCAAAATT Gene: Sbal_1864: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella denitrificans OS217 Site: position = -189 score = 4.12923 sequence = TTATGTGATTATGGGCCCAAAT Gene: Sden_1625: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -165 score = 4.70241 sequence = TTATGTGATTATGATCGAAAAT Gene: Sfri_1733: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella amazonensis SB2B Site: position = -140 score = 4.83629 sequence = TTATGTGATGATTGTCAAAAAT Gene: Sama_1934: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella loihica PV-4 Site: position = -149 score = 4.86581 sequence = TTGTGTGATGATGTTCAAAATT Gene: Shew_2188: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella pealeana ATCC 700345 Site: position = -156 score = 5.01352 sequence = TTATGTGATGATAATCAAAATT Gene: Spea_2448: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -155 score = 5.01352 sequence = TTATGTGATGATAATCAAAATT Gene: Shal_1832: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella piezotolerans WP3 Site: position = -153 score = 5.00694 sequence = ATATGTGATGATAATCAAAATT Gene: swp_2289: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella sediminis HAW-EB3 Site: position = -151 score = 5.02801 sequence = TTATGTGATGATGATCATAATT Gene: Ssed_2523: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella woodyi ATCC 51908 Site: position = -153 score = 5.07027 sequence = TTATGTGATGATGTTCAAAATT Gene: Swoo_2110: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
| CRON 4. | |||||||||||||||||
| SO0971 |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -161 score = 4.28008 sequence = TATCGATATCTGCCTCACATAT Gene: Spea_0741: hypothetical protein |
|
|
|
|
hypothetical protein |
| SO0972 |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_0740: methyltransferase type 12 |
|
|
|
|
SAM-dependent methyltransferases |
| SO0973 |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_0739: hypothetical protein |
|
|
|
|
hypothetical protein |
| Sputcn32_0834 |
|
Gene: Sputcn32_0834: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
Gene: Sputw3181_3339: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
*
Shewanella sp ANA-3 Site: position = -156 score = 4.19724 sequence = AAAGGTGACGAGTATAACAAAA Gene: Shewana3_0799: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
*
Shewanella sp MR-4 Site: position = -156 score = 4.19724 sequence = AAAGGTGACGAGTATAACAAAA Gene: Shewmr4_3139: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
*
Shewanella sp MR-7 Site: position = -156 score = 4.19724 sequence = AAAGGTGACGAGTATAACAAAA Gene: Shewmr7_0827: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
Gene: Sbal_0733: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
*
Shewanella denitrificans OS217 Site: position = -175 score = 4.00133 sequence = TAATGTGATTGGTATAAGAACA Gene: Sden_3048: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
Gene: Sfri_0515: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
Gene: Sama_0606: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
Gene: Shew_0783: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
Gene: Spea_0738: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
Gene: Shal_0791: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
*
Shewanella piezotolerans WP3 Site: position = -322 score = 3.85784 sequence = TAATGCAATTGGTATTACAATA Gene: swp_4339: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
Gene: Ssed_0821: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
*
Shewanella woodyi ATCC 51908 Site: position = -67 score = 3.73566 sequence = TATTTTTACTTGCCTCAACTAA Gene: Swoo_0917: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) |
| asnC |
Gene: SO3799: regulatory protein AsnC |
Gene: Sputcn32_0833: regulatory protein AsnC |
Gene: Sputw3181_3340: regulatory protein AsnC |
Gene: Shewana3_0798: regulatory protein AsnC |
Gene: Shewmr4_3140: regulatory protein AsnC |
Gene: Shewmr7_0826: regulatory protein AsnC |
Gene: Sbal_0732: regulatory protein AsnC |
Gene: Sden_3049: regulatory protein AsnC |
Gene: Sfri_0514: regulatory protein AsnC |
Gene: Sama_0605: regulatory protein AsnC |
Gene: Shew_0782: regulatory protein AsnC |
*
Shewanella pealeana ATCC 700345 Site: position = -7 score = 3.76387 sequence = ATTTATTATGGAAGTCCCATTT Gene: Spea_0737: regulatory protein AsnC |
*
Shewanella halifaxensis HAW-EB4 Site: position = -248 score = 3.81488 sequence = ATTTATAATGATAATCACAACT Gene: Shal_0790: regulatory protein AsnC |
Gene: swp_4340: regulatory protein AsnC |
Gene: Ssed_0820: regulatory protein AsnC |
Gene: Swoo_0916: regulatory protein AsnC |
regulatory protein AsnC |
| CRON 5. | |||||||||||||||||
| Sputcn32_0312 |
|
*
Shewanella putrefaciens CN-32 Site: position = -99 score = 4.31656 sequence = AAGTGTGATGCTGGTCAATAAA Gene: Sputcn32_0312: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -99 score = 4.24289 sequence = AAGTGTGATACTGGTCAATAAA Gene: Sputw3181_3896: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -99 score = 5.23204 sequence = AAATGTGATCTATGTCAAAAAA Gene: Shewana3_3963: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -99 score = 5.23204 sequence = AAATGTGATCTATGTCAAAAAA Gene: Shewmr4_3765: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -99 score = 5.19373 sequence = AAATGTGATCTGTGTCAAAAAA Gene: Shewmr7_3838: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -97 score = 5.20192 sequence = AAATGTGATCGTGTTCAAAAAA Gene: Sbal_0180: hypothetical protein |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -115 score = 3.65375 sequence = TTAATTGATTACGATCAATTTA Gene: Sfri_0616: hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -285 score = 4.06654 sequence = AAAAGAGACTTAGATCATATTT Gene: Sama_2901: hypothetical protein |
*
Shewanella loihica PV-4 Site: position = -286 score = 3.87265 sequence = AAAATAGATCTTGATCATATTT Gene: Shew_3155: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -127 score = 3.40276 sequence = TTTTATGATGAATAAAACGTTC Gene: Spea_3968: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -100 score = 3.62988 sequence = ATAATTGATTTGTATCAATGTT Gene: Shal_0300: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -97 score = 3.34695 sequence = TTATATAATGATTTTTATATTT Gene: swp_4118: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -100 score = 4.06844 sequence = TTGTTTGATTTAAATCAAGGTT Gene: Ssed_0240: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -92 score = 3.98241 sequence = TAACTTGATTTGAATCAATATT Gene: Swoo_0239: hypothetical protein |
hypothetical protein |
| nrfB |
|
Gene: Sputcn32_0313: Cytochrome c-type protein NrfB precursor |
Gene: Sputw3181_3895: Cytochrome c-type protein NrfB precursor |
Gene: Shewana3_3962: Cytochrome c-type protein NrfB precursor |
Gene: Shewmr4_3764: Cytochrome c-type protein NrfB precursor |
Gene: Shewmr7_3837: Cytochrome c-type protein NrfB precursor |
Gene: Sbal_0181: Cytochrome c-type protein NrfB precursor |
|
Gene: Sfri_0615: Cytochrome c-type protein NrfB precursor |
Gene: Sama_2902: Cytochrome c-type protein NrfB precursor |
Gene: Shew_3156: Cytochrome c-type protein NrfB precursor |
Gene: Spea_3967: Cytochrome c-type protein NrfB precursor |
Gene: Shal_0301: Cytochrome c-type protein NrfB precursor |
Gene: swp_4117: Cytochrome c-type protein NrfB precursor |
Gene: Ssed_0241: Cytochrome c-type protein NrfB precursor |
Gene: Swoo_0240: Cytochrome c-type protein NrfB precursor |
Cytochrome c-type protein NrfB precursor |
| nrfC |
|
Gene: Sputcn32_0314: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
Gene: Sputw3181_3894: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
Gene: Shewana3_3961: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
Gene: Shewmr4_3763: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
Gene: Shewmr7_3836: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
Gene: Sbal_0182: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
|
Gene: Sfri_0614: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
Gene: Sama_2903: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
Gene: Shew_3157: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
Gene: Spea_3966: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
Gene: Shal_0302: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
Gene: swp_4116: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
Gene: Ssed_0242: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
Gene: Swoo_0241: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
4Fe-4S ferredoxin iron-sulfur binding domain-containing protein |
| nrfD-2 |
Gene: SO4568: nitrite reductase, quinol dehydrogenase component, NrfD |
Gene: Sputcn32_0315: nitrite reductase, quinol dehydrogenase component, NrfD |
Gene: Sputw3181_3893: nitrite reductase, quinol dehydrogenase component, NrfD |
Gene: Shewana3_3960: nitrite reductase, quinol dehydrogenase component, NrfD |
Gene: Shewmr4_3762: nitrite reductase, quinol dehydrogenase component, NrfD |
Gene: Shewmr7_3835: nitrite reductase, quinol dehydrogenase component, NrfD |
Gene: Sbal_0183: nitrite reductase, quinol dehydrogenase component, NrfD |
|
Gene: Sfri_0613: nitrite reductase, quinol dehydrogenase component, NrfD |
Gene: Sama_2904: nitrite reductase, quinol dehydrogenase component, NrfD |
Gene: Shew_3158: nitrite reductase, quinol dehydrogenase component, NrfD |
Gene: Spea_3965: nitrite reductase, quinol dehydrogenase component, NrfD |
Gene: Shal_0303: nitrite reductase, quinol dehydrogenase component, NrfD |
Gene: swp_4115: nitrite reductase, quinol dehydrogenase component, NrfD |
Gene: Ssed_0243: nitrite reductase, quinol dehydrogenase component, NrfD |
Gene: Swoo_0242: nitrite reductase, quinol dehydrogenase component, NrfD |
nitrite reductase, quinol dehydrogenase component, NrfD |
| SO4570 |
*
Shewanella oneidensis MR-1 Site: position = -207 score = 4.40356 sequence = ATTTGTGAGCTAGTTAGAATTA Gene: SO4570: conserved domain protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
conserved domain protein |
| CRON 6. | |||||||||||||||||
| hyaA |
*
Shewanella oneidensis MR-1 Site: position = -105 score = 3.97644 sequence = ATTCTTGATATGCATCAATAAT Gene: SO2099: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
*
Shewanella putrefaciens CN-32 Site: position = -167 score = 3.70145 sequence = AAATTAGATCTGCGTCATGTTA Site: position = -107 score = 4.01474 sequence = ATTCTTGATATACATCAATAAT Gene: Sputcn32_2088: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
*
Shewanella sp W3-18-1 Site: position = -167 score = 3.70145 sequence = AAATTAGATCTGCGTCATGTTA Site: position = -107 score = 4.01474 sequence = ATTCTTGATATACATCAATAAT Gene: Sputw3181_1924: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
*
Shewanella sp ANA-3 Site: position = -166 score = 3.91857 sequence = AAATTAGATCTGCATCATGTTA Site: position = -106 score = 4.17166 sequence = ATTCTTGATATGCATCAAGAAT Gene: Shewana3_1880: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
*
Shewanella sp MR-4 Site: position = -166 score = 3.91857 sequence = AAATTAGATCTGCATCATGTTA Site: position = -106 score = 4.17166 sequence = ATTCTTGATATGCATCAAGAAT Gene: Shewmr4_1822: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
*
Shewanella sp MR-7 Site: position = -166 score = 3.91857 sequence = AAATTAGATCTGCATCATGTTA Site: position = -106 score = 4.17166 sequence = ATTCTTGATATGCATCAAGAAT Gene: Shewmr7_2155: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
*
Shewanella baltica OS155 Site: position = -107 score = 4.20997 sequence = ATTCTTGATATACATCAAGAAT Site: position = -229 score = 3.92975 sequence = TTAAGTGACCGATTTCATCCAA Site: position = -167 score = 3.73976 sequence = AAATTAGATCTACGTCATGTTA Gene: Sbal_1889: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -174 score = 3.76852 sequence = TTTTGTTAACTTGATCAACATC Site: position = -168 score = 4.36595 sequence = TAACTTGATCAACATCATAAAT Gene: Sfri_2103: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
*
Shewanella amazonensis SB2B Site: position = -172 score = 3.44118 sequence = AAGCATGACACACCTCATGTTA Gene: Sama_1679: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
*
Shewanella loihica PV-4 Site: position = -164 score = 3.80383 sequence = AAACTTGATCCAGCTCATAGCT Site: position = -103 score = 3.70832 sequence = AATGTTGACATACATCAACATT Gene: Shew_1765: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
*
Shewanella pealeana ATCC 700345 Site: position = -211 score = 4.63119 sequence = TTACGTGACCACGATCACCTTT Gene: Spea_2033: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -212 score = 5.04352 sequence = TTACGTGATCTCCATCACCTTT Gene: Shal_2261: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
Gene: swp_2639: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
*
Shewanella sediminis HAW-EB3 Site: position = -162 score = 3.97894 sequence = AAAGATGATCTAGTTCATATTG Gene: Ssed_1908: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
|
Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) |
| hyaB |
Gene: SO2098: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
Gene: Sputcn32_2089: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
Gene: Sputw3181_1923: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
Gene: Shewana3_1879: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
Gene: Shewmr4_1821: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
Gene: Shewmr7_2156: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
Gene: Sbal_1888: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
|
Gene: Sfri_2104: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
Gene: Sama_1678: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
Gene: Shew_1764: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
Gene: Spea_2032: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
Gene: Shal_2262: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
Gene: swp_2640: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
Gene: Ssed_1907: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
|
Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) |
| hydC |
Gene: SO2097: Ni,Fe-hydrogenase I cytochrome b subunit |
Gene: Sputcn32_2090: Ni,Fe-hydrogenase I cytochrome b subunit |
Gene: Sputw3181_1922: Ni,Fe-hydrogenase I cytochrome b subunit |
Gene: Shewana3_1878: Ni,Fe-hydrogenase I cytochrome b subunit |
Gene: Shewmr4_1820: Ni,Fe-hydrogenase I cytochrome b subunit |
Gene: Shewmr7_2157: Ni,Fe-hydrogenase I cytochrome b subunit |
Gene: Sbal_1887: Ni,Fe-hydrogenase I cytochrome b subunit |
|
Gene: Sfri_2105: Ni,Fe-hydrogenase I cytochrome b subunit |
Gene: Sama_1677: Ni,Fe-hydrogenase I cytochrome b subunit |
Gene: Shew_1763: Ni,Fe-hydrogenase I cytochrome b subunit |
Gene: Spea_2031: Ni,Fe-hydrogenase I cytochrome b subunit |
Gene: Shal_2263: Ni,Fe-hydrogenase I cytochrome b subunit |
Gene: swp_2641: Ni,Fe-hydrogenase I cytochrome b subunit |
Gene: Ssed_1906: Ni,Fe-hydrogenase I cytochrome b subunit |
|
Ni,Fe-hydrogenase I cytochrome b subunit |
| hyaD |
Gene: SO2096: Hydrogenase maturation protease (EC 3.4.24.-) |
Gene: Sputcn32_2091: Hydrogenase maturation protease (EC 3.4.24.-) |
Gene: Sputw3181_1921: Hydrogenase maturation protease (EC 3.4.24.-) |
Gene: Shewana3_1877: Hydrogenase maturation protease (EC 3.4.24.-) |
Gene: Shewmr4_1819: Hydrogenase maturation protease (EC 3.4.24.-) |
Gene: Shewmr7_2158: Hydrogenase maturation protease (EC 3.4.24.-) |
Gene: Sbal_1886: Hydrogenase maturation protease (EC 3.4.24.-) |
|
Gene: Sfri_2106: Hydrogenase maturation protease (EC 3.4.24.-) |
Gene: Sama_1676: Hydrogenase maturation protease (EC 3.4.24.-) |
Gene: Shew_1762: Hydrogenase maturation protease (EC 3.4.24.-) |
Gene: Spea_2030: Hydrogenase maturation protease (EC 3.4.24.-) |
Gene: Shal_2264: Hydrogenase maturation protease (EC 3.4.24.-) |
Gene: swp_2642: Hydrogenase maturation protease (EC 3.4.24.-) |
Gene: Ssed_1905: Hydrogenase maturation protease (EC 3.4.24.-) |
|
Hydrogenase maturation protease (EC 3.4.24.-) |
| hyaE |
Gene: SO2095: NiFe hydrogenase assembly chaperone, HyaE |
Gene: Sputcn32_2092: NiFe hydrogenase assembly chaperone, HyaE |
Gene: Sputw3181_1920: NiFe hydrogenase assembly chaperone, HyaE |
Gene: Shewana3_1876: NiFe hydrogenase assembly chaperone, HyaE |
Gene: Shewmr4_1818: NiFe hydrogenase assembly chaperone, HyaE |
Gene: Shewmr7_2159: NiFe hydrogenase assembly chaperone, HyaE |
Gene: Sbal_1885: NiFe hydrogenase assembly chaperone, HyaE |
|
Gene: Sfri_2107: NiFe hydrogenase assembly chaperone, HyaE |
Gene: Sama_1675: NiFe hydrogenase assembly chaperone, HyaE |
Gene: Shew_1761: NiFe hydrogenase assembly chaperone, HyaE |
Gene: Spea_2029: NiFe hydrogenase assembly chaperone, HyaE |
Gene: Shal_2265: NiFe hydrogenase assembly chaperone, HyaE |
Gene: swp_2643: NiFe hydrogenase assembly chaperone, HyaE |
Gene: Ssed_1904: NiFe hydrogenase assembly chaperone, HyaE |
|
NiFe hydrogenase assembly chaperone, HyaE |
| hyaF |
Gene: SO2094: NiFe hydrogenase assembly protein, HypF |
Gene: Sputcn32_2093: NiFe hydrogenase assembly protein, HypF |
Gene: Sputw3181_1919: NiFe hydrogenase assembly protein, HypF |
Gene: Shewana3_1875: NiFe hydrogenase assembly protein, HypF |
Gene: Shewmr4_1817: NiFe hydrogenase assembly protein, HypF |
Gene: Shewmr7_2160: NiFe hydrogenase assembly protein, HypF |
Gene: Sbal_1884: NiFe hydrogenase assembly protein, HypF |
|
Gene: Sfri_2108: NiFe hydrogenase assembly protein, HypF |
Gene: Sama_1674: NiFe hydrogenase assembly protein, HypF |
Gene: Shew_1760: NiFe hydrogenase assembly protein, HypF |
Gene: Spea_2028: NiFe hydrogenase assembly protein, HypF |
Gene: Shal_2266: NiFe hydrogenase assembly protein, HypF |
Gene: swp_2644: NiFe hydrogenase assembly protein, HypF |
Gene: Ssed_1903: NiFe hydrogenase assembly protein, HypF |
|
NiFe hydrogenase assembly protein, HypF |
| CRON 7. | |||||||||||||||||
| mtrC |
*
Shewanella oneidensis MR-1 Site: position = -190 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Site: position = -248 score = 3.6914 sequence = TGTTGTTTTTTTGCTCTCAATT Gene: SO1778: surface localized decaheme cytochrome c lipoprotein, MtrC |
*
Shewanella putrefaciens CN-32 Site: position = -190 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Gene: Sputcn32_1478: surface localized decaheme cytochrome c lipoprotein, MtrC |
*
Shewanella sp W3-18-1 Site: position = -190 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Gene: Sputw3181_2623: surface localized decaheme cytochrome c lipoprotein, MtrC |
*
Shewanella sp ANA-3 Site: position = -189 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Gene: Shewana3_2676: surface localized decaheme cytochrome c lipoprotein, MtrC |
*
Shewanella sp MR-4 Site: position = -189 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Gene: Shewmr4_2510: surface localized decaheme cytochrome c lipoprotein, MtrC |
*
Shewanella sp MR-7 Site: position = -189 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Gene: Shewmr7_2578: surface localized decaheme cytochrome c lipoprotein, MtrC |
*
Shewanella baltica OS155 Site: position = -190 score = 3.51764 sequence = TAGAAAGATCCAAGTCACACAT Gene: Sbal_1589: surface localized decaheme cytochrome c lipoprotein, MtrC |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -164 score = 3.7709 sequence = TAGGCTGATCATCATCACACAA Gene: Sfri_2637: surface localized decaheme cytochrome c lipoprotein, MtrC |
*
Shewanella amazonensis SB2B Site: position = -230 score = 3.85699 sequence = TTTTTTGATCTGAAACAGCTTT Site: position = -178 score = 3.63907 sequence = TAGCCGGATCCAGTTCACACAT Gene: Sama_1208: surface localized decaheme cytochrome c lipoprotein, MtrC |
*
Shewanella loihica PV-4 Site: position = -179 score = 3.59173 sequence = TAGAAAGATCTCGGTCACACAT Gene: Shew_2525: surface localized decaheme cytochrome c lipoprotein, MtrC |
Gene: Spea_2698: surface localized decaheme cytochrome c lipoprotein, MtrC |
*
Shewanella halifaxensis HAW-EB4 Site: position = -264 score = 4.00452 sequence = TTTTATTACATTTATCACGTAT Gene: Shal_2784: surface localized decaheme cytochrome c lipoprotein, MtrC |
Gene: swp_3278: surface localized decaheme cytochrome c lipoprotein, MtrC |
*
Shewanella sediminis HAW-EB3 Site: position = -191 score = 4.01918 sequence = TAGGCTGATCTAGGTCACACAT Gene: Ssed_1525: surface localized decaheme cytochrome c lipoprotein, MtrC |
*
Shewanella woodyi ATCC 51908 Site: position = -288 score = 3.71936 sequence = ATGAGTTACAACTTTCACACAT Gene: Swoo_3125: surface localized decaheme cytochrome c lipoprotein, MtrC |
surface localized decaheme cytochrome c lipoprotein, MtrC |
| mtrA |
Gene: SO1777: periplasmic decaheme cytochrome c, MtrA |
Gene: Sputcn32_1477: periplasmic decaheme cytochrome c, MtrA |
Gene: Sputw3181_2624: periplasmic decaheme cytochrome c, MtrA |
Gene: Shewana3_2677: periplasmic decaheme cytochrome c, MtrA |
Gene: Shewmr4_2511: periplasmic decaheme cytochrome c, MtrA |
Gene: Shewmr7_2579: periplasmic decaheme cytochrome c, MtrA |
Gene: Sbal_1588: periplasmic decaheme cytochrome c, MtrA |
|
Gene: Sfri_2638: periplasmic decaheme cytochrome c, MtrA |
Gene: Sama_1207: periplasmic decaheme cytochrome c, MtrA |
Gene: Shew_2526: periplasmic decaheme cytochrome c, MtrA |
Gene: Spea_2699: periplasmic decaheme cytochrome c, MtrA |
Gene: Shal_2785: periplasmic decaheme cytochrome c, MtrA |
Gene: swp_3279: periplasmic decaheme cytochrome c, MtrA |
Gene: Ssed_1524: periplasmic decaheme cytochrome c, MtrA |
Gene: Swoo_3126: periplasmic decaheme cytochrome c, MtrA |
periplasmic decaheme cytochrome c, MtrA |
| mtrB |
Gene: SO1776: outer membrane protein, MtrB |
Gene: Sputcn32_1476: outer membrane protein, MtrB |
Gene: Sputw3181_2625: outer membrane protein, MtrB |
Gene: Shewana3_2678: outer membrane protein, MtrB |
Gene: Shewmr4_2512: outer membrane protein, MtrB |
Gene: Shewmr7_2580: outer membrane protein, MtrB |
Gene: Sbal_1587: outer membrane protein, MtrB |
|
Gene: Sfri_2639: outer membrane protein, MtrB |
Gene: Sama_1206: outer membrane protein, MtrB |
Gene: Shew_2527: outer membrane protein, MtrB |
Gene: Spea_2700: outer membrane protein, MtrB |
Gene: Shal_2786: outer membrane protein, MtrB |
Gene: swp_3280: outer membrane protein, MtrB |
Gene: Ssed_1523: outer membrane protein, MtrB |
Gene: Swoo_3127: outer membrane protein, MtrB |
outer membrane protein, MtrB |
| CRON 8. | |||||||||||||||||
| SO0939 |
*
Shewanella oneidensis MR-1 Site: position = -382 score = 4.3436 sequence = TACTGTGATCCCGTTAACCCAA Site: position = -217 score = 4.55008 sequence = TATCGTGCCTTCGCTCACATTA Gene: SO0939: split-soret diheme cytochrome c |
*
Shewanella putrefaciens CN-32 Site: position = -388 score = 4.40149 sequence = TACTGTGATCTTGCTAACCCAA Gene: Sputcn32_0879: split-soret diheme cytochrome c |
*
Shewanella sp W3-18-1 Site: position = -388 score = 4.40149 sequence = TACTGTGATCTTGCTAACCCAA Site: position = -253 score = 3.48068 sequence = AAATGGATTTAAATTCACATAA Gene: Sputw3181_3294: split-soret diheme cytochrome c |
*
Shewanella sp ANA-3 Site: position = -217 score = 3.77595 sequence = TAATGTGCGCTGCCGCAAATTG Site: position = -384 score = 4.3436 sequence = TACTGTGATCCCGTTAACCCAA Gene: Shewana3_3344: split-soret diheme cytochrome c |
*
Shewanella sp MR-4 Site: position = -383 score = 4.3436 sequence = TACTGTGATCCCGTTAACCCAA Site: position = -217 score = 4.04131 sequence = TAATGTGCGTTGATGCACATTG Gene: Shewmr4_0782: split-soret diheme cytochrome c |
*
Shewanella sp MR-7 Site: position = -383 score = 4.3436 sequence = TACTGTGATCCCGTTAACCCAA Site: position = -217 score = 3.86944 sequence = TAATGTGCGCAGGCACACATTG Gene: Shewmr7_3241: split-soret diheme cytochrome c |
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -147 score = 4.43897 sequence = TTATCTGCTTTGAATCACATTT Site: position = -325 score = 4.52262 sequence = ATTTGTGAGCGATATCACGTCA Gene: Sfri_3633: split-soret diheme cytochrome c |
*
Shewanella amazonensis SB2B Site: position = -297 score = 3.9359 sequence = AATTGTGATATTGAACAATATG Gene: Sama_2750: split-soret diheme cytochrome c |
*
Shewanella loihica PV-4 Site: position = -246 score = 4.11479 sequence = TAGAGTGATCAGCTTCACATCG Gene: Shew_0759: split-soret diheme cytochrome c |
*
Shewanella pealeana ATCC 700345 Site: position = -327 score = 4.02021 sequence = AAATGAGACGTTAGTCACACTC Site: position = -249 score = 4.53098 sequence = TAATGTGACATCGTTCATGAAA Gene: Spea_3437: split-soret diheme cytochrome c |
*
Shewanella halifaxensis HAW-EB4 Site: position = -328 score = 4.17432 sequence = AAATGAGAGGTTAATCACACAG Site: position = -250 score = 4.69242 sequence = TAATGTGCTATCGGTCACAGAA Gene: Shal_3518: split-soret diheme cytochrome c |
|
*
Shewanella sediminis HAW-EB3 Site: position = -349 score = 4.10731 sequence = TTTTGCGAACAAAATCACACTG Gene: Ssed_0882: split-soret diheme cytochrome c |
*
Shewanella woodyi ATCC 51908 Site: position = -250 score = 4.48942 sequence = TAACATGATCCAGCTCACCATT Site: position = -337 score = 3.74538 sequence = GTTTGCGAAGAGGATCACATTG Gene: Swoo_0884: split-soret diheme cytochrome c |
split-soret diheme cytochrome c |
| SO0938 |
Gene: SO0938: hypothetical protein |
Gene: Sputcn32_0878: hypothetical protein |
Gene: Sputw3181_3295: hypothetical protein |
Gene: Shewana3_3345: hypothetical protein |
Gene: Shewmr4_0781: hypothetical protein |
Gene: Shewmr7_3242: hypothetical protein |
|
|
Gene: Sfri_3634: hypothetical protein |
Gene: Sama_2751: hypothetical protein |
Gene: Shew_0758: hypothetical protein |
Gene: Spea_3436: hypothetical protein |
Gene: Shal_3517: hypothetical protein |
|
Gene: Ssed_0881: hypothetical protein |
Gene: Swoo_0883: hypothetical protein |
hypothetical protein |
| CRON 9. | |||||||||||||||||
| SO3119 |
*
Shewanella oneidensis MR-1 Site: position = -166 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: SO3119: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -171 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: Sputcn32_2489: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -171 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: Sputw3181_1519: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -171 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: Shewana3_1429: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -171 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: Shewmr4_1376: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -171 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: Shewmr7_1441: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -171 score = 4.51106 sequence = AATAGTGATAAAGATCGCGTTT Gene: Sbal_2792: hypothetical protein |
|
|
*
Shewanella amazonensis SB2B Site: position = -151 score = 4.4095 sequence = AATAGTGATTAAGCTCGCGTTT Gene: Sama_2198: hypothetical protein |
|
*
Shewanella pealeana ATCC 700345 Site: position = -148 score = 4.0596 sequence = GAAAGTGATTTATATCGCGTTT Gene: Spea_1466: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -148 score = 4.0596 sequence = GAAAGTGATTTATATCGCGTTT Gene: Shal_1549: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -220 score = 3.76309 sequence = GAAAGTGACTTAAATCGCGTTT Gene: swp_1671: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -173 score = 4.73553 sequence = TAAAGTGATTTAGATCGCGTTT Gene: Ssed_2897: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -148 score = 4.42972 sequence = TTAAGTGACTTAGATCGCGTTT Gene: Swoo_1750: hypothetical protein |
hypothetical protein |
| CRON 10. | |||||||||||||||||
| mtrD |
*
Shewanella oneidensis MR-1 Site: position = -339 score = 3.80688 sequence = TTATGTGACAAAAATCTCTATG Gene: SO1782: periplasmic decaheme cytochrome c, MtrD |
|
|
*
Shewanella sp ANA-3 Site: position = -295 score = 4.35955 sequence = TTATGTGACAAAAATCTCAATG Site: position = -172 score = 4.26694 sequence = AAGTGAGAACAAGATCACACTT Gene: Shewana3_2672: periplasmic decaheme cytochrome c, MtrD |
*
Shewanella sp MR-4 Site: position = -295 score = 4.35955 sequence = TTATGTGACAAAAATCTCAATG Site: position = -172 score = 4.26694 sequence = AAGTGAGAACAAGATCACACTT Gene: Shewmr4_2506: periplasmic decaheme cytochrome c, MtrD |
*
Shewanella sp MR-7 Site: position = -295 score = 4.35955 sequence = TTATGTGACAAAAATCTCAATG Site: position = -172 score = 4.26694 sequence = AAGTGAGAACAAGATCACACTT Gene: Shewmr7_2574: periplasmic decaheme cytochrome c, MtrD |
*
Shewanella baltica OS155 Site: position = -304 score = 3.76559 sequence = TTATGTGACAAAAATACCAATG Site: position = -181 score = 4.77529 sequence = AAACGTGATCAACATCACGCTT Gene: Sbal_1593: periplasmic decaheme cytochrome c, MtrD |
|
|
*
Shewanella amazonensis SB2B Site: position = -189 score = 3.93967 sequence = CGGCGTGACACTCATCACACTT Gene: Sama_1213: periplasmic decaheme cytochrome c, MtrD |
*
Shewanella loihica PV-4 Site: position = -170 score = 5.28415 sequence = CAACGTGATCTAGATCACATAT Site: position = -260 score = 4.45471 sequence = TTATGTGACAGATATCTCAATC Gene: Shew_2519: periplasmic decaheme cytochrome c, MtrD |
*
Shewanella pealeana ATCC 700345 Site: position = -286 score = 4.12663 sequence = TTATGTGACAAAACTCTCAACT Site: position = -197 score = 5.43359 sequence = AAGTGTGATACGCATCACATAA Gene: Spea_2692: periplasmic decaheme cytochrome c, MtrD |
*
Shewanella halifaxensis HAW-EB4 Site: position = -305 score = 4.5247 sequence = TTATGTGATAAATATCTCAACT Site: position = -184 score = 4.56732 sequence = AAACTTGACACAGATCACACTT Gene: Shal_2778: periplasmic decaheme cytochrome c, MtrD |
*
Shewanella piezotolerans WP3 Site: position = -308 score = 4.16651 sequence = TTATGTGACAAATCTCTCAACT Site: position = -185 score = 4.56511 sequence = CAGTGTGACGTAGATCACGCTT Gene: swp_3272: periplasmic decaheme cytochrome c, MtrD |
*
Shewanella sediminis HAW-EB3 Site: position = -174 score = 4.76284 sequence = TAGCGTGACCAAGATCACACTT Site: position = -291 score = 4.01107 sequence = TTATGTGACAAAAGTCTCAACT Gene: Ssed_1530: periplasmic decaheme cytochrome c, MtrD |
|
periplasmic decaheme cytochrome c, MtrD |
| mtrE |
Gene: SO1781: outer membrane protein, MtrE |
|
|
Gene: Shewana3_2673: outer membrane protein, MtrE |
Gene: Shewmr4_2507: outer membrane protein, MtrE |
Gene: Shewmr7_2575: outer membrane protein, MtrE |
Gene: Sbal_1592: outer membrane protein, MtrE |
|
|
Gene: Sama_1212: outer membrane protein, MtrE |
Gene: Shew_2520: outer membrane protein, MtrE |
Gene: Spea_2693: outer membrane protein, MtrE |
Gene: Shal_2779: outer membrane protein, MtrE |
Gene: swp_3273: outer membrane protein, MtrE |
Gene: Ssed_1529: outer membrane protein, MtrE |
|
outer membrane protein, MtrE |
| mtrF |
Gene: SO1780: surface localized decaheme cytochrome c lipoprotein, MtrF |
|
|
Gene: Shewana3_2674: surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Shewmr4_2508: surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Shewmr7_2576: surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Sbal_1591: surface localized decaheme cytochrome c lipoprotein, MtrF |
|
|
Gene: Sama_1211: surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Shew_2521: surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Spea_2694: surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Shal_2780: surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: swp_3274: surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Ssed_1528: surface localized decaheme cytochrome c lipoprotein, MtrF |
|
surface localized decaheme cytochrome c lipoprotein, MtrF |
| omcA |
Gene: SO1779: surface localized decaheme cytochrome c lipoprotein, OmcA |
|
|
Gene: Shewana3_2675: surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: Shewmr4_2509: surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: Shewmr7_2577: surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: Sbal_1590: surface localized decaheme cytochrome c lipoprotein, OmcA |
|
Gene: Sfri_2636: surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: Sama_1210: surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: Shew_2522: surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: Spea_2695: surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: Shal_2781: surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: swp_3275: surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: Ssed_1527: surface localized decaheme cytochrome c lipoprotein, OmcA |
|
surface localized decaheme cytochrome c lipoprotein, OmcA |
| CRON 11. | |||||||||||||||||
| cyaC |
*
Shewanella oneidensis MR-1 Site: position = -162 score = 4.6576 sequence = TGTATTGATCCAGATCACAAAT Gene: SO1329: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella putrefaciens CN-32 Site: position = -101 score = 4.6576 sequence = TGTATTGATCCAGATCACAAAT Gene: Sputcn32_1140: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella sp W3-18-1 Site: position = -101 score = 4.6576 sequence = TGTATTGATCCAGATCACAAAT Gene: Sputw3181_3024: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella sp ANA-3 Site: position = -162 score = 4.43072 sequence = TGGATTGATCCAGATCACAAAT Gene: Shewana3_3045: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella sp MR-4 Site: position = -162 score = 4.43072 sequence = TGGATTGATCCAGATCACAAAT Gene: Shewmr4_2867: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella sp MR-7 Site: position = -162 score = 4.43072 sequence = TGGATTGATCCAGATCACAAAT Gene: Shewmr7_2949: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella baltica OS155 Site: position = -101 score = 4.7278 sequence = TAGATTGATCCAGATCACAAAT Gene: Sbal_1182: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella denitrificans OS217 Site: position = -157 score = 4.80677 sequence = TGAATTGATCTAGATCACATTT Gene: Sden_2784: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -158 score = 4.40292 sequence = TCTATTGATCTAAATCACAAAT Gene: Sfri_2947: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella amazonensis SB2B Site: position = -102 score = 4.2287 sequence = TGAATTGATTCAGATCACGTTA Gene: Sama_0861: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella loihica PV-4 Site: position = -162 score = 4.57561 sequence = TCATTTGACTTAGATCACAAAT Gene: Shew_1036: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella pealeana ATCC 700345 Site: position = -100 score = 4.57561 sequence = TCATTTGACTTAGATCACAAAT Gene: Spea_1019: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -99 score = 5.05535 sequence = TTATTTGACTTAGATCACAAAT Gene: Shal_1065: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella piezotolerans WP3 Site: position = -98 score = 4.57561 sequence = TCATTTGACTTAGATCACAAAT Gene: swp_3798: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella sediminis HAW-EB3 Site: position = -103 score = 4.3353 sequence = TCATTTGACAAAGATCACAAAT Gene: Ssed_1130: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella woodyi ATCC 51908 Site: position = -96 score = 4.3353 sequence = TCATTTGACTAAGATCACAAAT Gene: Swoo_1225: Adenylate cyclase (EC 4.6.1.1) |
Adenylate cyclase (EC 4.6.1.1) |
| CRON 12. | |||||||||||||||||
| resA |
*
Shewanella oneidensis MR-1 Site: position = -265 score = 4.09062 sequence = ATTATTGATGCATATCAAGAAT Gene: SO2100: C-type cytochrome biogenesis protein ResA (thioredoxin) |
*
Shewanella putrefaciens CN-32 Site: position = -279 score = 4.17976 sequence = ATTATTGATGTATATCAAGAAT Site: position = -219 score = 3.94856 sequence = TAACATGACGCAGATCTAATTT Gene: Sputcn32_2087: C-type cytochrome biogenesis protein ResA (thioredoxin) |
*
Shewanella sp W3-18-1 Site: position = -219 score = 3.94856 sequence = TAACATGACGCAGATCTAATTT Site: position = -279 score = 4.17976 sequence = ATTATTGATGTATATCAAGAAT Gene: Sputw3181_1925: C-type cytochrome biogenesis protein ResA (thioredoxin) |
*
Shewanella sp ANA-3 Site: position = -251 score = 4.20702 sequence = ATTCTTGATGCATATCAAGAAT Site: position = -191 score = 4.2052 sequence = TAACATGATGCAGATCTAATTT Gene: Shewana3_1881: C-type cytochrome biogenesis protein ResA (thioredoxin) |
*
Shewanella sp MR-4 Site: position = -206 score = 4.2052 sequence = TAACATGATGCAGATCTAATTT Site: position = -266 score = 4.20702 sequence = ATTCTTGATGCATATCAAGAAT Gene: Shewmr4_1823: C-type cytochrome biogenesis protein ResA (thioredoxin) |
*
Shewanella sp MR-7 Site: position = -191 score = 4.2052 sequence = TAACATGATGCAGATCTAATTT Site: position = -251 score = 4.20702 sequence = ATTCTTGATGCATATCAAGAAT Gene: Shewmr7_2154: C-type cytochrome biogenesis protein ResA (thioredoxin) |
*
Shewanella baltica OS155 Site: position = -301 score = 4.29616 sequence = ATTCTTGATGTATATCAAGAAT Site: position = -241 score = 4.03771 sequence = TAACATGACGTAGATCTAATTT Gene: Sbal_1890: C-type cytochrome biogenesis protein ResA (thioredoxin) |
|
Gene: Sfri_1124: C-type cytochrome biogenesis protein ResA (thioredoxin) |
Gene: Sama_1680: C-type cytochrome biogenesis protein ResA (thioredoxin) |
Gene: Shew_1895: C-type cytochrome biogenesis protein ResA (thioredoxin) |
|
|
|
Gene: Ssed_3819: C-type cytochrome biogenesis protein ResA (thioredoxin) |
*
Shewanella woodyi ATCC 51908 Site: position = -140 score = 4.05319 sequence = ATTTTTGATGCTAATCAAATGA Gene: Swoo_2219: C-type cytochrome biogenesis protein ResA (thioredoxin) |
C-type cytochrome biogenesis protein ResA (thioredoxin) |
| SO2101 |
Gene: SO2101: lipoprotein, putative |
Gene: Sputcn32_2086: lipoprotein, putative |
Gene: Sputw3181_1926: lipoprotein, putative |
Gene: Shewana3_1882: lipoprotein, putative |
Gene: Shewmr4_1824: lipoprotein, putative |
Gene: Shewmr7_2153: lipoprotein, putative |
Gene: Sbal_1891: lipoprotein, putative |
|
Gene: Sfri_1125: lipoprotein, putative |
Gene: Sama_1681: lipoprotein, putative |
Gene: Shew_1896: lipoprotein, putative |
|
|
|
Gene: Ssed_3818: lipoprotein, putative |
Gene: Swoo_2220: lipoprotein, putative |
lipoprotein, putative |
| SO2102 |
Gene: SO2102: hypothetical protein |
Gene: Sputcn32_2085: hypothetical protein |
Gene: Sputw3181_1927: hypothetical protein |
Gene: Shewana3_1883: hypothetical protein |
Gene: Shewmr4_1825: hypothetical protein |
Gene: Shewmr7_2152: hypothetical protein |
Gene: Sbal_1892: hypothetical protein |
|
Gene: Sfri_1126: hypothetical protein |
Gene: Sama_1682: hypothetical protein |
Gene: Shew_1897: hypothetical protein |
|
|
|
Gene: Ssed_3817: hypothetical protein |
Gene: Swoo_2221: hypothetical protein |
hypothetical protein |
| apbE |
Gene: SO2103: thiamin biosynthesis lipoprotein ApbE |
Gene: Sputcn32_2084: thiamin biosynthesis lipoprotein ApbE |
Gene: Sputw3181_1928: thiamin biosynthesis lipoprotein ApbE |
Gene: Shewana3_1884: thiamin biosynthesis lipoprotein ApbE |
Gene: Shewmr4_1826: thiamin biosynthesis lipoprotein ApbE |
Gene: Shewmr7_2151: thiamin biosynthesis lipoprotein ApbE |
Gene: Sbal_1893: thiamin biosynthesis lipoprotein ApbE |
|
Gene: Sfri_1127: thiamin biosynthesis lipoprotein ApbE |
Gene: Sama_1683: thiamin biosynthesis lipoprotein ApbE |
Gene: Shew_1898: thiamin biosynthesis lipoprotein ApbE |
|
|
|
Gene: Ssed_3816: thiamin biosynthesis lipoprotein ApbE |
Gene: Swoo_3407: thiamin biosynthesis lipoprotein ApbE |
thiamin biosynthesis lipoprotein ApbE |
| SO2104 |
Gene: SO2104: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase |
Gene: Sputcn32_2083: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase |
Gene: Sputw3181_1929: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase |
Gene: Shewana3_1885: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase |
Gene: Shewmr4_1827: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase |
Gene: Shewmr7_2150: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase |
Gene: Sbal_1894: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase |
|
Gene: Sfri_1128: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase |
|
|
|
|
|
|
|
DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase |
| SO2105 |
Gene: SO2105: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted |
Gene: Sputcn32_2082: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted |
Gene: Sputw3181_1930: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted |
Gene: Shewana3_1886: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted |
Gene: Shewmr4_1828: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted |
Gene: Shewmr7_2149: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted |
Gene: Sbal_1895: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted |
|
Gene: Sfri_1129: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted |
|
|
|
|
|
|
|
Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted |
| Swoo_2222 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: Swoo_2222: transposase and inactivated derivative |
transposase and inactivated derivative |
| CRON 13. | |||||||||||||||||
| Sputcn32_0777 |
|
*
Shewanella putrefaciens CN-32 Site: position = -140 score = 4.46796 sequence = AAACTTGATTCGTGTCACACAA Gene: Sputcn32_0777: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -140 score = 4.46796 sequence = AAACTTGATTCGTGTCACACAA Gene: Sputw3181_3398: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -140 score = 4.42397 sequence = AAATTTGAACCACATCACACAG Gene: Shewana3_0738: hypothetical protein |
|
|
Gene: Sbal_3565: hypothetical protein |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -129 score = 4.15093 sequence = TTTTGTGAGCTAATTGGCAATT Gene: Sfri_0507: hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -139 score = 4.26481 sequence = AAAGTTGATTCACATCAAATTA Gene: Sama_0549: hypothetical protein |
Gene: Shew_3247: hypothetical protein |
Gene: Spea_0593: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -79 score = 3.85574 sequence = GTTTTTGACTAAGATCAAAAAA Gene: Shal_0680: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -64 score = 4.09572 sequence = AAACGTGATCAACAGCATCTTT Gene: swp_4510: hypothetical protein |
Gene: Ssed_4003: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -81 score = 3.91436 sequence = TTTATTGATCGAGATCAGCTTA Gene: Swoo_4146: hypothetical protein |
hypothetical protein |
| CRON 14. | |||||||||||||||||
| pepQ |
*
Shewanella oneidensis MR-1 Site: position = -237 score = 4.40096 sequence = CTTTGTGATACACTGCACAAAG Gene: SO0022: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
*
Shewanella putrefaciens CN-32 Site: position = -302 score = 4.1807 sequence = CTTTGTGATACACTGCACAGAG Gene: Sputcn32_0014: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
*
Shewanella sp W3-18-1 Site: position = -302 score = 4.1807 sequence = CTTTGTGATACACTGCACAGAG Gene: Sputw3181_0014: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
*
Shewanella sp ANA-3 Site: position = -255 score = 4.40096 sequence = CTTTGTGATACACTGCACAAAG Gene: Shewana3_0025: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
*
Shewanella sp MR-4 Site: position = -255 score = 4.40096 sequence = CTTTGTGATACACTGCACAAAG Gene: Shewmr4_0019: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
*
Shewanella sp MR-7 Site: position = -255 score = 4.40096 sequence = CTTTGTGATACACTGCACAAAG Gene: Shewmr7_0017: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
*
Shewanella baltica OS155 Site: position = -302 score = 4.1807 sequence = CTTTGTGATACACTGCACAGAG Gene: Sbal_0022: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
Gene: Sden_0016: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
Gene: Sfri_0014: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
*
Shewanella amazonensis SB2B Site: position = -109 score = 4.02086 sequence = CTTTGTGATACACTGCACAGCA Gene: Sama_0033: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
Gene: Shew_0020: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
*
Shewanella pealeana ATCC 700345 Site: position = -252 score = 4.08273 sequence = CAGTGTGCGACGAATCACAAAA Gene: Spea_0019: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -250 score = 4.00906 sequence = CAGTGTGCGACTAATCACAAAA Gene: Shal_0017: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
Gene: swp_0046: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
Gene: Ssed_0024: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
Gene: Swoo_0022: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) |
| SO0023 |
Gene: SO0023: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: Sputcn32_0015: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: Sputw3181_0015: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: Shewana3_0026: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: Shewmr4_0020: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: Shewmr7_0018: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: Sbal_0023: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: Sden_0017: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: Sfri_0015: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: Sama_0034: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: Shew_0021: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: Spea_0020: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: Shal_0018: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: swp_0047: FIG000605: protein co-occurring with transport systems (COG1739) |
*
Shewanella sediminis HAW-EB3 Site: position = -48 score = 3.80986 sequence = TTTTCTGATAGATTTTACATCA Gene: Ssed_0025: FIG000605: protein co-occurring with transport systems (COG1739) |
Gene: Swoo_0023: FIG000605: protein co-occurring with transport systems (COG1739) |
FIG000605: protein co-occurring with transport systems (COG1739) |
| trkH-1 |
Gene: SO0024: potassium uptake protein TrkH |
Gene: Sputcn32_0016: potassium uptake protein TrkH |
Gene: Sputw3181_0016: potassium uptake protein TrkH |
Gene: Shewana3_0027: potassium uptake protein TrkH |
Gene: Shewmr4_0021: potassium uptake protein TrkH |
Gene: Shewmr7_0019: potassium uptake protein TrkH |
Gene: Sbal_0024: potassium uptake protein TrkH |
Gene: Sden_0018: potassium uptake protein TrkH |
Gene: Sfri_0016: potassium uptake protein TrkH |
Gene: Sama_0035: potassium uptake protein TrkH |
Gene: Shew_0022: potassium uptake protein TrkH |
Gene: Spea_0021: potassium uptake protein TrkH |
Gene: Shal_0019: potassium uptake protein TrkH |
Gene: swp_0048: potassium uptake protein TrkH |
Gene: Ssed_0026: potassium uptake protein TrkH |
Gene: Swoo_0024: potassium uptake protein TrkH |
potassium uptake protein TrkH |
| hemG |
Gene: SO0025: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Sputcn32_0017: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Sputw3181_0017: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Shewana3_0028: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Shewmr4_0022: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Shewmr7_0020: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Sbal_0025: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Sden_0019: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Sfri_0017: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Sama_0036: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Shew_0023: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Spea_0022: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Shal_0020: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: swp_0049: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Ssed_0027: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
Gene: Swoo_0025: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
| CRON 15. | |||||||||||||||||
| fadB |
*
Shewanella oneidensis MR-1 Site: position = -210 score = 4.0994 sequence = CTTTGTGCAGTGTATCACAAAG Gene: SO0021: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
*
Shewanella putrefaciens CN-32 Site: position = -210 score = 3.70346 sequence = CTCTGTGCAGTGTATCACAAAG Gene: Sputcn32_0013: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
*
Shewanella sp W3-18-1 Site: position = -210 score = 3.70346 sequence = CTCTGTGCAGTGTATCACAAAG Gene: Sputw3181_0013: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
*
Shewanella sp ANA-3 Site: position = -210 score = 4.0994 sequence = CTTTGTGCAGTGTATCACAAAG Gene: Shewana3_0024: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
*
Shewanella sp MR-4 Site: position = -210 score = 4.0994 sequence = CTTTGTGCAGTGTATCACAAAG Gene: Shewmr4_0018: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
*
Shewanella sp MR-7 Site: position = -210 score = 4.0994 sequence = CTTTGTGCAGTGTATCACAAAG Gene: Shewmr7_0016: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
*
Shewanella baltica OS155 Site: position = -210 score = 3.70346 sequence = CTCTGTGCAGTGTATCACAAAG Gene: Sbal_0021: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Sden_0015: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Sfri_0013: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
*
Shewanella amazonensis SB2B Site: position = -193 score = 3.83321 sequence = TGCTGTGCAGTGTATCACAAAG Gene: Sama_0032: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Shew_0019: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
*
Shewanella pealeana ATCC 700345 Site: position = -134 score = 4.5914 sequence = TTTTGTGATTCGTCGCACACTG Gene: Spea_0018: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -134 score = 4.44023 sequence = TTTTGTGATTAGTCGCACACTG Gene: Shal_0016: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
*
Shewanella piezotolerans WP3 Site: position = -127 score = 4.41781 sequence = TTATGTGATTAGTCGCACACTG Gene: swp_0035: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Ssed_0023: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Swoo_0021: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
| fadA |
Gene: SO0020: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Sputcn32_0012: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Sputw3181_0012: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Shewana3_0023: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Shewmr4_0017: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Shewmr7_0015: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Sbal_0020: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Sden_0014: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Sfri_0012: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Sama_0031: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Shew_0018: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Spea_0017: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Shal_0015: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: swp_0034: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Ssed_0022: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
Gene: Swoo_0020: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9) |
| CRON 16. | |||||||||||||||||
| SO2010 |
*
Shewanella oneidensis MR-1 Site: position = -70 score = 4.66386 sequence = TTTTGTGATCTTCGTCACTGTA Gene: SO2010: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -65 score = 5.08961 sequence = TTTTGTGATCTCCATCACCGTT Gene: Sputcn32_2305: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -65 score = 5.08961 sequence = TTTTGTGATCTCCATCACCGTT Gene: Sputw3181_1703: hypothetical protein |
|
*
Shewanella sp MR-4 Site: position = -65 score = 4.85361 sequence = TTTTGTGATCTTAATCACTGTA Gene: Shewmr4_2257: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -65 score = 4.85361 sequence = TTTTGTGATCTTAATCACTGTA Gene: Shewmr7_2329: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -65 score = 4.96559 sequence = TTTTGTGATCTAAATCACTGTA Gene: Sbal_2577: hypothetical protein |
*
Shewanella denitrificans OS217 Site: position = -81 score = 4.80876 sequence = AAATGTGATCCAGCTCAGCTTT Gene: Sden_2384: hypothetical protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -116 score = 4.84249 sequence = TTTTGTGATCGACTTCACGTCT Gene: Sfri_2410: hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -51 score = 4.3278 sequence = TTTTGTGAGCTGCATCACGGCA Gene: Sama_1307: hypothetical protein |
*
Shewanella loihica PV-4 Site: position = -48 score = 4.08426 sequence = AAAATTGATCTAGATCAATAAA Gene: Shew_2238: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -51 score = 4.08426 sequence = AAAATTGATCTAGATCAATAAA Gene: Spea_1505: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -80 score = 4.02505 sequence = TAGTGTGATTGATATCTATAAT Gene: Shal_1587: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -21 score = 4.08426 sequence = AAAATTGATCTAGATCAATAAA Gene: swp_1711: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -49 score = 4.08426 sequence = AAAATTGATCTAGATCAATAAA Gene: Ssed_2855: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -48 score = 4.09084 sequence = TAAATTGATCTAGATCAATAAA Gene: Swoo_1790: hypothetical protein |
hypothetical protein |
| CRON 17. | |||||||||||||||||
| SO3553 |
*
Shewanella oneidensis MR-1 Site: position = -70 score = 3.91137 sequence = TTTTGCAACTATGATCACACAA Gene: SO3553: putative sulfate permease |
*
Shewanella putrefaciens CN-32 Site: position = -81 score = 3.95475 sequence = ATTTGCAATCATGATCACACAG Gene: Sputcn32_1042: putative sulfate permease |
*
Shewanella sp W3-18-1 Site: position = -81 score = 3.95475 sequence = ATTTGCAATCATGATCACACAG Gene: Sputw3181_3123: putative sulfate permease |
*
Shewanella sp ANA-3 Site: position = -70 score = 3.91137 sequence = TTTTGCAACTATGATCACACAA Gene: Shewana3_3154: putative sulfate permease |
*
Shewanella sp MR-4 Site: position = -70 score = 4.47087 sequence = TTTTGTAACTATGATCACACAA Gene: Shewmr4_2974: putative sulfate permease |
*
Shewanella sp MR-7 Site: position = -70 score = 4.47087 sequence = TTTTGTAACTATGATCACACAA Gene: Shewmr7_3056: putative sulfate permease |
Gene: Sbal_1037: putative sulfate permease |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -116 score = 4.47739 sequence = TAATGTGATGATAATTATATTA Gene: Sfri_3674: putative sulfate permease |
*
Shewanella amazonensis SB2B Site: position = -82 score = 4.12356 sequence = AAATTTGCCAAAGCTCACACAT Gene: Sama_1067: putative sulfate permease |
Gene: Shew_0497: putative sulfate permease |
|
|
|
*
Shewanella sediminis HAW-EB3 Site: position = -233 score = 4.0599 sequence = GTAAGTGCTACGCATCACATTT Gene: Ssed_1334: putative sulfate permease |
*
Shewanella woodyi ATCC 51908 Site: position = -288 score = 3.72381 sequence = TCCAGCGACTTAGATCACATTT Gene: Swoo_3320: putative sulfate permease |
putative sulfate permease |
| Sama_1066 |
|
|
|
|
|
|
|
|
|
Gene: Sama_1066: hypothetical protein |
|
|
|
|
|
|
hypothetical protein |
| Shewana3_2597 |
|
|
|
|
|
|
|
|
|
Gene: Sama_1065: L-sorbosone dehydrogenase |
|
|
|
|
|
|
L-sorbosone dehydrogenase |
| purE |
Gene: SO3554: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Sputcn32_1041: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Sputw3181_3124: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Shewana3_3155: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Shewmr4_2975: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Shewmr7_3057: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Sbal_1036: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
*
Shewanella denitrificans OS217 Site: position = -315 score = 3.73258 sequence = AATTCTGACTCATCTTAAATTA Gene: Sden_1224: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Sfri_1076: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Sama_1064: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
2
Shewanella loihica PV-4 Gene: Shew_1248: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) Gene: Shew_1230: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Spea_1211: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -269 score = 4.35424 sequence = TTGTGGGATCTAGGTAACATTT Gene: Shal_1245: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: swp_1396: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
*
Shewanella sediminis HAW-EB3 Site: position = -217 score = 3.77583 sequence = TATTGTGAAGTCATCCGGATAT Gene: Ssed_1333: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Swoo_3321: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
| purK |
Gene: SO3555: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Sputcn32_1040: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Sputw3181_3125: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Shewana3_3156: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Shewmr4_2976: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Shewmr7_3058: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Sbal_1035: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Sden_1223: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Sfri_1075: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Sama_1063: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Shew_1249: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
|
|
|
|
Gene: Swoo_3322: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
| SO3556 |
Gene: SO3556: cyclic nucleotide phosphodiesterase, putative |
Gene: Sputcn32_1039: cyclic nucleotide phosphodiesterase, putative |
Gene: Sputw3181_3126: cyclic nucleotide phosphodiesterase, putative |
Gene: Shewana3_3157: cyclic nucleotide phosphodiesterase, putative |
Gene: Shewmr4_2977: cyclic nucleotide phosphodiesterase, putative |
Gene: Shewmr7_3059: cyclic nucleotide phosphodiesterase, putative |
|
Gene: Sden_1222: cyclic nucleotide phosphodiesterase, putative |
|
Gene: Sama_1062: cyclic nucleotide phosphodiesterase, putative |
Gene: Shew_2953: cyclic nucleotide phosphodiesterase, putative |
|
|
|
|
Gene: Swoo_3724: cyclic nucleotide phosphodiesterase, putative |
cyclic nucleotide phosphodiesterase, putative |
| CRON 18. | |||||||||||||||||
| SO0543 |
*
Shewanella oneidensis MR-1 Site: position = -192 score = 3.7012 sequence = CGTTATGCGCTAAATCACAAAA Gene: SO0543: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -88 score = 4.16514 sequence = ATTTTTACTCTAATTCACAAAA Gene: Sputcn32_3331: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -88 score = 4.16514 sequence = ATTTTTACTCTAATTCACAAAA Gene: Sputw3181_0610: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -193 score = 4.07227 sequence = AGTTATGCGCTAAATCACAAAA Gene: Shewana3_0541: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -192 score = 3.96029 sequence = AGTTATGCGCTTAATCACAAAA Gene: Shewmr4_0542: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -191 score = 3.96029 sequence = AGTTATGCGCTTAATCACAAAA Gene: Shewmr7_3488: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -201 score = 4.84616 sequence = TGTTGTGCTCTCAATCACAAAA Site: position = -88 score = 3.91937 sequence = AATTTTACCCTGATTCACAAAA Gene: Sbal_0501: hypothetical protein |
*
Shewanella denitrificans OS217 Site: position = -34 score = 3.93206 sequence = TAATATGACTAGAGTCAAACAT Gene: Sden_0657: hypothetical protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -200 score = 4.0127 sequence = ATATTTGATCACAAGCACACTC Gene: Sfri_3534: hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -240 score = 3.88591 sequence = CATTGTTACTCACTTCATACAT Site: position = -126 score = 3.94973 sequence = ATTTATGACCATACTCACAGAG Gene: Sama_3164: hypothetical protein |
*
Shewanella loihica PV-4 Site: position = -190 score = 4.1607 sequence = TAGTGTTAACTCGATCAAACAA Gene: Shew_0428: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -197 score = 4.17892 sequence = TTTTGCTACATAGATCGCATAT Gene: Spea_3733: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -235 score = 4.70012 sequence = TTTTGTTACATGGATCGCATAT Gene: Shal_3818: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -156 score = 4.64928 sequence = TTTTGTTACACAGATCGCATAT Gene: swp_0532: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -213 score = 4.19313 sequence = TAATGTTAAATCGATCTCACTT Gene: Ssed_0598: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -215 score = 3.83055 sequence = AATTGCTAGATAGATCTCACTT Gene: Swoo_4355: hypothetical protein |
hypothetical protein |
| CRON 19. | |||||||||||||||||
| hmgA |
*
Shewanella oneidensis MR-1 Site: position = -92 score = 3.81693 sequence = AATTGATAAGAAGATCACAGTA Gene: SO1963: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
*
Shewanella putrefaciens CN-32 Site: position = -66 score = 4.14896 sequence = AATTGATAACAAGATCACATAA Gene: Sputcn32_1671: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
*
Shewanella sp W3-18-1 Site: position = -66 score = 4.14896 sequence = AATTGATAACAAGATCACATAA Gene: Sputw3181_2354: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
*
Shewanella sp ANA-3 Site: position = -144 score = 3.88015 sequence = TTTTTAGATTGAGATAACAGAT Site: position = -88 score = 3.92208 sequence = AATTGATAAGAAGATCACACTA Gene: Shewana3_2481: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
*
Shewanella sp MR-4 Site: position = -144 score = 3.88015 sequence = TTTTTAGATTGAGATAACAGAT Site: position = -88 score = 3.92208 sequence = AATTGATAAGAAGATCACACTA Gene: Shewmr4_2291: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
*
Shewanella sp MR-7 Site: position = -88 score = 3.92208 sequence = AATTGATAAGAAGATCACACTA Site: position = -144 score = 3.88015 sequence = TTTTTAGATAGAGATAACAGAT Gene: Shewmr7_2363: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
*
Shewanella baltica OS155 Site: position = -88 score = 3.95142 sequence = AATTGATAACAAGATCACACTA Site: position = -144 score = 3.52271 sequence = TTTTTAGATTGAGATAACGGAT Gene: Sbal_2615: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
*
Shewanella denitrificans OS217 Site: position = -122 score = 3.58168 sequence = AATTGATAGCTAGATCACAACG Gene: Sden_2162: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -106 score = 4.99586 sequence = AATTGTAAGTTAGATCACATAT Site: position = -126 score = 3.52118 sequence = TTTGTTGATCTTTACCACTAAA Gene: Sfri_2326: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
*
Shewanella amazonensis SB2B Site: position = -78 score = 4.47858 sequence = AATTGATACCCAGATCACATAT Gene: Sama_1569: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
*
Shewanella loihica PV-4 Site: position = -61 score = 5.10196 sequence = AATTGTTACTTAGATCACATAA Gene: Shew_2154: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
*
Shewanella pealeana ATCC 700345 Site: position = -63 score = 3.95532 sequence = AAATTGAACCTAGATCACATTA Gene: Spea_1874: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -63 score = 3.9407 sequence = AAATTAAAGCTAGATCACATTA Gene: Shal_2409: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
*
Shewanella piezotolerans WP3 Site: position = -61 score = 4.14896 sequence = AATTGATAACAAGATCACATTA Site: position = -84 score = 3.48834 sequence = TTTTTTGCTGTTGTTAGCAACT Gene: swp_2870: Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
|
|
Homogentisate 1,2-dioxygenase (EC 1.13.11.5) |
| CRON 20. | |||||||||||||||||
| SO2806 |
*
Shewanella oneidensis MR-1 Site: position = -95 score = 4.26651 sequence = TCTTGTGAATTGAGTCACATAG Gene: SO2806: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -95 score = 3.96381 sequence = TCTTGTGAATTGAGTCACAGAG Gene: Sputcn32_1554: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -95 score = 3.96381 sequence = TCTTGTGAATTGAGTCACAGAG Gene: Sputw3181_2545: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -95 score = 3.96381 sequence = TCTTGTGAATTGAGTCACAGAG Gene: Shewana3_2588: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -95 score = 3.96381 sequence = TCTTGTGAATTGAGTCACAGAG Gene: Shewmr4_2426: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -95 score = 3.96381 sequence = TCTTGTGAATTGAGTCACAGAG Gene: Shewmr7_2496: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -94 score = 4.18448 sequence = ATCTGTGAATTAAGTCACACAG Gene: Sbal_1679: hypothetical protein |
*
Shewanella denitrificans OS217 Site: position = -35 score = 3.92596 sequence = ATATTTTATGCCGTTCACTCAT Gene: Sden_1453: hypothetical protein |
Gene: Sfri_2429: hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -85 score = 4.0245 sequence = AATTGTGAAGCCAGTCACGGTG Gene: Sama_1287: hypothetical protein |
Gene: Shew_2323: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -84 score = 4.41665 sequence = AATTGTGAATAACGTCACACAG Gene: Spea_1483: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -84 score = 4.73677 sequence = AATTGTGAACAACATCACACAG Gene: Shal_1567: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = 27 score = 4.26731 sequence = AACTGTGAAAGGTATCACACAC Gene: swp_1689: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -82 score = 4.45071 sequence = TAATGTGAATGGCGTCACACAG Gene: Ssed_2877: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -81 score = 4.61656 sequence = TATTGTGAAAGTCATCACACAG Gene: Swoo_1771: hypothetical protein |
hypothetical protein |
| CRON 21. | |||||||||||||||||
| map |
Gene: SO1627: methionine aminopeptidase (EC 3.4.11.18) |
Gene: Sputcn32_1347: methionine aminopeptidase (EC 3.4.11.18) |
Gene: Sputw3181_2756: methionine aminopeptidase (EC 3.4.11.18) |
Gene: Shewana3_2816: methionine aminopeptidase (EC 3.4.11.18) |
Gene: Shewmr4_2642: methionine aminopeptidase (EC 3.4.11.18) |
Gene: Shewmr7_2709: methionine aminopeptidase (EC 3.4.11.18) |
Gene: Sbal_1449: methionine aminopeptidase (EC 3.4.11.18) |
Gene: Sden_1553: methionine aminopeptidase (EC 3.4.11.18) |
Gene: Sfri_1269: methionine aminopeptidase (EC 3.4.11.18) |
Gene: Sama_1138: methionine aminopeptidase (EC 3.4.11.18) |
Gene: Shew_2636: methionine aminopeptidase (EC 3.4.11.18) |
*
Shewanella pealeana ATCC 700345 Site: position = -104 score = 4.17206 sequence = TAATTTGAAAAAAAGCACAAAT Gene: Spea_2886: methionine aminopeptidase (EC 3.4.11.18) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -92 score = 3.70075 sequence = TAATATGAAAAAAAGCACAAAC Gene: Shal_2982: methionine aminopeptidase (EC 3.4.11.18) |
*
Shewanella piezotolerans WP3 Site: position = -93 score = 4.19448 sequence = TATTTTGAAAAAAAGCACAAAT Gene: swp_3524: methionine aminopeptidase (EC 3.4.11.18) |
*
Shewanella sediminis HAW-EB3 Site: position = -91 score = 3.88528 sequence = TATTGAGAGAGCAAACACAAAT Gene: Ssed_3162: methionine aminopeptidase (EC 3.4.11.18) |
Gene: Swoo_3282: methionine aminopeptidase (EC 3.4.11.18) |
methionine aminopeptidase (EC 3.4.11.18) |
| CRON 22. | |||||||||||||||||
| SO3895 |
Gene: SO3895: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella putrefaciens CN-32 Site: position = -317 score = 4.86557 sequence = AAATGCGATATAGATCACAAAC Gene: Sputcn32_0780: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella sp W3-18-1 Site: position = -317 score = 4.86557 sequence = AAATGCGATATAGATCACAAAC Gene: Sputw3181_3395: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella sp ANA-3 Site: position = -308 score = 4.54871 sequence = AAATGTGATCTTGATCACTTGA Gene: Shewana3_0735: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella sp MR-4 Site: position = -309 score = 3.87278 sequence = AAATGTGATCTGGATCATTGGA Gene: Shewmr4_3226: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella sp MR-7 Site: position = -309 score = 3.87278 sequence = AAATGTGATCTGGATCATTGGA Gene: Shewmr7_0763: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella baltica OS155 Site: position = -321 score = 5.03197 sequence = AAGTGTGATCTGGATCAAGTTT Gene: Sbal_3568: HesA/MoeB/ThiF family protein related to EC-YgdL |
Gene: Sden_0542: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella frigidimarina NCIMB 400 Site: position = -251 score = 3.95131 sequence = TATCTTGATGAGTTTAACCAAT Gene: Sfri_0504: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella amazonensis SB2B Site: position = -214 score = 4.83968 sequence = AAGTGTGATCACTATCACATCA Gene: Sama_0546: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella loihica PV-4 Site: position = -226 score = 4.63153 sequence = AGGTGTGATCCGTGTCGCAAAT Site: position = -196 score = 3.83046 sequence = TTACGTGAGTTTTATCATGTTG Gene: Shew_3251: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella pealeana ATCC 700345 Site: position = -259 score = 4.2915 sequence = ATGTGTGACGCTTGTCACGGTT Gene: Spea_0591: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella halifaxensis HAW-EB4 Site: position = -253 score = 4.77168 sequence = GTTTGTGATGTCTATCACGTTT Gene: Shal_0678: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella piezotolerans WP3 Site: position = -215 score = 3.91162 sequence = ATGTGTGATATTAATCATAGGT Site: position = -245 score = 3.77242 sequence = CGATGTGATCTTGATCTGGTTT Gene: swp_4512: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella sediminis HAW-EB3 Site: position = -200 score = 3.77358 sequence = TTTTGTGAACTTGATTAACAAG Site: position = -324 score = 5.03019 sequence = TTTTGTGATTCTTATCACGCAT Site: position = -294 score = 4.58816 sequence = TTGTGTGATATCAATCATCTTT Gene: Ssed_4007: HesA/MoeB/ThiF family protein related to EC-YgdL |
*
Shewanella woodyi ATCC 51908 Site: position = -290 score = 5.13082 sequence = CTTTGTGATATCAATCACAATA Gene: Swoo_4150: HesA/MoeB/ThiF family protein related to EC-YgdL |
HesA/MoeB/ThiF family protein related to EC-YgdL |
| CRON 23. | |||||||||||||||||
| SO4126 |
*
Shewanella oneidensis MR-1 Site: position = -92 score = 4.13908 sequence = TTAATTGACCTAAATCAAACTT Gene: SO4126: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -90 score = 4.63786 sequence = TAATTTGACCTAGATCAAAGTT Gene: Sputcn32_0548: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -90 score = 4.63786 sequence = TAATTTGACCTAGATCAAAGTT Gene: Sputw3181_3624: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -93 score = 4.25106 sequence = TTAATTGACCTAGATCAAACTT Gene: Shewana3_3675: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -187 score = 4.23469 sequence = AACATTGAACTAGATCACAATT Site: position = -93 score = 4.25106 sequence = TTAATTGACCTAGATCAAACTT Gene: Shewmr4_3498: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -93 score = 4.25106 sequence = TTAATTGACCTAGATCAAACTT Site: position = -187 score = 4.23469 sequence = AACATTGAACTAGATCACAATT Gene: Shewmr7_0454: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -90 score = 4.25106 sequence = TTAATTGACCTAGATCAAACTT Gene: Sbal_3847: hypothetical protein |
|
|
|
|
|
|
|
|
|
hypothetical protein |
| CRON 24. | |||||||||||||||||
| etfD |
*
Shewanella oneidensis MR-1 Site: position = -171 score = 4.25014 sequence = ATCTGTGACAGTGCTCACCCAA Gene: SO4453: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella putrefaciens CN-32 Site: position = -171 score = 4.16552 sequence = ATCTGTGACAGTCCTCACCCAA Gene: Sputcn32_0388: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella sp W3-18-1 Site: position = -171 score = 4.16552 sequence = ATCTGTGACAGTCCTCACCCAA Gene: Sputw3181_0242: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella sp ANA-3 Site: position = -175 score = 4.25014 sequence = ATCTGTGACAGTGCTCACCCAA Gene: Shewana3_0273: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella sp MR-4 Site: position = -175 score = 4.28426 sequence = AACTGTGACAGCGCTCACCCAA Gene: Shewmr4_0272: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella sp MR-7 Site: position = -175 score = 4.28426 sequence = AACTGTGACAGCGCTCACCCAA Gene: Shewmr7_3749: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella baltica OS155 Site: position = -170 score = 4.36307 sequence = ATCTGTGACAGTCCTCACCTAA Gene: Sbal_0283: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella denitrificans OS217 Site: position = -130 score = 4.55565 sequence = TTTTGTGACACAGCTCACCTCA Gene: Sden_0100: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -159 score = 4.67074 sequence = ATTTGTGACTCGACTCACGCTA Gene: Sfri_0081: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella amazonensis SB2B Site: position = -157 score = 4.31194 sequence = AATTGTGACGCCGCTCACTCAG Gene: Sama_3523: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella loihica PV-4 Site: position = -148 score = 4.53276 sequence = TAATGTGACACCGCTCACGAAG Gene: Shew_0086: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella pealeana ATCC 700345 Site: position = -181 score = 4.10743 sequence = TTTTGTGACAGTTATCACGGCA Gene: Spea_4121: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -180 score = 4.21259 sequence = TTTTGTGACAGTTATCACGCCA Gene: Shal_0121: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella piezotolerans WP3 Site: position = -176 score = 4.43323 sequence = TTTTGTGACACTAATCACCTCA Gene: swp_5010: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella sediminis HAW-EB3 Site: position = -150 score = 4.82835 sequence = TTTTGTGACACCCCTCACATAC Gene: Ssed_4403: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Shewanella woodyi ATCC 51908 Site: position = -135 score = 4.72349 sequence = TTTTGTGACGACACTCACATTC Gene: Swoo_4794: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
| CRON 25. | |||||||||||||||||
| omp35 |
*
Shewanella oneidensis MR-1 Site: position = -67 score = 4.14845 sequence = AAATGTGTTAAACCACACAAAA Gene: SO3896: outer membrane porin |
|
|
*
Shewanella sp ANA-3 Site: position = -67 score = 4.14845 sequence = AAATGTGTTAAACCACACAAAA Gene: Shewana3_0733: outer membrane porin |
*
Shewanella sp MR-4 Site: position = -67 score = 3.74184 sequence = AAATGTGTAAAACCACACAAAA Gene: Shewmr4_3228: outer membrane porin |
*
Shewanella sp MR-7 Site: position = -67 score = 3.74184 sequence = AAATGTGTAAAACCACACAAAA Gene: Shewmr7_0761: outer membrane porin |
*
Shewanella baltica OS155 Site: position = -67 score = 3.58895 sequence = AAATGCGTTAAACCACACAAAA Gene: Sbal_3570: outer membrane porin |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -145 score = 4.52387 sequence = TTATTTGATCTAGGCCACACTA Gene: Sfri_0503: outer membrane porin |
|
*
Shewanella loihica PV-4 Site: position = -150 score = 4.10094 sequence = AAATTTGATCTGCGCCACACTC Gene: Shew_3260: outer membrane porin |
*
Shewanella pealeana ATCC 700345 Site: position = -150 score = 4.4453 sequence = AAACATGATCTAGTCCACAATT Gene: Spea_0589: outer membrane porin |
*
Shewanella halifaxensis HAW-EB4 Site: position = -150 score = 4.4453 sequence = AAACATGATCTAGTCCACAATT Gene: Shal_0676: outer membrane porin |
*
Shewanella piezotolerans WP3 Site: position = -150 score = 4.12815 sequence = AAACTTGATCTAGCCCACAATC Gene: swp_4514: outer membrane porin |
*
Shewanella sediminis HAW-EB3 Site: position = -151 score = 4.4453 sequence = AAACATGATCTAGTCCACAATT Gene: Ssed_4009: outer membrane porin |
*2
Shewanella woodyi ATCC 51908 Site: position = -149 score = 4.29639 sequence = AAGTTTGATCTAGTCCACAATC Gene: Swoo_4151: outer membrane porin Site: position = -241 score = 3.31103 sequence = AATTATTAACTCTTTCTTAAAT Gene: Swoo_4152: outer membrane porin |
outer membrane porin |
| CRON 26. | |||||||||||||||||
| SO3421 |
*
Shewanella oneidensis MR-1 Site: position = -244 score = 4.22439 sequence = AAACGAGAGTTAAATCACACTT Gene: SO3421: b-type cytochrome, putative |
*
Shewanella putrefaciens CN-32 Site: position = -242 score = 4.76659 sequence = AAACGAGATCTAAATCACAAAA Gene: Sputcn32_2739: b-type cytochrome, putative |
*
Shewanella sp W3-18-1 Site: position = -242 score = 4.76659 sequence = AAACGAGATCTAAATCACAAAA Gene: Sputw3181_1273: b-type cytochrome, putative |
*
Shewanella sp ANA-3 Site: position = -241 score = 4.87751 sequence = AAACGAGATCTAAATCACATTT Gene: Shewana3_1134: b-type cytochrome, putative |
*
Shewanella sp MR-4 Site: position = -241 score = 4.87751 sequence = AAACGAGATCTAAATCACATTT Gene: Shewmr4_1133: b-type cytochrome, putative |
*
Shewanella sp MR-7 Site: position = -241 score = 4.87751 sequence = AAACGAGATCTAAATCACATTT Gene: Shewmr7_1204: b-type cytochrome, putative |
*
Shewanella baltica OS155 Site: position = -244 score = 4.98949 sequence = AAACGAGATCTAGATCACATTT Gene: Sbal_1222: b-type cytochrome, putative |
*
Shewanella denitrificans OS217 Site: position = -291 score = 4.6838 sequence = AAGCGTGATCAAAGTCACACTT Gene: Sden_2745: b-type cytochrome, putative |
*
Shewanella frigidimarina NCIMB 400 Site: position = -383 score = 5.24076 sequence = AATAGTGATCTGCATCACACTT Gene: Sfri_2911: b-type cytochrome, putative |
*
Shewanella amazonensis SB2B Site: position = -234 score = 4.21525 sequence = AGTCGTGAGTAAAATCACGTTT Gene: Sama_0900: b-type cytochrome, putative |
*
Shewanella loihica PV-4 Site: position = -208 score = 4.94835 sequence = AAACGTGATCTAGATCAACTTT Gene: Shew_1074: b-type cytochrome, putative |
*
Shewanella pealeana ATCC 700345 Site: position = -255 score = 4.91113 sequence = AGTCGTGATCTAAATCACGTTT Gene: Spea_1061: b-type cytochrome, putative |
*
Shewanella halifaxensis HAW-EB4 Site: position = -255 score = 4.91113 sequence = AGTCGTGATCTAAATCACGTTT Gene: Shal_1109: b-type cytochrome, putative |
*
Shewanella piezotolerans WP3 Site: position = -366 score = 4.91113 sequence = AGTCGTGATCTAAATCACGTTT Gene: swp_3756: b-type cytochrome, putative |
*
Shewanella sediminis HAW-EB3 Site: position = -236 score = 4.91113 sequence = AGTCGTGATCTAAATCACGTTT Gene: Ssed_1170: b-type cytochrome, putative |
*
Shewanella woodyi ATCC 51908 Site: position = -234 score = 4.91113 sequence = AGTCGTGATCTTGATCACGTTT Gene: Swoo_1265: b-type cytochrome, putative |
b-type cytochrome, putative |
| CRON 27. | |||||||||||||||||
| hutC |
*
Shewanella oneidensis MR-1 Site: position = -151 score = 4.14677 sequence = TTATGTGAGCTAGCTTGTATTT Gene: SO0096: histidine utilization repressor |
*
Shewanella putrefaciens CN-32 Site: position = -178 score = 4.10847 sequence = TTATGTGAGCTGGCTTGTATTT Gene: Sputcn32_0078: histidine utilization repressor |
*
Shewanella sp W3-18-1 Site: position = -178 score = 4.10847 sequence = TTATGTGAGCTGGCTTGTATTT Gene: Sputw3181_3999: histidine utilization repressor |
*
Shewanella sp ANA-3 Site: position = -142 score = 4.14677 sequence = TTATGTGAGCTAGCTTGTATTT Gene: Shewana3_0099: histidine utilization repressor |
*
Shewanella sp MR-4 Site: position = -142 score = 4.05763 sequence = TTATGTGAGCCAGCTTGTATTT Gene: Shewmr4_0098: histidine utilization repressor |
*
Shewanella sp MR-7 Site: position = -142 score = 4.14677 sequence = TTATGTGAGCTAGCTTGTATTT Gene: Shewmr7_0093: histidine utilization repressor |
*
Shewanella baltica OS155 Site: position = -177 score = 4.14677 sequence = TTATGTGAGCTAGCTTGTATTT Gene: Sbal_4253: histidine utilization repressor |
Gene: Sden_0082: histidine utilization repressor |
Gene: Sfri_3954: histidine utilization repressor |
Gene: Sama_0081: histidine utilization repressor |
*
Shewanella loihica PV-4 Site: position = -138 score = 4.14677 sequence = TTATGTGAGCTAGCTTGTATTT Gene: Shew_3758: histidine utilization repressor |
*
Shewanella pealeana ATCC 700345 Site: position = -106 score = 3.80517 sequence = ATTTGTGAGCTAGCTTGTGTTT Gene: Spea_4170: histidine utilization repressor |
*
Shewanella halifaxensis HAW-EB4 Site: position = -106 score = 3.94642 sequence = ATTTGTGAGCCCGCTTGTATTT Gene: Shal_0072: histidine utilization repressor |
*
Shewanella piezotolerans WP3 Site: position = -177 score = 4.16261 sequence = ATTTGTGAGCTAGCTTGTATTT Gene: swp_0132: histidine utilization repressor |
*
Shewanella sediminis HAW-EB3 Site: position = -150 score = 4.06614 sequence = AGTTGTGATCCAACTTGTATTT Gene: Ssed_4448: histidine utilization repressor |
*
Shewanella woodyi ATCC 51908 Site: position = -201 score = 4.13634 sequence = AAGTGTGATCCAACTTGTATTT Gene: Swoo_4839: histidine utilization repressor |
histidine utilization repressor |
| hutU |
Gene: SO0097: urocanate hydratase (EC 4.2.1.49) |
Gene: Sputcn32_0079: urocanate hydratase (EC 4.2.1.49) |
Gene: Sputw3181_3998: urocanate hydratase (EC 4.2.1.49) |
Gene: Shewana3_0100: urocanate hydratase (EC 4.2.1.49) |
Gene: Shewmr4_0099: urocanate hydratase (EC 4.2.1.49) |
Gene: Shewmr7_0094: urocanate hydratase (EC 4.2.1.49) |
Gene: Sbal_4252: urocanate hydratase (EC 4.2.1.49) |
Gene: Sden_0083: urocanate hydratase (EC 4.2.1.49) |
Gene: Sfri_3953: urocanate hydratase (EC 4.2.1.49) |
Gene: Sama_1632: urocanate hydratase (EC 4.2.1.49) |
Gene: Shew_3757: urocanate hydratase (EC 4.2.1.49) |
Gene: Spea_4169: urocanate hydratase (EC 4.2.1.49) |
Gene: Shal_0073: urocanate hydratase (EC 4.2.1.49) |
Gene: swp_0133: urocanate hydratase (EC 4.2.1.49) |
Gene: Ssed_4447: urocanate hydratase (EC 4.2.1.49) |
Gene: Swoo_4838: urocanate hydratase (EC 4.2.1.49) |
urocanate hydratase (EC 4.2.1.49) |
| hutH |
Gene: SO0098: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Sputcn32_0080: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Sputw3181_3997: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Shewana3_0101: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Shewmr4_0100: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Shewmr7_0095: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Sbal_4251: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Sden_0084: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Sfri_3952: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Sama_1631: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Shew_3756: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Spea_4168: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Shal_0074: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: swp_0134: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Ssed_4446: histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Swoo_4837: histidine ammonia-lyase (EC 4.3.1.3) |
histidine ammonia-lyase (EC 4.3.1.3) |
| CRON 28. | |||||||||||||||||
| yfiA-2 |
*
Shewanella oneidensis MR-1 Site: position = -78 score = 4.65624 sequence = AAGTGTGATTTAACTCTCGTTT Gene: SO3422: Ribosome hibernation protein YfiA |
*
Shewanella putrefaciens CN-32 Site: position = -77 score = 5.05406 sequence = TTTTGTGATTTAGATCTCGTTT Gene: Sputcn32_2740: Ribosome hibernation protein YfiA |
*
Shewanella sp W3-18-1 Site: position = -77 score = 5.05406 sequence = TTTTGTGATTTAGATCTCGTTT Gene: Sputw3181_1272: Ribosome hibernation protein YfiA |
*
Shewanella sp ANA-3 Site: position = -78 score = 5.07423 sequence = AAATGTGATTTAGATCTCGTTT Gene: Shewana3_1133: Ribosome hibernation protein YfiA |
*
Shewanella sp MR-4 Site: position = -78 score = 5.07423 sequence = AAATGTGATTTAGATCTCGTTT Gene: Shewmr4_1132: Ribosome hibernation protein YfiA |
*
Shewanella sp MR-7 Site: position = -78 score = 5.07423 sequence = AAATGTGATTTAGATCTCGTTT Gene: Shewmr7_1203: Ribosome hibernation protein YfiA |
*
Shewanella baltica OS155 Site: position = -77 score = 5.17724 sequence = AAATGTGATCTAGATCTCGTTT Gene: Sbal_1221: Ribosome hibernation protein YfiA |
*
Shewanella denitrificans OS217 Site: position = -77 score = 4.75052 sequence = AAGTGTGACTTTGATCACGCTT Site: position = -38 score = 4.14028 sequence = TAATCTGAAGTTAAGCACATAA Gene: Sden_2746: Ribosome hibernation protein YfiA |
*
Shewanella frigidimarina NCIMB 400 Site: position = -77 score = 5.02355 sequence = AAGTGTGATGCAGATCACTATT Gene: Sfri_2912: Ribosome hibernation protein YfiA |
*
Shewanella amazonensis SB2B Site: position = -78 score = 4.31728 sequence = AAACGTGATTTTACTCACGACT Gene: Sama_0899: Ribosome hibernation protein YfiA |
*
Shewanella loihica PV-4 Site: position = -76 score = 4.56203 sequence = AAAGTTGATCTAGATCACGTTT Gene: Shew_1073: Ribosome hibernation protein YfiA |
*
Shewanella pealeana ATCC 700345 Site: position = -76 score = 4.6428 sequence = AAACGTGATTTAGATCACGACT Gene: Spea_1060: Ribosome hibernation protein YfiA |
*2
Shewanella halifaxensis HAW-EB4 Site: position = -83 score = 4.63076 sequence = AAACATGACCTAGATCACACTA Site: position = -58 score = 3.78531 sequence = TAATGTGATTGGACTATTGTAA Gene: Shal_4284: Ribosome hibernation protein YfiA Site: position = -76 score = 4.6428 sequence = AAACGTGATTTAGATCACGACT Gene: Shal_1108: Ribosome hibernation protein YfiA |
*
Shewanella piezotolerans WP3 Site: position = -76 score = 4.6428 sequence = AAACGTGATTTAGATCACGACT Gene: swp_3757: Ribosome hibernation protein YfiA |
*
Shewanella sediminis HAW-EB3 Site: position = -222 score = 3.83618 sequence = TTTTGAGAGGCAAATAAAAAAA Site: position = -76 score = 4.6428 sequence = AAACGTGATTTAGATCACGACT Gene: Ssed_1169: Ribosome hibernation protein YfiA |
*
Shewanella woodyi ATCC 51908 Site: position = -76 score = 4.50549 sequence = AAACGTGATCAAGATCACGACT Gene: Swoo_1264: Ribosome hibernation protein YfiA |
Ribosome hibernation protein YfiA |
| CRON 29. | |||||||||||||||||
| fahA |
*
Shewanella oneidensis MR-1 Site: position = -200 score = 5.1279 sequence = AAATGTGATTTTGTTCACGCTA Gene: SO1670: Fumarylacetoacetate hydrolase family protein |
*
Shewanella putrefaciens CN-32 Site: position = -229 score = 4.9676 sequence = AAATGTGATTTGTGTCACGCTA Gene: Sputcn32_1389: Fumarylacetoacetate hydrolase family protein |
*
Shewanella sp W3-18-1 Site: position = -229 score = 4.9676 sequence = AAATGTGATTTGTGTCACGCTA Gene: Sputw3181_2712: Fumarylacetoacetate hydrolase family protein |
*
Shewanella sp ANA-3 Site: position = -197 score = 5.08159 sequence = AAATGTGATTTTGCTCACGCTA Gene: Shewana3_2778: Fumarylacetoacetate hydrolase family protein |
*
Shewanella sp MR-4 Site: position = -196 score = 5.08159 sequence = AAATGTGATTTTGCTCACGCTA Gene: Shewmr4_2604: Fumarylacetoacetate hydrolase family protein |
*
Shewanella sp MR-7 Site: position = -196 score = 5.08159 sequence = AAATGTGATTTTGCTCACGCTA Gene: Shewmr7_2671: Fumarylacetoacetate hydrolase family protein |
*
Shewanella baltica OS155 Site: position = -235 score = 4.96603 sequence = AAATGTGATTTTGGTCACGCTA Gene: Sbal_1487: Fumarylacetoacetate hydrolase family protein |
*
Shewanella denitrificans OS217 Site: position = -107 score = 4.65138 sequence = AAATGTGATTTTGCGCACGCTA Gene: Sden_2592: Fumarylacetoacetate hydrolase family protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -116 score = 4.13475 sequence = AAATGTGATTTGGTACTTACTA Gene: Sfri_1331: Fumarylacetoacetate hydrolase family protein |
*
Shewanella amazonensis SB2B Site: position = -111 score = 4.95014 sequence = AATTGTGATTTGAGTCACGCTA Gene: Sama_2219: Fumarylacetoacetate hydrolase family protein |
*
Shewanella loihica PV-4 Site: position = -130 score = 4.38301 sequence = GAGTGTGATTTGTATCACGCTA Gene: Shew_1438: Fumarylacetoacetate hydrolase family protein |
*
Shewanella pealeana ATCC 700345 Site: position = -158 score = 5.26583 sequence = AAGTGTGATTTCGTTCACACTA Gene: Spea_1451: Fumarylacetoacetate hydrolase family protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -144 score = 4.54594 sequence = CAGTGTGATTTATCTCACGCTA Gene: Shal_1534: Fumarylacetoacetate hydrolase family protein |
*
Shewanella piezotolerans WP3 Site: position = -140 score = 4.9957 sequence = TAGTGTGATTTAGCTCACGCTA Gene: swp_1653: Fumarylacetoacetate hydrolase family protein |
*
Shewanella sediminis HAW-EB3 Site: position = -116 score = 4.14612 sequence = GAGCGTGATTCATGTCACACTA Gene: Ssed_2927: Fumarylacetoacetate hydrolase family protein |
*
Shewanella woodyi ATCC 51908 Site: position = -133 score = 4.9966 sequence = TATTGTGATTTGTGTCACGCTA Gene: Swoo_1718: Fumarylacetoacetate hydrolase family protein |
Fumarylacetoacetate hydrolase family protein |
| maiA |
Gene: SO1671: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Sputcn32_1390: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Sputw3181_2711: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Shewana3_2777: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Shewmr4_2603: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Shewmr7_2670: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Sbal_1488: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Sden_2591: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Sfri_1332: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Sama_2218: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Shew_1439: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Spea_1452: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Shal_1535: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: swp_1654: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Ssed_2926: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Gene: Swoo_1719: Maleylacetoacetate isomerase (EC 5.2.1.2) |
Maleylacetoacetate isomerase (EC 5.2.1.2) |
| CRON 30. | |||||||||||||||||
| purH |
*
Shewanella oneidensis MR-1 Site: position = -180 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: SO0442: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella putrefaciens CN-32 Site: position = -193 score = 3.99458 sequence = TATTGTGAAATCACGCAGAAAA Gene: Sputcn32_3401: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella sp W3-18-1 Site: position = -193 score = 3.99458 sequence = TATTGTGAAATCACGCAGAAAA Gene: Sputw3181_0542: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella sp ANA-3 Site: position = -181 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: Shewana3_0441: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella sp MR-4 Site: position = -181 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: Shewmr4_0445: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella sp MR-7 Site: position = -181 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: Shewmr7_3584: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella baltica OS155 Site: position = -195 score = 3.99458 sequence = TATTGTGAAATCACGCAGAAAA Gene: Sbal_0420: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
Gene: Sden_3407: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -195 score = 3.89434 sequence = TATTGTGAAATCACACAGAAAA Gene: Sfri_0493: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella amazonensis SB2B Site: position = -194 score = 3.99458 sequence = TATTGTGAAATCACGCAGAAAA Gene: Sama_0395: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella loihica PV-4 Site: position = -182 score = 4.00632 sequence = TATTGTGAAATCGCACAGAAAA Gene: Shew_3412: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella pealeana ATCC 700345 Site: position = -181 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: Spea_0432: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -182 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: Shal_0488: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella piezotolerans WP3 Site: position = -181 score = 4.10656 sequence = TATTGTGAAATCGCGCAGAAAA Gene: swp_4724: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella sediminis HAW-EB3 Site: position = -282 score = 4.04029 sequence = GAGTGTGACGCTCTGCACAAAT Site: position = -191 score = 4.15287 sequence = TATTGTGAAATCGTGCAGAAAA Gene: Ssed_0444: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
*
Shewanella woodyi ATCC 51908 Site: position = -192 score = 3.55881 sequence = TATTGTGAAATCACATATAAAT Gene: Swoo_0296: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) |
| purD |
Gene: SO0441: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Sputcn32_3402: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Sputw3181_0541: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Shewana3_0440: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Shewmr4_0444: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Shewmr7_3585: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Sbal_0419: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Sden_3406: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Sfri_0492: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Sama_0394: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Shew_3413: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Spea_0431: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Shal_0487: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: swp_4725: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Ssed_0443: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Gene: Swoo_0295: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
Phosphoribosylamine--glycine ligase (EC 6.3.4.13) |
| CRON 31. | |||||||||||||||||
| SO1328 |
*
Shewanella oneidensis MR-1 Site: position = -109 score = 3.99519 sequence = AAAATCGATTTTGCTCACACAA Gene: SO1328: transcriptional regulator, LysR family |
*
Shewanella putrefaciens CN-32 Site: position = -109 score = 3.84964 sequence = AATGGCGATTCTGCTCACACTC Gene: Sputcn32_1139: transcriptional regulator, LysR family |
*
Shewanella sp W3-18-1 Site: position = -109 score = 3.92332 sequence = AATGGCGATTCGGCTCACACTC Gene: Sputw3181_3025: transcriptional regulator, LysR family |
*
Shewanella sp ANA-3 Site: position = -109 score = 3.89004 sequence = AAAATCGATTTTGCTCACAGTA Gene: Shewana3_3046: transcriptional regulator, LysR family |
*
Shewanella sp MR-4 Site: position = -109 score = 3.99519 sequence = AAAATCGATTTTGCTCACACTA Gene: Shewmr4_2868: transcriptional regulator, LysR family |
*
Shewanella sp MR-7 Site: position = -109 score = 3.99519 sequence = AAAATCGATTTTGCTCACACAA Gene: Shewmr7_2950: transcriptional regulator, LysR family |
Gene: Sbal_1181: transcriptional regulator, LysR family |
Gene: Sden_2788: transcriptional regulator, LysR family |
Gene: Sfri_2948: transcriptional regulator, LysR family |
Gene: Sama_0860: transcriptional regulator, LysR family |
*
Shewanella loihica PV-4 Site: position = -110 score = 3.79618 sequence = TTTTGGGCAGCGCTTCACACTT Gene: Shew_1035: transcriptional regulator, LysR family |
*
Shewanella pealeana ATCC 700345 Site: position = -89 score = 4.81238 sequence = ATTTTTGATTCAGTTCACAAAC Gene: Spea_1016: transcriptional regulator, LysR family |
*
Shewanella halifaxensis HAW-EB4 Site: position = -89 score = 4.59212 sequence = ATTTTTGATTCAGTTCACAGTC Gene: Shal_1064: transcriptional regulator, LysR family |
Gene: swp_3799: transcriptional regulator, LysR family |
Gene: Ssed_1129: transcriptional regulator, LysR family |
*
Shewanella woodyi ATCC 51908 Site: position = -111 score = 4.29044 sequence = ATTTTAGAGATAGCTCACATTT Gene: Swoo_1224: transcriptional regulator, LysR family |
transcriptional regulator, LysR family |
| CRON 32. | |||||||||||||||||
| SO1389 |
*
Shewanella oneidensis MR-1 Site: position = -150 score = 3.77881 sequence = AACTGTTAGCTTTATCACTCAA Gene: SO1389: ROK family protein, in a cluster with chitinase |
Gene: Sputcn32_1199: ROK family protein, in a cluster with chitinase |
Gene: Sputw3181_2965: ROK family protein, in a cluster with chitinase |
*
Shewanella sp ANA-3 Site: position = -150 score = 4.19521 sequence = AAATGTTATCTTTATCACTCAG Gene: Shewana3_2985: ROK family protein, in a cluster with chitinase |
*
Shewanella sp MR-4 Site: position = -150 score = 4.19521 sequence = AAATGTTATCTTTATCACTCAG Gene: Shewmr4_2806: ROK family protein, in a cluster with chitinase |
*
Shewanella sp MR-7 Site: position = -150 score = 4.50488 sequence = AAATGTTATCTTTATCACTCAA Gene: Shewmr7_2889: ROK family protein, in a cluster with chitinase |
*
Shewanella baltica OS155 Site: position = -180 score = 4.37027 sequence = TTGTGTGATTCTTAGCATAAAA Gene: Sbal_3084: ROK family protein, in a cluster with chitinase |
|
|
Gene: Sama_0686: ROK family protein, in a cluster with chitinase |
Gene: Shew_0954: ROK family protein, in a cluster with chitinase |
|
|
Gene: swp_4198: ROK family protein, in a cluster with chitinase |
Gene: Ssed_1026: ROK family protein, in a cluster with chitinase |
Gene: Swoo_1098: ROK family protein, in a cluster with chitinase |
ROK family protein, in a cluster with chitinase |
| CRON 33. | |||||||||||||||||
| ilvC |
*
Shewanella oneidensis MR-1 Site: position = -86 score = 4.04611 sequence = TATAGTGACTTCAATCACAACC Gene: SO4349: Ketol-acid reductoisomerase (EC 1.1.1.86) |
*
Shewanella putrefaciens CN-32 Site: position = -86 score = 4.30275 sequence = TATAGTGATTTCAATCACAACC Gene: Sputcn32_3615: Ketol-acid reductoisomerase (EC 1.1.1.86) |
*
Shewanella sp W3-18-1 Site: position = -86 score = 4.30275 sequence = TATAGTGATTTCAATCACAACC Gene: Sputw3181_3755: Ketol-acid reductoisomerase (EC 1.1.1.86) |
*
Shewanella sp ANA-3 Site: position = -86 score = 4.30275 sequence = TATAGTGATTTCAATCACAACC Gene: Shewana3_0355: Ketol-acid reductoisomerase (EC 1.1.1.86) |
*
Shewanella sp MR-4 Site: position = -86 score = 4.30275 sequence = TATAGTGATTTCAATCACAACC Gene: Shewmr4_0361: Ketol-acid reductoisomerase (EC 1.1.1.86) |
*
Shewanella sp MR-7 Site: position = -86 score = 4.30275 sequence = TATAGTGATTTCAATCACAACC Gene: Shewmr7_3665: Ketol-acid reductoisomerase (EC 1.1.1.86) |
*
Shewanella baltica OS155 Site: position = -85 score = 4.30275 sequence = TATAGTGATTTCAATCACAACC Gene: Sbal_4032: Ketol-acid reductoisomerase (EC 1.1.1.86) |
Gene: Sden_3415: Ketol-acid reductoisomerase (EC 1.1.1.86) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -85 score = 4.07903 sequence = TATAGTGACTTCAATCACAACG Gene: Sfri_0421: Ketol-acid reductoisomerase (EC 1.1.1.86) |
*
Shewanella amazonensis SB2B Site: position = -88 score = 4.41971 sequence = TATAGTGAGTTCAATCACAATC Gene: Sama_3282: Ketol-acid reductoisomerase (EC 1.1.1.86) |
*
Shewanella loihica PV-4 Site: position = -77 score = 3.80381 sequence = ATAGTTGATCTCATTCACAGCT Site: position = -126 score = 3.74563 sequence = CAATGTGACGTTTCGAATATAT Gene: Shew_0288: Ketol-acid reductoisomerase (EC 1.1.1.86) |
Gene: Spea_0344: Ketol-acid reductoisomerase (EC 1.1.1.86) |
Gene: Shal_3945: Ketol-acid reductoisomerase (EC 1.1.1.86) |
*
Shewanella piezotolerans WP3 Site: position = -77 score = 4.55657 sequence = TATAGTGATCTCAATCACAGCT Gene: swp_0358: Ketol-acid reductoisomerase (EC 1.1.1.86) |
*
Shewanella sediminis HAW-EB3 Site: position = -78 score = 4.0039 sequence = TATAGTGATCTCAATCACTGCT Gene: Ssed_4166: Ketol-acid reductoisomerase (EC 1.1.1.86) |
*
Shewanella woodyi ATCC 51908 Site: position = -78 score = 3.49429 sequence = TATAGTGAATTCAATCACTGCT Gene: Swoo_0441: Ketol-acid reductoisomerase (EC 1.1.1.86) |
Ketol-acid reductoisomerase (EC 1.1.1.86) |
| CRON 34. | |||||||||||||||||
| SO3090 |
*
Shewanella oneidensis MR-1 Site: position = -165 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: SO3090: MoxR-like ATPase in aerotolerance operon |
*
Shewanella putrefaciens CN-32 Site: position = -97 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Sputcn32_2461: MoxR-like ATPase in aerotolerance operon |
*
Shewanella sp W3-18-1 Site: position = -97 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Sputw3181_1547: MoxR-like ATPase in aerotolerance operon |
*
Shewanella sp ANA-3 Site: position = -160 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Shewana3_1459: MoxR-like ATPase in aerotolerance operon |
*
Shewanella sp MR-4 Site: position = -160 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Shewmr4_1406: MoxR-like ATPase in aerotolerance operon |
*
Shewanella sp MR-7 Site: position = -160 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Shewmr7_1471: MoxR-like ATPase in aerotolerance operon |
*
Shewanella baltica OS155 Site: position = -148 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Sbal_2762: MoxR-like ATPase in aerotolerance operon |
*
Shewanella denitrificans OS217 Site: position = -157 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Sden_1528: MoxR-like ATPase in aerotolerance operon |
*
Shewanella frigidimarina NCIMB 400 Site: position = -167 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Sfri_2678: MoxR-like ATPase in aerotolerance operon |
*
Shewanella amazonensis SB2B Site: position = -137 score = 4.23195 sequence = AAGTGTGACCCGATTCTAACTT Gene: Sama_2169: MoxR-like ATPase in aerotolerance operon |
*
Shewanella loihica PV-4 Site: position = -296 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Shew_2427: MoxR-like ATPase in aerotolerance operon |
*
Shewanella pealeana ATCC 700345 Site: position = -306 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Spea_2600: MoxR-like ATPase in aerotolerance operon |
*
Shewanella halifaxensis HAW-EB4 Site: position = -319 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Shal_2672: MoxR-like ATPase in aerotolerance operon |
*
Shewanella piezotolerans WP3 Site: position = -97 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: swp_3141: MoxR-like ATPase in aerotolerance operon |
*
Shewanella sediminis HAW-EB3 Site: position = -316 score = 4.57773 sequence = AAGTGTGATCTGATTCTAACTT Gene: Ssed_1627: MoxR-like ATPase in aerotolerance operon |
*
Shewanella woodyi ATCC 51908 Site: position = -306 score = 4.78219 sequence = AAATGTGATCTGATTCTAACTT Gene: Swoo_3028: MoxR-like ATPase in aerotolerance operon |
MoxR-like ATPase in aerotolerance operon |
| SO3091 |
Gene: SO3091: Conserved hypothetical protein |
Gene: Sputcn32_2462: Conserved hypothetical protein |
Gene: Sputw3181_1546: Conserved hypothetical protein |
Gene: Shewana3_1458: Conserved hypothetical protein |
Gene: Shewmr4_1405: Conserved hypothetical protein |
Gene: Shewmr7_1470: Conserved hypothetical protein |
Gene: Sbal_2763: Conserved hypothetical protein |
Gene: Sden_1527: Conserved hypothetical protein |
Gene: Sfri_2679: Conserved hypothetical protein |
Gene: Sama_2170: Conserved hypothetical protein |
Gene: Shew_2428: Conserved hypothetical protein |
Gene: Spea_2601: Conserved hypothetical protein |
Gene: Shal_2673: Conserved hypothetical protein |
Gene: swp_3143: Conserved hypothetical protein |
Gene: Ssed_1626: Conserved hypothetical protein |
Gene: Swoo_3029: Conserved hypothetical protein |
Conserved hypothetical protein |
| SO3092 |
Gene: SO3092: hypothetical protein |
Gene: Sputcn32_2463: hypothetical protein |
Gene: Sputw3181_1545: hypothetical protein |
Gene: Shewana3_1457: hypothetical protein |
Gene: Shewmr4_1404: hypothetical protein |
Gene: Shewmr7_1469: hypothetical protein |
Gene: Sbal_2764: hypothetical protein |
Gene: Sden_1526: hypothetical protein |
Gene: Sfri_2680: hypothetical protein |
Gene: Sama_2171: hypothetical protein |
Gene: Shew_2429: hypothetical protein |
Gene: Spea_2602: hypothetical protein |
Gene: Shal_2674: hypothetical protein |
Gene: swp_3144: hypothetical protein |
Gene: Ssed_1625: hypothetical protein |
Gene: Swoo_3030: hypothetical protein |
hypothetical protein |
| SO3093 |
Gene: SO3093: von Willebrand factor type A domain protein |
Gene: Sputcn32_2464: von Willebrand factor type A domain protein |
Gene: Sputw3181_1544: von Willebrand factor type A domain protein |
Gene: Shewana3_1456: von Willebrand factor type A domain protein |
Gene: Shewmr4_1403: von Willebrand factor type A domain protein |
Gene: Shewmr7_1468: von Willebrand factor type A domain protein |
Gene: Sbal_2765: von Willebrand factor type A domain protein |
Gene: Sden_1525: von Willebrand factor type A domain protein |
Gene: Sfri_2681: von Willebrand factor type A domain protein |
Gene: Sama_2172: von Willebrand factor type A domain protein |
Gene: Shew_2430: von Willebrand factor type A domain protein |
Gene: Spea_2603: von Willebrand factor type A domain protein |
Gene: Shal_2675: von Willebrand factor type A domain protein |
Gene: swp_3145: von Willebrand factor type A domain protein |
Gene: Ssed_1624: von Willebrand factor type A domain protein |
Gene: Swoo_3031: von Willebrand factor type A domain protein |
von Willebrand factor type A domain protein |
| SO3094 |
Gene: SO3094: TPR domain protein in aerotolerance operon |
Gene: Sputcn32_2465: TPR domain protein in aerotolerance operon |
Gene: Sputw3181_1543: TPR domain protein in aerotolerance operon |
Gene: Shewana3_1455: TPR domain protein in aerotolerance operon |
Gene: Shewmr4_1402: TPR domain protein in aerotolerance operon |
Gene: Shewmr7_1467: TPR domain protein in aerotolerance operon |
Gene: Sbal_2766: TPR domain protein in aerotolerance operon |
Gene: Sden_1524: TPR domain protein in aerotolerance operon |
Gene: Sfri_2682: TPR domain protein in aerotolerance operon |
Gene: Sama_2173: TPR domain protein in aerotolerance operon |
Gene: Shew_2431: TPR domain protein in aerotolerance operon |
Gene: Spea_2604: TPR domain protein in aerotolerance operon |
Gene: Shal_2676: TPR domain protein in aerotolerance operon |
Gene: swp_3146: TPR domain protein in aerotolerance operon |
Gene: Ssed_1623: TPR domain protein in aerotolerance operon |
Gene: Swoo_3032: TPR domain protein in aerotolerance operon |
TPR domain protein in aerotolerance operon |
| SO3095 |
Gene: SO3095: hypothetical protein |
Gene: Sputcn32_2466: hypothetical protein |
Gene: Sputw3181_1542: hypothetical protein |
Gene: Shewana3_1454: hypothetical protein |
Gene: Shewmr4_1401: hypothetical protein |
Gene: Shewmr7_1466: hypothetical protein |
Gene: Sbal_2767: hypothetical protein |
Gene: Sden_1523: hypothetical protein |
Gene: Sfri_2683: hypothetical protein |
Gene: Sama_2174: hypothetical protein |
Gene: Shew_2432: hypothetical protein |
Gene: Spea_2605: hypothetical protein |
Gene: Shal_2677: hypothetical protein |
Gene: swp_3148: hypothetical protein |
Gene: Ssed_1622: hypothetical protein |
Gene: Swoo_3033: hypothetical protein |
hypothetical protein |
| CRON 35. | |||||||||||||||||
| crp |
*
Shewanella oneidensis MR-1 Site: position = -174 score = 3.54123 sequence = TTAGTTGACTAATATCACTAAA Gene: SO0624: Cyclic AMP receptor protein Crp |
*
Shewanella putrefaciens CN-32 Site: position = -174 score = 3.54123 sequence = TTAGTTGACTAATATCACTAAA Gene: Sputcn32_0652: Cyclic AMP receptor protein Crp |
*
Shewanella sp W3-18-1 Site: position = -174 score = 3.54123 sequence = TTAGTTGACTAATATCACTAAA Gene: Sputw3181_3522: Cyclic AMP receptor protein Crp |
*
Shewanella sp ANA-3 Site: position = -174 score = 3.54123 sequence = TTAGTTGACTAATATCACTAAA Gene: Shewana3_0617: Cyclic AMP receptor protein Crp |
*
Shewanella sp MR-4 Site: position = -174 score = 3.54123 sequence = TTAGTTGACTAATATCACTAAA Gene: Shewmr4_0618: Cyclic AMP receptor protein Crp |
*
Shewanella sp MR-7 Site: position = -174 score = 3.54123 sequence = TTAGTTGACTAATATCACTAAA Gene: Shewmr7_3412: Cyclic AMP receptor protein Crp |
*
Shewanella baltica OS155 Site: position = -174 score = 3.74166 sequence = TTAGTTGACTTAAATCACTAAA Gene: Sbal_0578: Cyclic AMP receptor protein Crp |
*
Shewanella denitrificans OS217 Site: position = -94 score = 3.5727 sequence = AAACACGATCTTGGTCAAAGTT Gene: Sden_3190: Cyclic AMP receptor protein Crp |
*
Shewanella frigidimarina NCIMB 400 Site: position = -97 score = 4.02903 sequence = AAATACGATCTCTATCAAAGTT Gene: Sfri_3292: Cyclic AMP receptor protein Crp |
*
Shewanella amazonensis SB2B Site: position = -96 score = 3.77298 sequence = AATTTCGATCTGCATCATGGTT Gene: Sama_3004: Cyclic AMP receptor protein Crp |
*
Shewanella loihica PV-4 Site: position = -238 score = 4.04133 sequence = AGATGTGATATGGGCAACATTG Gene: Shew_0585: Cyclic AMP receptor protein Crp |
*
Shewanella pealeana ATCC 700345 Site: position = -225 score = 3.58749 sequence = AGATGTGATATAAGCCTAATTG Gene: Spea_3509: Cyclic AMP receptor protein Crp |
*
Shewanella halifaxensis HAW-EB4 Site: position = -226 score = 3.49835 sequence = AGATGTGATACAAGCCTAATTG Gene: Shal_3603: Cyclic AMP receptor protein Crp |
*
Shewanella piezotolerans WP3 Site: position = -309 score = 4.17988 sequence = TTTATTGATAAGGTTCAAAAAA Gene: swp_0755: Cyclic AMP receptor protein Crp |
*
Shewanella sediminis HAW-EB3 Site: position = -173 score = 3.81001 sequence = TTAGTTGACTTATATCACTAAT Gene: Ssed_3873: Cyclic AMP receptor protein Crp |
*
Shewanella woodyi ATCC 51908 Site: position = -173 score = 3.81001 sequence = TTAGTTGACTTATATCACTAAT Gene: Swoo_0662: Cyclic AMP receptor protein Crp |
Cyclic AMP receptor protein Crp |
| CRON 36. | |||||||||||||||||
| SO2858 |
*
Shewanella oneidensis MR-1 Site: position = -105 score = 4.82761 sequence = TATTGTGAGTAAGTTCGCAAAT Gene: SO2858: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -75 score = 4.21636 sequence = AGTCGTGATTGTGCTCACACCA Gene: Sputcn32_2359: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -75 score = 4.21636 sequence = AGTCGTGATTGTGCTCACACCA Gene: Sputw3181_1650: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -105 score = 4.03554 sequence = GGATGTGAGCCGCTTCGCAAAT Gene: Shewana3_1574: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -105 score = 3.93606 sequence = CCGTGTGAGGTATTTCGCAAAT Gene: Shewmr4_1513: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -105 score = 3.93606 sequence = CCGTGTGAGGTATTTCGCAAAT Gene: Shewmr7_1580: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -75 score = 4.21636 sequence = AGTCGTGATTGTGCTCACACCA Gene: Sbal_2639: hypothetical protein |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -237 score = 4.94252 sequence = TTTTGTGATGCAGATCTCAATC Gene: Sfri_1546: hypothetical protein |
Gene: Sama_1522: hypothetical protein |
Gene: Shew_2372: hypothetical protein |
Gene: Spea_1695: hypothetical protein |
Gene: Shal_2566: hypothetical protein |
Gene: swp_1973: hypothetical protein |
Gene: Ssed_1745: hypothetical protein |
Gene: Swoo_2839: hypothetical protein |
hypothetical protein |
| SO2857 |
Gene: SO2857: sodium solute symporter family protein |
Gene: Sputcn32_2358: sodium solute symporter family protein |
Gene: Sputw3181_1651: sodium solute symporter family protein |
Gene: Shewana3_1575: sodium solute symporter family protein |
Gene: Shewmr4_1514: sodium solute symporter family protein |
Gene: Shewmr7_1581: sodium solute symporter family protein |
Gene: Sbal_2638: sodium solute symporter family protein |
|
Gene: Sfri_1547: sodium solute symporter family protein |
Gene: Sama_1523: sodium solute symporter family protein |
Gene: Shew_2371: sodium solute symporter family protein |
Gene: Spea_1696: sodium solute symporter family protein |
Gene: Shal_2565: sodium solute symporter family protein |
Gene: swp_1974: sodium solute symporter family protein |
Gene: Ssed_1746: sodium solute symporter family protein |
Gene: Swoo_2838: sodium solute symporter family protein |
sodium solute symporter family protein |
| SO2856 |
Gene: SO2856: predicted signal-transduction protein containing cAMP-binding and CBS domains |
Gene: Sputcn32_2357: predicted signal-transduction protein containing cAMP-binding and CBS domains |
Gene: Sputw3181_1652: predicted signal-transduction protein containing cAMP-binding and CBS domains |
Gene: Shewana3_1576: predicted signal-transduction protein containing cAMP-binding and CBS domains |
Gene: Shewmr4_1515: predicted signal-transduction protein containing cAMP-binding and CBS domains |
Gene: Shewmr7_1582: predicted signal-transduction protein containing cAMP-binding and CBS domains |
Gene: Sbal_2637: predicted signal-transduction protein containing cAMP-binding and CBS domains |
|
Gene: Sfri_1548: predicted signal-transduction protein containing cAMP-binding and CBS domains |
Gene: Sama_1524: predicted signal-transduction protein containing cAMP-binding and CBS domains |
Gene: Shew_2369: predicted signal-transduction protein containing cAMP-binding and CBS domains |
Gene: Spea_1697: predicted signal-transduction protein containing cAMP-binding and CBS domains |
Gene: Shal_2564: predicted signal-transduction protein containing cAMP-binding and CBS domains |
Gene: swp_1975: predicted signal-transduction protein containing cAMP-binding and CBS domains |
Gene: Ssed_1751: predicted signal-transduction protein containing cAMP-binding and CBS domains |
Gene: Swoo_2835: predicted signal-transduction protein containing cAMP-binding and CBS domains |
predicted signal-transduction protein containing cAMP-binding and CBS domains |
| SO2855 |
Gene: SO2855: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
Gene: Sputcn32_2356: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
Gene: Sputw3181_1653: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
Gene: Shewana3_1577: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
Gene: Shewmr4_1516: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
Gene: Shewmr7_1583: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
Gene: Sbal_2636: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
|
Gene: Sfri_1549: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
Gene: Sama_1525: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
Gene: Shew_2368: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
Gene: Spea_1698: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
Gene: Shal_2563: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
Gene: swp_1976: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
Gene: Ssed_1752: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
Gene: Swoo_2834: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
DNA polymerase III epsilon subunit (EC 2.7.7.7) |
| SO2854 |
Gene: SO2854: hypothetical protein |
|
|
Gene: Shewana3_1580: hypothetical protein |
Gene: Shewmr4_1519: hypothetical protein |
Gene: Shewmr7_1586: hypothetical protein |
Gene: Sbal_2635: hypothetical protein |
|
|
Gene: Sama_1526: hypothetical protein |
Gene: Shew_2367: hypothetical protein |
Gene: Spea_1699: hypothetical protein |
Gene: Shal_2560: hypothetical protein |
Gene: swp_1979: hypothetical protein |
Gene: Ssed_1755: hypothetical protein |
Gene: Swoo_2832: hypothetical protein |
hypothetical protein |
| CRON 37. | |||||||||||||||||
| SO4142 |
*
Shewanella oneidensis MR-1 Site: position = -121 score = 3.92872 sequence = GAAAGTGACACACCTCAAATAA Gene: SO4142: cytochrome c family protein |
|
|
*
Shewanella sp ANA-3 Site: position = -118 score = 4.18536 sequence = GAAAGTGATACACCTCAAATAA Gene: Shewana3_3688: cytochrome c family protein |
*
Shewanella sp MR-4 Site: position = -118 score = 4.18536 sequence = GAAAGTGATACACCTCAAATAA Gene: Shewmr4_3511: cytochrome c family protein |
*
Shewanella sp MR-7 Site: position = -122 score = 4.00757 sequence = GAAGGTGATACACCTCAAATAA Gene: Shewmr7_0441: cytochrome c family protein |
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -112 score = 4.02774 sequence = GGATATGATCTACTTCAAATTA Gene: Sfri_3554: cytochrome c family protein |
*
Shewanella amazonensis SB2B Site: position = -268 score = 3.8573 sequence = AAACGTCACATAGATCACACAC Gene: Sama_3178: cytochrome c family protein |
*
Shewanella loihica PV-4 Site: position = -113 score = 4.08943 sequence = GAAGGTGATCAACATCAAATTT Gene: Shew_0516: cytochrome c family protein |
|
*
Shewanella halifaxensis HAW-EB4 Site: position = -289 score = 3.78179 sequence = AAGTGTGATCTAGATCTGTTAC Gene: Shal_0616: cytochrome c family protein |
*
Shewanella piezotolerans WP3 Site: position = -133 score = 3.98105 sequence = GAAAGTGATCGAGCTCAACTAT Gene: swp_4577: cytochrome c family protein |
*
Shewanella sediminis HAW-EB3 Site: position = -112 score = 4.68668 sequence = AAAGGTGATCAACATCAAATTT Gene: Ssed_4058: cytochrome c family protein |
|
cytochrome c family protein |
| SO4143 |
Gene: SO4143: hypothetical protein |
|
|
Gene: Shewana3_3689: hypothetical protein |
Gene: Shewmr4_3512: hypothetical protein |
Gene: Shewmr7_0440: hypothetical protein |
|
|
Gene: Sfri_3555: hypothetical protein |
Gene: Sama_3179: hypothetical protein |
Gene: Shew_0515: hypothetical protein |
|
Gene: Shal_0615: hypothetical protein |
Gene: swp_4578: hypothetical protein |
Gene: Ssed_4059: hypothetical protein |
|
hypothetical protein |
| SO4144 |
Gene: SO4144: octaheme tetrathionate reductase |
|
|
Gene: Shewana3_3690: octaheme tetrathionate reductase |
Gene: Shewmr4_3513: octaheme tetrathionate reductase |
Gene: Shewmr7_0439: octaheme tetrathionate reductase |
|
|
Gene: Sfri_3556: octaheme tetrathionate reductase |
Gene: Sama_3180: octaheme tetrathionate reductase |
Gene: Shew_0514: octaheme tetrathionate reductase |
|
Gene: Shal_0614: octaheme tetrathionate reductase |
Gene: swp_4579: octaheme tetrathionate reductase |
Gene: Ssed_4060: octaheme tetrathionate reductase |
|
octaheme tetrathionate reductase |
| CRON 38. | |||||||||||||||||
| Sputcn32_0539 |
|
*
Shewanella putrefaciens CN-32 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Sputcn32_0539: mechanosensitive ion channel |
*
Shewanella sp W3-18-1 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Sputw3181_3633: mechanosensitive ion channel |
*
Shewanella sp ANA-3 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Shewana3_3684: mechanosensitive ion channel |
*
Shewanella sp MR-4 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Shewmr4_3509: mechanosensitive ion channel |
*
Shewanella sp MR-7 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Shewmr7_0443: mechanosensitive ion channel |
*
Shewanella baltica OS155 Site: position = -95 score = 4.50296 sequence = TTACATGATACGCTTCACACAT Gene: Sbal_3856: mechanosensitive ion channel |
|
Gene: Sfri_3406: mechanosensitive ion channel |
Gene: Sama_0408: mechanosensitive ion channel |
*
Shewanella loihica PV-4 Site: position = -144 score = 4.10197 sequence = TTGCTTGATATGCTTCACGCTA Gene: Shew_3394: mechanosensitive ion channel |
*
Shewanella pealeana ATCC 700345 Site: position = -138 score = 4.08475 sequence = AAGCTTGATCCTCTTCACGCTA Gene: Spea_0457: mechanosensitive ion channel |
*
Shewanella halifaxensis HAW-EB4 Site: position = -137 score = 3.96946 sequence = AAGCATGATCCCCTTCACGCTA Gene: Shal_0532: mechanosensitive ion channel |
Gene: swp_4706: mechanosensitive ion channel |
*
Shewanella sediminis HAW-EB3 Site: position = -154 score = 4.16207 sequence = ATTCATGATCCACTTCACCTAG Gene: Ssed_0457: mechanosensitive ion channel |
*
Shewanella woodyi ATCC 51908 Site: position = -127 score = 3.85254 sequence = ATTCATGATCCTCTTCACGCAG Gene: Swoo_4512: mechanosensitive ion channel |
mechanosensitive ion channel |
| SO4139 |
*
Shewanella oneidensis MR-1 Site: position = -162 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: SO4139: tetratricopeptide repeat family protein |
Gene: Sputcn32_0538: tetratricopeptide repeat family protein |
Gene: Sputw3181_3634: tetratricopeptide repeat family protein |
Gene: Shewana3_3685: tetratricopeptide repeat family protein |
Gene: Shewmr4_3510: tetratricopeptide repeat family protein |
Gene: Shewmr7_0442: tetratricopeptide repeat family protein |
Gene: Sbal_3857: tetratricopeptide repeat family protein |
|
|
|
Gene: Shew_2985: tetratricopeptide repeat family protein |
|
|
|
|
|
tetratricopeptide repeat family protein |
| CRON 39. | |||||||||||||||||
| icd |
*
Shewanella oneidensis MR-1 Site: position = -149 score = 4.6768 sequence = ATTCGTGATATTGCTCACTATT Gene: SO1538: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella putrefaciens CN-32 Site: position = -148 score = 4.71092 sequence = AATCGTGATATCGCTCACTATT Gene: Sputcn32_1286: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella sp W3-18-1 Site: position = -148 score = 4.71092 sequence = AATCGTGATATCGCTCACTATT Gene: Sputw3181_2820: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella sp ANA-3 Site: position = -149 score = 4.72598 sequence = AATCGTGATATTGCTCACTATT Gene: Shewana3_2890: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella sp MR-4 Site: position = -149 score = 4.72598 sequence = AATCGTGATATTGCTCACTATT Gene: Shewmr4_2720: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella sp MR-7 Site: position = -149 score = 4.72598 sequence = AATCGTGATATTGCTCACTATT Gene: Shewmr7_2791: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella baltica OS155 Site: position = -149 score = 4.72598 sequence = AATCGTGATATTGCTCACTATT Gene: Sbal_1368: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella denitrificans OS217 Site: position = -143 score = 3.76803 sequence = AAAAGGGATATTTCTCACTAAT Gene: Sden_2561: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -148 score = 4.68422 sequence = TAATGTGATAATACTCACTATT Gene: Sfri_2779: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella amazonensis SB2B Site: position = -89 score = 4.51181 sequence = AATCGAGACATAAATCACATAA Gene: Sama_2423: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella loihica PV-4 Site: position = -150 score = 4.351 sequence = AAACGTGAGATTGCTCACTATT Gene: Shew_2760: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella pealeana ATCC 700345 Site: position = -146 score = 4.22084 sequence = AAACGTGAGATCGCTCACTCTT Gene: Spea_2980: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -149 score = 4.351 sequence = AAACGTGAGATTGCTCACTATT Gene: Shal_3069: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella piezotolerans WP3 Site: position = -293 score = 4.62867 sequence = AAACGTGAGATTGCTCACCTTT Gene: swp_3606: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella sediminis HAW-EB3 Site: position = -151 score = 4.67738 sequence = AAATGTGAGATTGCTCACTATT Gene: Ssed_3318: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
*
Shewanella woodyi ATCC 51908 Site: position = -148 score = 4.26186 sequence = AAACGTGAGACTGCTCACTATT Gene: Swoo_3466: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
Isocitrate dehydrogenase [NAD] (EC 1.1.1.41) |
| CRON 40. | |||||||||||||||||
| SO2427 |
*
Shewanella oneidensis MR-1 Site: position = -319 score = 5.12428 sequence = AAGTGTGATTAAAATCACACTT Gene: SO2427: TonB-dependent receptor |
*
Shewanella putrefaciens CN-32 Site: position = -274 score = 4.02843 sequence = AAATGTTATTTTATTAACAGAG Site: position = -318 score = 5.67063 sequence = TAGTGTGATCTACATCACATAA Gene: Sputcn32_1940: TonB-dependent receptor |
*
Shewanella sp W3-18-1 Site: position = -318 score = 4.5504 sequence = GCGTGTGATCTATATCACATAA Gene: Sputw3181_2068: TonB-dependent receptor |
*
Shewanella sp ANA-3 Site: position = -276 score = 4.39394 sequence = AAATGTTATTTTCTTAACAGTT Site: position = -320 score = 5.24373 sequence = AAGTGTGACACACATCACATAT Gene: Shewana3_1958: TonB-dependent receptor |
*
Shewanella sp MR-4 Site: position = -275 score = 3.89706 sequence = AAATGTTATTTTATTAACAGCT Site: position = -319 score = 5.61222 sequence = AAATGTGATGTGCGTCACATTT Gene: Shewmr4_1903: TonB-dependent receptor |
*
Shewanella sp MR-7 Site: position = -319 score = 5.16364 sequence = AAGTGTGACGTGTGTCACATTT Site: position = -275 score = 4.33811 sequence = AAATGTTATTTTATTAACAGTA Gene: Shewmr7_2075: TonB-dependent receptor |
*
Shewanella baltica OS155 Site: position = -317 score = 5.12323 sequence = AAGCGTGATCTGTGTCACATTT Gene: Sbal_2044: TonB-dependent receptor |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -149 score = 5.04528 sequence = AAATGTGATGTTGTTCACATGT Site: position = -4 score = 4.14649 sequence = ATTCATGAGTTCAGTCACATTA Gene: Sfri_2416: TonB-dependent receptor |
*
Shewanella amazonensis SB2B Site: position = -301 score = 5.24601 sequence = AAGTGTGATGCACGTCACAAAA Site: position = -324 score = 3.80556 sequence = TTAATCGATATGGGTCACAGAA Gene: Sama_1838: TonB-dependent receptor |
*
Shewanella loihica PV-4 Site: position = -308 score = 5.09145 sequence = TTTTGTGATAATGGTCACACTT Gene: Shew_2074: TonB-dependent receptor |
|
*
Shewanella halifaxensis HAW-EB4 Site: position = -199 score = 4.10655 sequence = ACTTGTGCTGTTTGTCACAATG Site: position = -306 score = 5.46305 sequence = AATTGTGATGCGCGTCACAATT Gene: Shal_1923: TonB-dependent receptor |
*
Shewanella piezotolerans WP3 Site: position = -310 score = 4.66904 sequence = AAGCGTGACCTGTGTCACACTT Gene: swp_2362: TonB-dependent receptor |
*
Shewanella sediminis HAW-EB3 Site: position = -316 score = 4.61719 sequence = TTTCGTGACGCGCGTCACAGTT Gene: Ssed_2036: TonB-dependent receptor |
*
Shewanella woodyi ATCC 51908 Site: position = -321 score = 4.8704 sequence = TTCTGTGACCTGTGTCACAAAA Gene: Swoo_2565: TonB-dependent receptor |
TonB-dependent receptor |
| CRON 41. | |||||||||||||||||
| SO1388 |
*
Shewanella oneidensis MR-1 Site: position = -232 score = 4.12802 sequence = TTGAGTGATAAAGCTAACAGTT Gene: SO1388: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
Gene: Sputcn32_1198: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
Gene: Sputw3181_2966: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
*
Shewanella sp ANA-3 Site: position = -233 score = 4.15463 sequence = CTGAGTGATAAAGATAACATTT Gene: Shewana3_2986: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
*
Shewanella sp MR-4 Site: position = -233 score = 4.15463 sequence = CTGAGTGATAAAGATAACATTT Gene: Shewmr4_2807: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
*
Shewanella sp MR-7 Site: position = -233 score = 4.53228 sequence = TTGAGTGATAAAGATAACATTT Gene: Shewmr7_2890: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
*
Shewanella baltica OS155 Site: position = -234 score = 4.18258 sequence = TTTTATGCTAAGAATCACACAA Gene: Sbal_3085: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
*
Shewanella denitrificans OS217 Site: position = -161 score = 3.69078 sequence = TATTGTATACAATATCACGTTA Gene: Sden_0887: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
Gene: Sfri_3047: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
Gene: Sama_0684: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
Gene: Shew_0952: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
Gene: Spea_0920: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
Gene: Shal_0972: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
Gene: swp_4202: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
Gene: Ssed_1024: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
Gene: Swoo_1096: Xaa-Pro aminopeptidase (EC 3.4.11.9) |
Xaa-Pro aminopeptidase (EC 3.4.11.9) |
| CRON 42. | |||||||||||||||||
| napD |
*
Shewanella oneidensis MR-1 Site: position = -150 score = 3.89406 sequence = AACTTTGATCCCGATCGACTAT Site: position = -260 score = 3.931 sequence = TAATGTGATTGGTATAAACCTC Gene: SO0849: periplasmic nitrate reductase component NapD |
*
Shewanella putrefaciens CN-32 Site: position = -147 score = 3.89406 sequence = AACTTTGATCCCGATCGACTAT Gene: Sputcn32_3147: periplasmic nitrate reductase component NapD |
*
Shewanella sp W3-18-1 Site: position = -147 score = 3.89406 sequence = AACTTTGATCCCGATCGACTAT Gene: Sputw3181_0796: periplasmic nitrate reductase component NapD |
*
Shewanella sp ANA-3 Site: position = -149 score = 3.89406 sequence = AACTTTGATCCCGATCGACTAT Gene: Shewana3_3429: periplasmic nitrate reductase component NapD |
*
Shewanella sp MR-4 Site: position = -149 score = 3.89406 sequence = AACTTTGATCCCGATCGACTAT Gene: Shewmr4_0705: periplasmic nitrate reductase component NapD |
*
Shewanella sp MR-7 Site: position = -149 score = 3.89406 sequence = AACTTTGATCCCGATCGACTAT Gene: Shewmr7_3317: periplasmic nitrate reductase component NapD |
*
Shewanella baltica OS155 Site: position = -150 score = 3.98279 sequence = AACTTTGATCCGGATCGACTAT Gene: Sbal_3510: periplasmic nitrate reductase component NapD |
|
|
Gene: Sama_2982: periplasmic nitrate reductase component NapD |
*
Shewanella loihica PV-4 Site: position = -154 score = 3.77479 sequence = AACTTTGATCTCGATCTACAAA Gene: Shew_3205: periplasmic nitrate reductase component NapD |
*
Shewanella pealeana ATCC 700345 Site: position = -173 score = 4.2894 sequence = ATTTGTGAACTAGATCAACACT Gene: Spea_0624: periplasmic nitrate reductase component NapD |
*
Shewanella halifaxensis HAW-EB4 Site: position = -174 score = 4.1821 sequence = ATCTGTGAATCAGATCACCATG Gene: Shal_0716: periplasmic nitrate reductase component NapD |
Gene: swp_4456: periplasmic nitrate reductase component NapD |
*
Shewanella sediminis HAW-EB3 Site: position = -187 score = 4.11887 sequence = ATCTGAGACATAGGTCACACAT Gene: Ssed_3956: periplasmic nitrate reductase component NapD |
*
Shewanella woodyi ATCC 51908 Site: position = -179 score = 4.43727 sequence = AAATGTGAACTCCATCACGCAC Site: position = -155 score = 3.92295 sequence = AATATTGATCTTGATCGACTAA Gene: Swoo_4109: periplasmic nitrate reductase component NapD |
periplasmic nitrate reductase component NapD |
| napA |
Gene: SO0848: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
Gene: Sputcn32_3148: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
Gene: Sputw3181_0795: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
Gene: Shewana3_3430: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
Gene: Shewmr4_0704: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
Gene: Shewmr7_3318: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
Gene: Sbal_3511: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -142 score = 4.27412 sequence = AAATGTGACCTTGCACAACTAT Site: position = -166 score = 4.2351 sequence = AAATGAGATTTACATCACGCTG Gene: Sfri_0553: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
Gene: Sama_2983: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
Gene: Shew_3206: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
Gene: Spea_0623: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
Gene: Shal_0715: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
Gene: swp_4457: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
Gene: Ssed_3957: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
Gene: Swoo_4110: periplasmic nitrate reductase precursor (EC 1.7.99.4) |
periplasmic nitrate reductase precursor (EC 1.7.99.4) |
| napG |
Gene: SO0847: ferredoxin-type protein NapG (periplasmic nitrate reductase) |
Gene: Sputcn32_3149: ferredoxin-type protein NapG (periplasmic nitrate reductase) |
Gene: Sputw3181_0794: ferredoxin-type protein NapG (periplasmic nitrate reductase) |
Gene: Shewana3_3431: ferredoxin-type protein NapG (periplasmic nitrate reductase) |
Gene: Shewmr4_0703: ferredoxin-type protein NapG (periplasmic nitrate reductase) |
Gene: Shewmr7_3319: ferredoxin-type protein NapG (periplasmic nitrate reductase) |
|
|
|
Gene: Sama_2984: ferredoxin-type protein NapG (periplasmic nitrate reductase) |
Gene: Shew_3207: ferredoxin-type protein NapG (periplasmic nitrate reductase) |
Gene: Spea_0622: ferredoxin-type protein NapG (periplasmic nitrate reductase) |
Gene: Shal_0714: ferredoxin-type protein NapG (periplasmic nitrate reductase) |
|
Gene: Ssed_3958: ferredoxin-type protein NapG (periplasmic nitrate reductase) |
|
ferredoxin-type protein NapG (periplasmic nitrate reductase) |
| napH |
Gene: SO0846: polyferredoxin NapH (periplasmic nitrate reductase) |
Gene: Sputcn32_3150: polyferredoxin NapH (periplasmic nitrate reductase) |
Gene: Sputw3181_0793: polyferredoxin NapH (periplasmic nitrate reductase) |
Gene: Shewana3_3432: polyferredoxin NapH (periplasmic nitrate reductase) |
Gene: Shewmr4_0702: polyferredoxin NapH (periplasmic nitrate reductase) |
Gene: Shewmr7_3320: polyferredoxin NapH (periplasmic nitrate reductase) |
|
|
|
Gene: Sama_2985: polyferredoxin NapH (periplasmic nitrate reductase) |
Gene: Shew_3208: polyferredoxin NapH (periplasmic nitrate reductase) |
Gene: Spea_0621: polyferredoxin NapH (periplasmic nitrate reductase) |
Gene: Shal_0713: polyferredoxin NapH (periplasmic nitrate reductase) |
|
Gene: Ssed_3959: polyferredoxin NapH (periplasmic nitrate reductase) |
|
polyferredoxin NapH (periplasmic nitrate reductase) |
| napB |
Gene: SO0845: nitrate reductase cytochrome c550-type subunit |
Gene: Sputcn32_3151: nitrate reductase cytochrome c550-type subunit |
Gene: Sputw3181_0792: nitrate reductase cytochrome c550-type subunit |
Gene: Shewana3_3433: nitrate reductase cytochrome c550-type subunit |
Gene: Shewmr4_0701: nitrate reductase cytochrome c550-type subunit |
Gene: Shewmr7_3321: nitrate reductase cytochrome c550-type subunit |
Gene: Sbal_3512: nitrate reductase cytochrome c550-type subunit |
|
Gene: Sfri_0552: nitrate reductase cytochrome c550-type subunit |
Gene: Sama_2986: nitrate reductase cytochrome c550-type subunit |
Gene: Shew_3209: nitrate reductase cytochrome c550-type subunit |
Gene: Spea_0620: nitrate reductase cytochrome c550-type subunit |
Gene: Shal_0712: nitrate reductase cytochrome c550-type subunit |
Gene: swp_4458: nitrate reductase cytochrome c550-type subunit |
Gene: Ssed_3960: nitrate reductase cytochrome c550-type subunit |
Gene: Swoo_4111: nitrate reductase cytochrome c550-type subunit |
nitrate reductase cytochrome c550-type subunit |
| CRON 43. | |||||||||||||||||
| fadI |
*
Shewanella oneidensis MR-1 Site: position = -131 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: SO3089: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella putrefaciens CN-32 Site: position = -136 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Sputcn32_2460: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella sp W3-18-1 Site: position = -136 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Sputw3181_1548: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella sp ANA-3 Site: position = -135 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Shewana3_1460: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella sp MR-4 Site: position = -135 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Shewmr4_1407: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella sp MR-7 Site: position = -135 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Shewmr7_1472: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella baltica OS155 Site: position = -136 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Sbal_2761: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella denitrificans OS217 Site: position = -109 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Sden_1529: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -104 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Sfri_2677: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella amazonensis SB2B Site: position = -112 score = 3.61813 sequence = AAGTTAGAATCGGGTCACACTT Gene: Sama_2168: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella loihica PV-4 Site: position = -134 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Shew_2426: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella pealeana ATCC 700345 Site: position = -116 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Spea_2599: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -119 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Shal_2671: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella piezotolerans WP3 Site: position = -122 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: swp_3140: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella sediminis HAW-EB3 Site: position = -151 score = 3.87355 sequence = AAGTTAGAATCAGATCACACTT Gene: Ssed_1628: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
*
Shewanella woodyi ATCC 51908 Site: position = -138 score = 4.0711 sequence = AAGTTAGAATCAGATCACATTT Gene: Swoo_3027: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
| fadJ |
Gene: SO3088: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Sputcn32_2459: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Sputw3181_1549: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Shewana3_1461: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Shewmr4_1408: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Shewmr7_1473: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Sbal_2760: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Sden_1530: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Sfri_2676: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Sama_2167: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Shew_2425: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Spea_2598: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Shal_2670: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: swp_3139: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Ssed_1629: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Gene: Swoo_3026: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) |
| CRON 44. | |||||||||||||||||
| SO4606 |
*
Shewanella oneidensis MR-1 Site: position = -317 score = 4.22767 sequence = AGAAGTGATCTTGATCAATTTT Gene: SO4606: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Shewanella putrefaciens CN-32 Site: position = -309 score = 4.39313 sequence = ATAAGTGATCTTGATCAATATT Gene: Sputcn32_3782: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Shewanella sp W3-18-1 Site: position = -309 score = 4.39313 sequence = ATAAGTGATCTTGATCAATATT Gene: Sputw3181_0133: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Shewanella sp ANA-3 Site: position = -318 score = 4.22767 sequence = AGAAGTGATCTTGATCAATTTT Gene: Shewana3_3991: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Shewanella sp MR-4 Site: position = -318 score = 4.22767 sequence = AGAAGTGATCTTGATCAATTTT Gene: Shewmr4_3791: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Shewanella sp MR-7 Site: position = -317 score = 4.22767 sequence = AGAAGTGATCTTGATCAATTTT Gene: Shewmr7_3864: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Shewanella baltica OS155 Site: position = -317 score = 4.39313 sequence = ATAAGTGATCTTGATCAATATT Gene: Sbal_0154: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Shewanella denitrificans OS217 Site: position = -316 score = 4.4423 sequence = AAAAGTGATCTTGATCAATATT Gene: Sden_3517: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -321 score = 3.85098 sequence = CAAAGTGATCTTGATCAATGTT Gene: Sfri_0258: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Shewanella amazonensis SB2B Site: position = -318 score = 4.44888 sequence = TAAAGTGATCTTGATCAATATT Gene: Sama_3483: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Shewanella loihica PV-4 Site: position = -321 score = 4.4423 sequence = AAAAGTGATCTTGATCAATATT Site: position = -264 score = 4.04584 sequence = TTATTTGTTATATCGCACAATT Gene: Shew_0125: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
Gene: Spea_3999: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
Gene: Shal_0258: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
Gene: swp_4823: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
Gene: Ssed_0198: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
Gene: Swoo_0178: cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
| SO4607 |
Gene: SO4607: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Sputcn32_3783: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Sputw3181_0132: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Shewana3_3992: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Shewmr4_3792: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Shewmr7_3865: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Sbal_0153: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Sden_3518: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Sfri_0257: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Sama_3484: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Shew_0124: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Spea_4000: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Shal_0257: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: swp_4824: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Ssed_0197: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Swoo_0177: cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
| coxG |
Gene: SO4608: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Sputcn32_3784: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Sputw3181_0131: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Shewana3_3993: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Shewmr4_3793: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Shewmr7_3866: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Sbal_0152: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Sden_3519: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Sfri_0256: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Sama_3485: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Shew_0123: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Spea_4001: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Shal_0256: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: swp_4825: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Ssed_0196: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Swoo_0176: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
| SO4609 |
Gene: SO4609: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Sputcn32_3785: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Sputw3181_0130: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Shewana3_3994: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Shewmr4_3794: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Shewmr7_3867: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Sbal_0151: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Sden_3520: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Sfri_0255: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Sama_3486: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Shew_0122: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Spea_4002: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Shal_0255: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: swp_4826: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Ssed_0195: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Swoo_0175: cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
| CRON 45. | |||||||||||||||||
| hemG |
Gene: SO3720: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
*
Shewanella putrefaciens CN-32 Site: position = -207 score = 4.47294 sequence = TTTTGTGAGCAAGCTAAAATTA Site: position = -135 score = 3.91378 sequence = AATTGATATTTAAATCACCTAG Gene: Sputcn32_3038: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
*
Shewanella sp W3-18-1 Site: position = -207 score = 4.47294 sequence = TTTTGTGAGCAAGCTAAAATTA Site: position = -135 score = 3.91378 sequence = AATTGATATTTAAATCACCTAG Gene: Sputw3181_0907: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
*
Shewanella sp ANA-3 Site: position = -317 score = 4.12352 sequence = TTTTGTGAGCAAGCTAGAATTA Gene: Shewana3_0871: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
*
Shewanella sp MR-4 Site: position = -320 score = 4.12352 sequence = TTTTGTGAGCAAGCTAGAATTA Gene: Shewmr4_3066: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
*
Shewanella sp MR-7 Site: position = -318 score = 4.12352 sequence = TTTTGTGAGCAAGCTAGAATTA Gene: Shewmr7_0906: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
*
Shewanella baltica OS155 Site: position = -316 score = 4.36986 sequence = TTTTGTGAGACAGTTAAAACTA Gene: Sbal_3400: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -144 score = 4.02008 sequence = TTTTGCGCGGCAGTTCACATTG Site: position = -83 score = 4.36624 sequence = TGACGTGATCTGTTTCATGTAA Gene: Sfri_0813: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
*
Shewanella amazonensis SB2B Site: position = -130 score = 3.89764 sequence = AAATGTGAGGCAGTTGGAATTT Gene: Sama_2882: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
*
Shewanella loihica PV-4 Site: position = -126 score = 4.09954 sequence = ATTTGTGACATCGGTAAACTTA Gene: Shew_0678: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
*
Shewanella pealeana ATCC 700345 Site: position = -140 score = 4.01337 sequence = TTTTGTGAGGTAGGTAAAGCTA Site: position = -98 score = 3.77917 sequence = CCTCGTGATCTGTTTCATGTAA Gene: Spea_0673: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -139 score = 4.01337 sequence = TTTTGTGAGGTAGGTAAAGCTA Site: position = -97 score = 3.77917 sequence = CCTCGTGATCTGTTTCATGTAA Gene: Shal_3525: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
*
Shewanella piezotolerans WP3 Site: position = -124 score = 3.90822 sequence = TTTTGTGAGGTAGGTAAAGGTA Site: position = -77 score = 3.72591 sequence = TGATCTGATTCAATTAAAAATA Gene: swp_4046: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
*
Shewanella sediminis HAW-EB3 Site: position = -120 score = 4.85366 sequence = ATTTGTGATGCAGGTAAAATTT Site: position = -78 score = 3.99272 sequence = TGCCGTGATCTGTTTCATGTAA Gene: Ssed_3790: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
*
Shewanella woodyi ATCC 51908 Site: position = -123 score = 4.31185 sequence = AATTGTGATATAGGTAAGAGTA Gene: Swoo_0793: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) |
| SO3719 |
Gene: SO3719: hypothetical protein |
Gene: Sputcn32_3037: hypothetical protein |
Gene: Sputw3181_0908: hypothetical protein |
Gene: Shewana3_0872: hypothetical protein |
Gene: Shewmr4_3065: hypothetical protein |
Gene: Shewmr7_0907: hypothetical protein |
Gene: Sbal_3399: hypothetical protein |
|
Gene: Sfri_0814: hypothetical protein |
Gene: Sama_2881: hypothetical protein |
Gene: Shew_0679: hypothetical protein |
Gene: Spea_0674: hypothetical protein |
*2
Shewanella halifaxensis HAW-EB4 Gene: Shal_3524: hypothetical protein Site: position = -235 score = 5.33461 sequence = AAGTGTGATATCGCTCACAAAA Gene: Shal_2707: hypothetical protein |
Gene: swp_4045: hypothetical protein |
Gene: Ssed_3789: hypothetical protein |
Gene: Swoo_0794: hypothetical protein |
hypothetical protein |
| CRON 46. | |||||||||||||||||
| moaA |
*
Shewanella oneidensis MR-1 Site: position = -220 score = 3.80214 sequence = TTGGGTGAGCACTGTCACAGAT Gene: SO4452: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella putrefaciens CN-32 Site: position = -187 score = 3.77281 sequence = TTGGGTGAGGACTGTCACAGAT Gene: Sputcn32_0389: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella sp W3-18-1 Site: position = -187 score = 3.77281 sequence = TTGGGTGAGGACTGTCACAGAT Gene: Sputw3181_0243: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella sp ANA-3 Site: position = -187 score = 3.80214 sequence = TTGGGTGAGCACTGTCACAGAT Gene: Shewana3_0274: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella sp MR-4 Site: position = -187 score = 3.89034 sequence = TTGGGTGAGCGCTGTCACAGTT Gene: Shewmr4_0273: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella sp MR-7 Site: position = -187 score = 3.89034 sequence = TTGGGTGAGCGCTGTCACAGTT Gene: Shewmr7_3748: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella baltica OS155 Site: position = -187 score = 3.97727 sequence = TTAGGTGAGGACTGTCACAGAT Gene: Sbal_0284: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella denitrificans OS217 Site: position = -186 score = 4.27953 sequence = TGAGGTGAGCTGTGTCACAAAA Gene: Sden_0101: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella frigidimarina NCIMB 400 Site: position = -186 score = 4.46278 sequence = TAGCGTGAGTCGAGTCACAAAT Gene: Sfri_0082: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella amazonensis SB2B Site: position = -180 score = 3.98696 sequence = CTGAGTGAGCGGCGTCACAATT Gene: Sama_3524: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella loihica PV-4 Site: position = -189 score = 4.39672 sequence = CTTCGTGAGCGGTGTCACATTA Gene: Shew_0087: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella pealeana ATCC 700345 Site: position = -222 score = 4.1207 sequence = TGCCGTGATAACTGTCACAAAA Gene: Spea_4120: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella halifaxensis HAW-EB4 Site: position = -222 score = 4.28976 sequence = TGGCGTGATAACTGTCACAAAA Gene: Shal_0122: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella piezotolerans WP3 Site: position = -222 score = 4.28877 sequence = TGAGGTGATTAGTGTCACAAAA Gene: swp_5009: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella sediminis HAW-EB3 Site: position = -221 score = 4.36273 sequence = GTATGTGAGGGGTGTCACAAAA Gene: Ssed_4402: molybdenum cofactor biosynthesis protein MoaA |
*
Shewanella woodyi ATCC 51908 Site: position = -222 score = 4.25203 sequence = GAATGTGAGTGTCGTCACAAAA Gene: Swoo_4793: molybdenum cofactor biosynthesis protein MoaA |
molybdenum cofactor biosynthesis protein MoaA |
| moaB |
|
|
|
|
|
|
|
|
|
Gene: Sama_3525: molybdenum cofactor biosynthesis protein MoaB |
Gene: Shew_0088: molybdenum cofactor biosynthesis protein MoaB |
Gene: Spea_4119: molybdenum cofactor biosynthesis protein MoaB |
Gene: Shal_0123: molybdenum cofactor biosynthesis protein MoaB |
Gene: swp_5008: molybdenum cofactor biosynthesis protein MoaB |
Gene: Ssed_4401: molybdenum cofactor biosynthesis protein MoaB |
Gene: Swoo_4792: molybdenum cofactor biosynthesis protein MoaB |
molybdenum cofactor biosynthesis protein MoaB |
| moaC |
Gene: SO4451: molybdenum cofactor biosynthesis protein MoaC |
Gene: Sputcn32_0390: molybdenum cofactor biosynthesis protein MoaC |
Gene: Sputw3181_0244: molybdenum cofactor biosynthesis protein MoaC |
Gene: Shewana3_0275: molybdenum cofactor biosynthesis protein MoaC |
Gene: Shewmr4_0274: molybdenum cofactor biosynthesis protein MoaC |
Gene: Shewmr7_3747: molybdenum cofactor biosynthesis protein MoaC |
Gene: Sbal_0285: molybdenum cofactor biosynthesis protein MoaC |
Gene: Sden_0102: molybdenum cofactor biosynthesis protein MoaC |
Gene: Sfri_0083: molybdenum cofactor biosynthesis protein MoaC |
Gene: Sama_3526: molybdenum cofactor biosynthesis protein MoaC |
Gene: Shew_0089: molybdenum cofactor biosynthesis protein MoaC |
Gene: Spea_4118: molybdenum cofactor biosynthesis protein MoaC |
Gene: Shal_0124: molybdenum cofactor biosynthesis protein MoaC |
Gene: swp_5007: molybdenum cofactor biosynthesis protein MoaC |
Gene: Ssed_4400: molybdenum cofactor biosynthesis protein MoaC |
Gene: Swoo_4791: molybdenum cofactor biosynthesis protein MoaC |
molybdenum cofactor biosynthesis protein MoaC |
| moaD |
Gene: SO4450: molybdenum cofactor biosynthesis protein MoaD |
Gene: Sputcn32_0391: molybdenum cofactor biosynthesis protein MoaD |
Gene: Sputw3181_0245: molybdenum cofactor biosynthesis protein MoaD |
Gene: Shewana3_0276: molybdenum cofactor biosynthesis protein MoaD |
Gene: Shewmr4_0275: molybdenum cofactor biosynthesis protein MoaD |
Gene: Shewmr7_3746: molybdenum cofactor biosynthesis protein MoaD |
Gene: Sbal_0286: molybdenum cofactor biosynthesis protein MoaD |
Gene: Sden_0103: molybdenum cofactor biosynthesis protein MoaD |
Gene: Sfri_0084: molybdenum cofactor biosynthesis protein MoaD |
Gene: Sama_3527: molybdenum cofactor biosynthesis protein MoaD |
Gene: Shew_0090: molybdenum cofactor biosynthesis protein MoaD |
Gene: Spea_4117: molybdenum cofactor biosynthesis protein MoaD |
Gene: Shal_0125: molybdenum cofactor biosynthesis protein MoaD |
Gene: swp_5006: molybdenum cofactor biosynthesis protein MoaD |
Gene: Ssed_4399: molybdenum cofactor biosynthesis protein MoaD |
Gene: Swoo_4790: molybdenum cofactor biosynthesis protein MoaD |
molybdenum cofactor biosynthesis protein MoaD |
| moaE |
Gene: SO4449: molybdenum cofactor biosynthesis protein MoaE |
Gene: Sputcn32_0392: molybdenum cofactor biosynthesis protein MoaE |
Gene: Sputw3181_0246: molybdenum cofactor biosynthesis protein MoaE |
Gene: Shewana3_0277: molybdenum cofactor biosynthesis protein MoaE |
Gene: Shewmr4_0276: molybdenum cofactor biosynthesis protein MoaE |
Gene: Shewmr7_3745: molybdenum cofactor biosynthesis protein MoaE |
Gene: Sbal_0287: molybdenum cofactor biosynthesis protein MoaE |
Gene: Sden_0104: molybdenum cofactor biosynthesis protein MoaE |
Gene: Sfri_0085: molybdenum cofactor biosynthesis protein MoaE |
Gene: Sama_3528: molybdenum cofactor biosynthesis protein MoaE |
Gene: Shew_0091: molybdenum cofactor biosynthesis protein MoaE |
Gene: Spea_4116: molybdenum cofactor biosynthesis protein MoaE |
Gene: Shal_0126: molybdenum cofactor biosynthesis protein MoaE |
Gene: swp_5005: molybdenum cofactor biosynthesis protein MoaE |
Gene: Ssed_4398: molybdenum cofactor biosynthesis protein MoaE |
Gene: Swoo_4789: molybdenum cofactor biosynthesis protein MoaE |
molybdenum cofactor biosynthesis protein MoaE |
| modA |
Gene: SO4448: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Sputcn32_0393: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Sputw3181_0247: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Shewana3_0278: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Shewmr4_0277: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Shewmr7_3744: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Sbal_0288: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Sden_0105: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Sfri_0086: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Sama_3529: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Shew_0092: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Spea_4115: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Shal_0127: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: swp_5004: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Ssed_4397: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
Gene: Swoo_4788: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) |
| modB |
Gene: SO4447: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Sputcn32_0394: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Sputw3181_0248: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Shewana3_0279: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Shewmr4_0278: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Shewmr7_3743: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Sbal_0289: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Sden_0106: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Sfri_0087: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Sama_3530: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Shew_0093: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Spea_4114: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Shal_0128: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: swp_5002: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Ssed_4396: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Swoo_4787: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
| modC |
Gene: SO4446: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Sputcn32_0395: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Sputw3181_0249: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Shewana3_0280: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Shewmr4_0279: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Shewmr7_3742: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Sbal_0290: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Sden_0107: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Sfri_0088: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Sama_3531: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Shew_0094: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Spea_4113: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Shal_0129: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: swp_5001: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Ssed_4395: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Swoo_4786: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
| CRON 47. | |||||||||||||||||
| Shewana3_0095 |
|
|
|
*
Shewanella sp ANA-3 Site: position = -80 score = 4.84948 sequence = AAATTTGAGCTTGATCACACTA Gene: Shewana3_0095: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -80 score = 4.84948 sequence = AAATTTGAGCTTGATCACACTA Gene: Shewmr4_0094: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -80 score = 4.84948 sequence = AAATTTGAGCTTGATCACACTA Gene: Shewmr7_0089: hypothetical protein |
|
|
Gene: Sfri_3964: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| CRON 48. | |||||||||||||||||
| sel1 |
*
Shewanella oneidensis MR-1 Site: position = -267 score = 4.23922 sequence = TTTAGTGATATTAGTCAACTAA Gene: SO0625: Sel1 domain protein repeat-containing protein precursor |
*
Shewanella putrefaciens CN-32 Site: position = -270 score = 4.23922 sequence = TTTAGTGATATTAGTCAACTAA Gene: Sputcn32_0653: Sel1 domain protein repeat-containing protein precursor |
*
Shewanella sp W3-18-1 Site: position = -270 score = 4.23922 sequence = TTTAGTGATATTAGTCAACTAA Gene: Sputw3181_3521: Sel1 domain protein repeat-containing protein precursor |
*
Shewanella sp ANA-3 Site: position = -270 score = 4.23922 sequence = TTTAGTGATATTAGTCAACTAA Gene: Shewana3_0618: Sel1 domain protein repeat-containing protein precursor |
*
Shewanella sp MR-4 Site: position = -270 score = 4.23922 sequence = TTTAGTGATATTAGTCAACTAA Gene: Shewmr4_0619: Sel1 domain protein repeat-containing protein precursor |
*
Shewanella sp MR-7 Site: position = -270 score = 4.23922 sequence = TTTAGTGATATTAGTCAACTAA Gene: Shewmr7_3411: Sel1 domain protein repeat-containing protein precursor |
*
Shewanella baltica OS155 Site: position = -278 score = 4.35121 sequence = TTTAGTGATTTAAGTCAACTAA Gene: Sbal_0579: Sel1 domain protein repeat-containing protein precursor |
Gene: Sden_3189: Sel1 domain protein repeat-containing protein precursor |
*
Shewanella frigidimarina NCIMB 400 Site: position = -222 score = 4.11507 sequence = AACTTTGATAGAGATCGTATTT Site: position = -147 score = 4.28476 sequence = ATTTGTGATGACGGTCGACTTT Site: position = -38 score = 3.99702 sequence = TTATTTAATCAGCTTCATAAAT Gene: Sfri_3291: Sel1 domain protein repeat-containing protein precursor |
*
Shewanella amazonensis SB2B Site: position = -319 score = 3.84014 sequence = AACCATGATGCAGATCGAAATT Gene: Sama_3003: Sel1 domain protein repeat-containing protein precursor |
*
Shewanella loihica PV-4 Site: position = -279 score = 3.83192 sequence = ATTAGTAATATATGTCAACTAA Gene: Shew_0586: Sel1 domain protein repeat-containing protein precursor |
|
|
*
Shewanella piezotolerans WP3 Site: position = -153 score = 3.82702 sequence = TTTTTTGAACCTTATCAATAAA Gene: swp_0756: Sel1 domain protein repeat-containing protein precursor |
*
Shewanella sediminis HAW-EB3 Site: position = -296 score = 4.34462 sequence = ATTAGTGATATAAGTCAACTAA Gene: Ssed_3872: Sel1 domain protein repeat-containing protein precursor |
*
Shewanella woodyi ATCC 51908 Site: position = -298 score = 4.34462 sequence = ATTAGTGATATAAGTCAACTAA Gene: Swoo_0663: Sel1 domain protein repeat-containing protein precursor |
Sel1 domain protein repeat-containing protein precursor |
| CRON 49. | |||||||||||||||||
| argR |
*
Shewanella oneidensis MR-1 Site: position = -266 score = 4.53368 sequence = ATGTGTGACATGGATCTAATTT Gene: SO0769: arginine pathway regulatory protein ArgR, repressor of arg regulon |
*
Shewanella putrefaciens CN-32 Site: position = -259 score = 4.17624 sequence = ATGTGTGACATGGATCTAGTTT Gene: Sputcn32_3220: arginine pathway regulatory protein ArgR, repressor of arg regulon |
*
Shewanella sp W3-18-1 Site: position = -259 score = 4.17624 sequence = ATGTGTGACATGGATCTAGTTT Gene: Sputw3181_0721: arginine pathway regulatory protein ArgR, repressor of arg regulon |
*
Shewanella sp ANA-3 Site: position = -266 score = 4.53368 sequence = ATGTGTGACATGGATCTAATTT Gene: Shewana3_3510: arginine pathway regulatory protein ArgR, repressor of arg regulon |
*
Shewanella sp MR-4 Site: position = -266 score = 4.53368 sequence = ATGTGTGACATGGATCTAATTT Gene: Shewmr4_3340: arginine pathway regulatory protein ArgR, repressor of arg regulon |
*
Shewanella sp MR-7 Site: position = -266 score = 4.53368 sequence = ATGTGTGACATGGATCTAATTT Gene: Shewmr7_0613: arginine pathway regulatory protein ArgR, repressor of arg regulon |
*
Shewanella baltica OS155 Site: position = -270 score = 4.53368 sequence = ATGTGTGACATGGATCTAATTT Gene: Sbal_0608: arginine pathway regulatory protein ArgR, repressor of arg regulon |
Gene: Sden_0825: arginine pathway regulatory protein ArgR, repressor of arg regulon |
Gene: Sfri_0640: arginine pathway regulatory protein ArgR, repressor of arg regulon |
*
Shewanella amazonensis SB2B Site: position = -262 score = 4.03298 sequence = ATTTGTGAGGTAGATCCTCAAA Gene: Sama_0671: arginine pathway regulatory protein ArgR, repressor of arg regulon |
*
Shewanella loihica PV-4 Site: position = -282 score = 4.59978 sequence = TTATGTGATATAGATCTAGATT Gene: Shew_0866: arginine pathway regulatory protein ArgR, repressor of arg regulon |
Gene: Spea_0849: arginine pathway regulatory protein ArgR, repressor of arg regulon |
Gene: Shal_0902: arginine pathway regulatory protein ArgR, repressor of arg regulon |
*
Shewanella piezotolerans WP3 Site: position = -140 score = 3.81151 sequence = ATTTATACTCTACATCATATTT Gene: swp_4101: arginine pathway regulatory protein ArgR, repressor of arg regulon |
*
Shewanella sediminis HAW-EB3 Site: position = -254 score = 3.75337 sequence = ATTTTTGTTCTACATCAATAAA Gene: Ssed_0951: arginine pathway regulatory protein ArgR, repressor of arg regulon |
*
Shewanella woodyi ATCC 51908 Site: position = -311 score = 4.47876 sequence = TTTTGTGATGTAGGTCTACATT Gene: Swoo_1001: arginine pathway regulatory protein ArgR, repressor of arg regulon |
arginine pathway regulatory protein ArgR, repressor of arg regulon |
| CRON 50. | |||||||||||||||||
| SO0439 |
*
Shewanella oneidensis MR-1 Site: position = -34 score = 4.426 sequence = ATACGTGATCTGACGCACATCA Gene: SO0439: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -90 score = 4.48702 sequence = AAATGTGAACCAGAGCACACTC Gene: Sputcn32_3403: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -90 score = 4.48702 sequence = AAATGTGAACCAGAGCACACTC Gene: Sputw3181_0540: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -78 score = 4.22843 sequence = AAGCGTGAGCTAACGCACACAA Gene: Shewana3_0438: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -77 score = 3.82136 sequence = AAGCGTGAACTTAAGCACACTC Gene: Shewmr4_0442: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -77 score = 3.82136 sequence = AAGCGTGAACTTAAGCACACTC Gene: Shewmr7_3587: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -93 score = 4.8117 sequence = AAATGTGACCTAAAGCACATAC Gene: Sbal_0417: hypothetical protein |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -135 score = 5.2057 sequence = TTTTATGATTTAGATCACAAAA Gene: Sfri_0491: hypothetical protein |
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -137 score = 4.75582 sequence = TTTTGTGATCTAAGTAGCAAAA Gene: Spea_0430: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -138 score = 4.74247 sequence = TTTTGTGACATAGGTAACACAA Gene: Shal_0486: hypothetical protein |
Gene: swp_4727: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -105 score = 4.32443 sequence = ATTTGTGACCAAGTTCCCAAAC Gene: Ssed_3193: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -78 score = 3.88288 sequence = AAACAGGACGTAGATCACACTT Gene: Swoo_0294: hypothetical protein |
hypothetical protein |
| CRON 51. | |||||||||||||||||
| yceI |
Gene: SO2893: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -70 score = 3.77562 sequence = TAAATGGATGTAAATCACGATT Gene: Sputcn32_1651: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -70 score = 3.77562 sequence = TAAATGGATGTAAATCACGATT Gene: Sputw3181_2375: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -102 score = 4.61453 sequence = TTAGGTGATCTTTGTCACAGAT Gene: Shewana3_1628: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -103 score = 4.83478 sequence = TTAGGTGATCTTTGTCACAAAT Gene: Shewmr4_1561: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -103 score = 4.83478 sequence = TTAGGTGATCTTTGTCACAAAT Gene: Shewmr7_1636: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -105 score = 4.67624 sequence = TTAGGTGATGTGGGTCACGTTT Gene: Sbal_1772: hypothetical protein |
Gene: Sden_2275: hypothetical protein |
Gene: Sfri_1704: hypothetical protein |
Gene: Sama_1959: hypothetical protein |
Gene: Shew_2223: hypothetical protein |
Gene: Spea_2476: hypothetical protein |
Gene: Shal_1807: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -42 score = 3.79306 sequence = TACATTGATATCTATCACTATT Gene: swp_3020: hypothetical protein |
Gene: Ssed_2605: hypothetical protein |
Gene: Swoo_2061: hypothetical protein |
hypothetical protein |
| SO2891 |
Gene: SO2891: type IIA topoisomerase, B subunit |
Gene: Sputcn32_1652: type IIA topoisomerase, B subunit |
Gene: Sputw3181_2374: type IIA topoisomerase, B subunit |
Gene: Shewana3_1629: type IIA topoisomerase, B subunit |
Gene: Shewmr4_1562: type IIA topoisomerase, B subunit |
Gene: Shewmr7_1637: type IIA topoisomerase, B subunit |
Gene: Sbal_1773: type IIA topoisomerase, B subunit |
Gene: Sden_2274: type IIA topoisomerase, B subunit |
Gene: Sfri_1705: type IIA topoisomerase, B subunit |
Gene: Sama_1958: type IIA topoisomerase, B subunit |
Gene: Shew_2222: type IIA topoisomerase, B subunit |
*
Shewanella pealeana ATCC 700345 Site: position = -166 score = 3.83614 sequence = TTACGTGCTGAATTGCAAAATT Site: position = -69 score = 3.81606 sequence = AATTGTTACGCATCTTACGCTA Gene: Spea_2475: type IIA topoisomerase, B subunit |
Gene: Shal_1808: type IIA topoisomerase, B subunit |
Gene: swp_3019: type IIA topoisomerase, B subunit |
Gene: Ssed_2604: type IIA topoisomerase, B subunit |
Gene: Swoo_2062: type IIA topoisomerase, B subunit |
type IIA topoisomerase, B subunit |
| CRON 52. | |||||||||||||||||
| SO3914 |
*
Shewanella oneidensis MR-1 Site: position = -136 score = 4.01516 sequence = AACAGTGATGCTGATTAAATTA Gene: SO3914: ferrichrome-iron receptor |
|
|
*
Shewanella sp ANA-3 Site: position = -135 score = 4.1747 sequence = AATTGTGACTAAGATTAAATTG Gene: Shewana3_0716: ferrichrome-iron receptor |
*
Shewanella sp MR-4 Site: position = -134 score = 4.46854 sequence = TAATGTGACAAAGATTAAATTA Gene: Shewmr4_3245: ferrichrome-iron receptor |
*
Shewanella sp MR-7 Site: position = -134 score = 4.85508 sequence = TAATGTGATATGTATTAAATTA Gene: Shewmr7_0697: ferrichrome-iron receptor |
Gene: Sbal_3635: ferrichrome-iron receptor |
|
|
|
|
|
|
|
|
|
ferrichrome-iron receptor |
| piuC |
Gene: SO3913: iron-uptake factor PiuC |
|
|
Gene: Shewana3_0717: iron-uptake factor PiuC |
Gene: Shewmr4_3244: iron-uptake factor PiuC |
Gene: Shewmr7_0698: iron-uptake factor PiuC |
Gene: Sbal_3634: iron-uptake factor PiuC |
|
|
|
|
|
|
|
|
|
iron-uptake factor PiuC |
| CRON 53. | |||||||||||||||||
| SO3811 |
Gene: SO3811: lipoprotein, putative |
*
Shewanella putrefaciens CN-32 Site: position = -116 score = 4.38849 sequence = TAATGTGATTGGTATAATATAC Gene: Sputcn32_0822: lipoprotein, putative |
*
Shewanella sp W3-18-1 Site: position = -116 score = 4.38849 sequence = TAATGTGATTGGTATAATATAC Gene: Sputw3181_3351: lipoprotein, putative |
*
Shewanella sp ANA-3 Site: position = -142 score = 4.14174 sequence = AATTGTTAAGTATTTCATATTG Gene: Shewana3_0786: lipoprotein, putative |
*
Shewanella sp MR-4 Site: position = -142 score = 4.14174 sequence = AATTGTTAAGTATTTCATATTG Gene: Shewmr4_3152: lipoprotein, putative |
*
Shewanella sp MR-7 Site: position = -142 score = 4.14174 sequence = AATTGTTAAGTATTTCATATTG Gene: Shewmr7_0815: lipoprotein, putative |
Gene: Sbal_0714: lipoprotein, putative |
Gene: Sden_0774: lipoprotein, putative |
Gene: Sfri_3111: lipoprotein, putative |
Gene: Sama_2553: lipoprotein, putative |
Gene: Shew_2889: lipoprotein, putative |
Gene: Spea_3110: lipoprotein, putative |
Gene: Shal_3194: lipoprotein, putative |
Gene: swp_1154: lipoprotein, putative |
*
Shewanella sediminis HAW-EB3 Site: position = -203 score = 4.29747 sequence = TAACGTGATGAAAGTAAAATTT Gene: Ssed_3439: lipoprotein, putative |
Gene: Swoo_3641: lipoprotein, putative |
lipoprotein, putative |
| ppiA |
Gene: SO3812: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Sputcn32_0821: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Sputw3181_3352: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Shewana3_0785: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Shewmr4_3153: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Shewmr7_0814: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Sbal_0713: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Sden_0773: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Sfri_3112: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Sama_2554: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Shew_2890: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Spea_3111: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Shal_3195: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: swp_1153: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Ssed_3440: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
Gene: Swoo_3642: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) |
| SO3813 |
Gene: SO3813: hypothetical protein |
Gene: Sputcn32_0820: hypothetical protein |
Gene: Sputw3181_3353: hypothetical protein |
Gene: Shewana3_0784: hypothetical protein |
Gene: Shewmr4_3154: hypothetical protein |
Gene: Shewmr7_0813: hypothetical protein |
Gene: Sbal_0712: hypothetical protein |
Gene: Sden_0772: hypothetical protein |
Gene: Sfri_3113: hypothetical protein |
Gene: Sama_2555: hypothetical protein |
Gene: Shew_2891: hypothetical protein |
Gene: Spea_3112: hypothetical protein |
Gene: Shal_3196: hypothetical protein |
|
Gene: Ssed_3441: hypothetical protein |
Gene: Swoo_3643: hypothetical protein |
hypothetical protein |
| ampG |
Gene: SO3814: AmpG permease |
Gene: Sputcn32_0819: AmpG permease |
Gene: Sputw3181_3354: AmpG permease |
Gene: Shewana3_0783: AmpG permease |
Gene: Shewmr4_3155: AmpG permease |
Gene: Shewmr7_0812: AmpG permease |
*
Shewanella baltica OS155 Site: position = -218 score = 4.38656 sequence = TTTTGTGATCTCTTTTACTCAA Gene: Sbal_0711: AmpG permease |
Gene: Sden_0771: AmpG permease |
Gene: Sfri_3114: AmpG permease |
Gene: Sama_2556: AmpG permease |
Gene: Shew_2892: AmpG permease |
Gene: Spea_3113: AmpG permease |
Gene: Shal_3197: AmpG permease |
Gene: swp_1152: AmpG permease |
Gene: Ssed_3442: AmpG permease |
Gene: Swoo_3644: AmpG permease |
AmpG permease |
| CRON 54. | |||||||||||||||||
| mviN |
*
Shewanella oneidensis MR-1 Site: position = -49 score = 4.5281 sequence = TTTTTTGAGATGAATCACCTAA Gene: SO3534: proposed peptidoglycan lipid II flippase MurJ |
*
Shewanella putrefaciens CN-32 Site: position = -49 score = 4.5281 sequence = TTTTTTGAGATGAATCACCTAA Gene: Sputcn32_1057: proposed peptidoglycan lipid II flippase MurJ |
*
Shewanella sp W3-18-1 Site: position = -49 score = 4.5281 sequence = TTTTTTGAGATGAATCACCTAA Gene: Sputw3181_3108: proposed peptidoglycan lipid II flippase MurJ |
*
Shewanella sp ANA-3 Site: position = -49 score = 4.5281 sequence = TTTTTTGAGATGAATCACCTAA Gene: Shewana3_3138: proposed peptidoglycan lipid II flippase MurJ |
*
Shewanella sp MR-4 Site: position = -49 score = 4.5281 sequence = TTTTTTGAGATGAATCACCTAA Gene: Shewmr4_2959: proposed peptidoglycan lipid II flippase MurJ |
*
Shewanella sp MR-7 Site: position = -49 score = 4.5281 sequence = TTTTTTGAGATGAATCACCTAA Gene: Shewmr7_3041: proposed peptidoglycan lipid II flippase MurJ |
*
Shewanella baltica OS155 Site: position = -49 score = 4.56797 sequence = TTTTTTGAGATGTATCACCTAA Gene: Sbal_1052: proposed peptidoglycan lipid II flippase MurJ |
Gene: Sden_2725: proposed peptidoglycan lipid II flippase MurJ |
Gene: Sfri_2892: proposed peptidoglycan lipid II flippase MurJ |
Gene: Sama_0922: proposed peptidoglycan lipid II flippase MurJ |
Gene: Shew_1097: proposed peptidoglycan lipid II flippase MurJ |
Gene: Spea_1081: proposed peptidoglycan lipid II flippase MurJ |
Gene: Shal_1129: proposed peptidoglycan lipid II flippase MurJ |
Gene: swp_3731: proposed peptidoglycan lipid II flippase MurJ |
Gene: Ssed_1192: proposed peptidoglycan lipid II flippase MurJ |
Gene: Swoo_1289: proposed peptidoglycan lipid II flippase MurJ |
proposed peptidoglycan lipid II flippase MurJ |
| ribF |
Gene: SO3533: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Sputcn32_1058: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Sputw3181_3107: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Shewana3_3137: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Shewmr4_2958: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Shewmr7_3040: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Sbal_1053: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Sden_2724: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Sfri_2891: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Sama_0923: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Shew_1098: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Spea_1082: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Shal_1130: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: swp_3730: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Ssed_1193: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
Gene: Swoo_1290: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) |
| ileS |
Gene: SO3532: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Sputcn32_1059: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Sputw3181_3106: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Shewana3_3136: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Shewmr4_2957: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Shewmr7_3039: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Sbal_1054: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Sden_2723: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Sfri_2890: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Sama_0924: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Shew_1099: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Spea_1083: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Shal_1131: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: swp_3728: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Ssed_1194: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
Gene: Swoo_1291: isoleucyl-tRNA synthetase (EC 6.1.1.5) |
isoleucyl-tRNA synthetase (EC 6.1.1.5) |
| lspA |
Gene: SO3531: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Sputcn32_1060: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Sputw3181_3105: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Shewana3_3135: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Shewmr4_2956: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Shewmr7_3038: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Sbal_1055: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Sden_2722: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Sfri_2889: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Sama_0925: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Shew_1100: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Spea_1084: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Shal_1132: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: swp_3727: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Ssed_1195: lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Swoo_1292: lipoprotein signal peptidase (EC 3.4.23.36) |
lipoprotein signal peptidase (EC 3.4.23.36) |
| fkbP-2 |
Gene: SO3530: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Sputcn32_1061: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Sputw3181_3104: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Shewana3_3134: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Shewmr4_2955: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Shewmr7_3037: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Sbal_1056: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Sden_2721: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Sfri_2888: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Sama_0926: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Shew_1101: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Spea_1085: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Shal_1133: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: swp_3725: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Ssed_1196: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
Gene: Swoo_1293: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) |
| lytB |
Gene: SO3529: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Sputcn32_1062: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Sputw3181_3103: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Shewana3_3133: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Shewmr4_2954: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Shewmr7_3036: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Sbal_1057: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Sden_2720: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Sfri_2887: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Sama_0927: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Shew_1102: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Spea_1086: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Shal_1134: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: swp_3724: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Ssed_1197: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
Gene: Swoo_1294: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) |
| pilV |
Gene: SO3528: type IV fimbrial biogenesis protein PilV |
Gene: Sputcn32_1063: type IV fimbrial biogenesis protein PilV |
Gene: Sputw3181_3102: type IV fimbrial biogenesis protein PilV |
Gene: Shewana3_3132: type IV fimbrial biogenesis protein PilV |
Gene: Shewmr4_2953: type IV fimbrial biogenesis protein PilV |
Gene: Shewmr7_3035: type IV fimbrial biogenesis protein PilV |
Gene: Sbal_1058: type IV fimbrial biogenesis protein PilV |
Gene: Sden_2719: type IV fimbrial biogenesis protein PilV |
Gene: Sfri_2886: type IV fimbrial biogenesis protein PilV |
*
Shewanella amazonensis SB2B Site: position = -138 score = 3.85633 sequence = TATTGTTACTGGCAGCAAACAA Gene: Sama_0928: type IV fimbrial biogenesis protein PilV |
Gene: Shew_1103: type IV fimbrial biogenesis protein PilV |
Gene: Spea_1087: type IV fimbrial biogenesis protein PilV |
Gene: Shal_1135: type IV fimbrial biogenesis protein PilV |
Gene: swp_3723: type IV fimbrial biogenesis protein PilV |
Gene: Ssed_1198: type IV fimbrial biogenesis protein PilV |
Gene: Swoo_1295: type IV fimbrial biogenesis protein PilV |
type IV fimbrial biogenesis protein PilV |
| pilW |
Gene: SO3527: type IV fimbrial biogenesis protein PilW |
Gene: Sputcn32_1064: type IV fimbrial biogenesis protein PilW |
Gene: Sputw3181_3101: type IV fimbrial biogenesis protein PilW |
Gene: Shewana3_3131: type IV fimbrial biogenesis protein PilW |
Gene: Shewmr4_2952: type IV fimbrial biogenesis protein PilW |
Gene: Shewmr7_3034: type IV fimbrial biogenesis protein PilW |
Gene: Sbal_1059: type IV fimbrial biogenesis protein PilW |
Gene: Sden_2718: type IV fimbrial biogenesis protein PilW |
Gene: Sfri_2885: type IV fimbrial biogenesis protein PilW |
Gene: Sama_0929: type IV fimbrial biogenesis protein PilW |
Gene: Shew_1104: type IV fimbrial biogenesis protein PilW |
Gene: Spea_1088: type IV fimbrial biogenesis protein PilW |
Gene: Shal_1136: type IV fimbrial biogenesis protein PilW |
Gene: swp_3722: type IV fimbrial biogenesis protein PilW |
Gene: Ssed_1199: type IV fimbrial biogenesis protein PilW |
Gene: Swoo_1296: type IV fimbrial biogenesis protein PilW |
type IV fimbrial biogenesis protein PilW |
| pilX |
Gene: SO3526: type IV fimbrial biogenesis protein PilX |
Gene: Sputcn32_1065: type IV fimbrial biogenesis protein PilX |
Gene: Sputw3181_3100: type IV fimbrial biogenesis protein PilX |
Gene: Shewana3_3130: type IV fimbrial biogenesis protein PilX |
Gene: Shewmr4_2951: type IV fimbrial biogenesis protein PilX |
Gene: Shewmr7_3033: type IV fimbrial biogenesis protein PilX |
Gene: Sbal_1060: type IV fimbrial biogenesis protein PilX |
Gene: Sden_2717: type IV fimbrial biogenesis protein PilX |
Gene: Sfri_2884: type IV fimbrial biogenesis protein PilX |
Gene: Sama_0930: type IV fimbrial biogenesis protein PilX |
Gene: Shew_1105: type IV fimbrial biogenesis protein PilX |
Gene: Spea_1089: type IV fimbrial biogenesis protein PilX |
Gene: Shal_1137: type IV fimbrial biogenesis protein PilX |
Gene: swp_3721: type IV fimbrial biogenesis protein PilX |
Gene: Ssed_1200: type IV fimbrial biogenesis protein PilX |
Gene: Swoo_1297: type IV fimbrial biogenesis protein PilX |
type IV fimbrial biogenesis protein PilX |
| pilY1 |
Gene: SO3525: type IV fimbrial biogenesis protein PilY1 |
Gene: Sputcn32_1066: type IV fimbrial biogenesis protein PilY1 |
Gene: Sputw3181_3099: type IV fimbrial biogenesis protein PilY1 |
Gene: Shewana3_3129: type IV fimbrial biogenesis protein PilY1 |
Gene: Shewmr4_2950: type IV fimbrial biogenesis protein PilY1 |
Gene: Shewmr7_3032: type IV fimbrial biogenesis protein PilY1 |
Gene: Sbal_1061: type IV fimbrial biogenesis protein PilY1 |
Gene: Sden_2716: type IV fimbrial biogenesis protein PilY1 |
Gene: Sfri_2883: type IV fimbrial biogenesis protein PilY1 |
Gene: Sama_0931: type IV fimbrial biogenesis protein PilY1 |
Gene: Shew_1106: type IV fimbrial biogenesis protein PilY1 |
Gene: Spea_1090: type IV fimbrial biogenesis protein PilY1 |
Gene: Shal_1138: type IV fimbrial biogenesis protein PilY1 |
Gene: swp_3720: type IV fimbrial biogenesis protein PilY1 |
Gene: Ssed_1201: type IV fimbrial biogenesis protein PilY1 |
Gene: Swoo_1298: type IV fimbrial biogenesis protein PilY1 |
type IV fimbrial biogenesis protein PilY1 |
| pilE |
Gene: SO3524: type IV pilus biogenesis protein PilE |
Gene: Sputcn32_1067: type IV pilus biogenesis protein PilE |
Gene: Sputw3181_3098: type IV pilus biogenesis protein PilE |
Gene: Shewana3_3128: type IV pilus biogenesis protein PilE |
Gene: Shewmr4_2949: type IV pilus biogenesis protein PilE |
Gene: Shewmr7_3031: type IV pilus biogenesis protein PilE |
Gene: Sbal_1062: type IV pilus biogenesis protein PilE |
Gene: Sden_2715: type IV pilus biogenesis protein PilE |
Gene: Sfri_2882: type IV pilus biogenesis protein PilE |
Gene: Sama_0932: type IV pilus biogenesis protein PilE |
Gene: Shew_1107: type IV pilus biogenesis protein PilE |
Gene: Spea_1091: type IV pilus biogenesis protein PilE |
Gene: Shal_1139: type IV pilus biogenesis protein PilE |
Gene: swp_3719: type IV pilus biogenesis protein PilE |
Gene: Ssed_1202: type IV pilus biogenesis protein PilE |
Gene: Swoo_1299: type IV pilus biogenesis protein PilE |
type IV pilus biogenesis protein PilE |
| CRON 55. | |||||||||||||||||
| mdh |
*
Shewanella oneidensis MR-1 Site: position = -47 score = 4.29841 sequence = AAATTAGATCCATGTCACACAT Gene: SO0770: malate dehydrogenase (EC 1.1.1.37) |
*
Shewanella putrefaciens CN-32 Site: position = -46 score = 3.97202 sequence = AAACTAGATCCATGTCACACAT Gene: Sputcn32_3219: malate dehydrogenase (EC 1.1.1.37) |
*
Shewanella sp W3-18-1 Site: position = -46 score = 3.97202 sequence = AAACTAGATCCATGTCACACAT Gene: Sputw3181_0722: malate dehydrogenase (EC 1.1.1.37) |
*
Shewanella sp ANA-3 Site: position = -46 score = 4.29841 sequence = AAATTAGATCCATGTCACACAT Gene: Shewana3_3509: malate dehydrogenase (EC 1.1.1.37) |
*
Shewanella sp MR-4 Site: position = -46 score = 4.29841 sequence = AAATTAGATCCATGTCACACAT Gene: Shewmr4_3339: malate dehydrogenase (EC 1.1.1.37) |
*
Shewanella sp MR-7 Site: position = -46 score = 4.29841 sequence = AAATTAGATCCATGTCACACAT Gene: Shewmr7_0614: malate dehydrogenase (EC 1.1.1.37) |
*
Shewanella baltica OS155 Site: position = -46 score = 4.29841 sequence = AAATTAGATCCATGTCACACAT Gene: Sbal_0609: malate dehydrogenase (EC 1.1.1.37) |
Gene: Sden_0826: malate dehydrogenase (EC 1.1.1.37) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -45 score = 4.154 sequence = AATTTAGATCTATGTCACAAAC Gene: Sfri_3173: malate dehydrogenase (EC 1.1.1.37) |
*
Shewanella amazonensis SB2B Site: position = -46 score = 3.78342 sequence = TTTGAGGATCTACCTCACAAAT Gene: Sama_0672: malate dehydrogenase (EC 1.1.1.37) |
*
Shewanella loihica PV-4 Site: position = -47 score = 4.46978 sequence = AATCTAGATCTATATCACATAA Gene: Shew_0867: malate dehydrogenase (EC 1.1.1.37) |
Gene: Spea_0850: malate dehydrogenase (EC 1.1.1.37) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -46 score = 3.88457 sequence = AAGATGGATCTGAATCACAAAA Gene: Shal_0903: malate dehydrogenase (EC 1.1.1.37) |
*
Shewanella piezotolerans WP3 Site: position = -46 score = 3.92088 sequence = AAAACAGATCTAAATCACAAAA Gene: swp_4100: malate dehydrogenase (EC 1.1.1.37) |
*
Shewanella sediminis HAW-EB3 Site: position = -136 score = 4.08545 sequence = TTTATTGATGTAGAACAAAAAT Gene: Ssed_0952: malate dehydrogenase (EC 1.1.1.37) |
*
Shewanella woodyi ATCC 51908 Site: position = -47 score = 3.82399 sequence = AATGTAGACCTACATCACAAAA Gene: Swoo_1002: malate dehydrogenase (EC 1.1.1.37) |
malate dehydrogenase (EC 1.1.1.37) |
| CRON 56. | |||||||||||||||||
| cytcB |
*
Shewanella oneidensis MR-1 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATTA Gene: SO4666: diheme cytochrome c4 |
*
Shewanella putrefaciens CN-32 Site: position = -95 score = 4.32157 sequence = AAATATTACTCCGATCACATTA Gene: Sputcn32_3908: diheme cytochrome c4 |
*
Shewanella sp W3-18-1 Site: position = -95 score = 4.32157 sequence = AAATATTACTCCGATCACATTA Gene: Sputw3181_0043: diheme cytochrome c4 |
*
Shewanella sp ANA-3 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATTA Gene: Shewana3_4111: diheme cytochrome c4 |
*
Shewanella sp MR-4 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATTA Gene: Shewmr4_3907: diheme cytochrome c4 |
*
Shewanella sp MR-7 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATTA Gene: Shewmr7_3999: diheme cytochrome c4 |
*
Shewanella baltica OS155 Site: position = -95 score = 4.32157 sequence = AAATATTACTCCGATCACATTA Gene: Sbal_0051: diheme cytochrome c4 |
*
Shewanella denitrificans OS217 Site: position = -94 score = 3.70779 sequence = AAATATTATTTCGAGCATAATA Gene: Sden_3622: diheme cytochrome c4 |
*
Shewanella frigidimarina NCIMB 400 Site: position = -181 score = 4.34371 sequence = AAATATTAGCCTGATCACATTA Gene: Sfri_3945: diheme cytochrome c4 |
*
Shewanella amazonensis SB2B Site: position = -95 score = 3.70946 sequence = AAATATTGCCCCGATCACATAT Gene: Sama_0091: diheme cytochrome c4 |
*
Shewanella loihica PV-4 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATAA Gene: Shew_3716: diheme cytochrome c4 |
*
Shewanella pealeana ATCC 700345 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATAA Gene: Spea_0100: diheme cytochrome c4 |
*
Shewanella halifaxensis HAW-EB4 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATAA Gene: Shal_4222: diheme cytochrome c4 |
*
Shewanella piezotolerans WP3 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATAA Gene: swp_5075: diheme cytochrome c4 |
*
Shewanella sediminis HAW-EB3 Site: position = -96 score = 4.51372 sequence = AAATATTACCTCGATCACATAA Gene: Ssed_0094: diheme cytochrome c4 |
*
Shewanella woodyi ATCC 51908 Site: position = -157 score = 4.1598 sequence = AAATATGATGTTTTGCACTTTA Site: position = -96 score = 4.43127 sequence = AAATATTACCTCGATCACAATA Gene: Swoo_0057: diheme cytochrome c4 |
diheme cytochrome c4 |
| CRON 57. | |||||||||||||||||
| SO1821 |
Gene: SO1821: outer membrane porin, putative |
*
Shewanella putrefaciens CN-32 Site: position = -140 score = 4.44343 sequence = TTTTGTGATGTTAATCTACATA Gene: Sputcn32_1515: outer membrane porin, putative |
*
Shewanella sp W3-18-1 Site: position = -140 score = 4.44343 sequence = TTTTGTGATGTTAATCTACATA Gene: Sputw3181_2585: outer membrane porin, putative |
*
Shewanella sp ANA-3 Site: position = -140 score = 4.38176 sequence = TTTTGTGATGTTTCTCTACATA Gene: Shewana3_2628: outer membrane porin, putative |
*
Shewanella sp MR-4 Site: position = -140 score = 4.38176 sequence = TTTTGTGATGTTTCTCTACATA Gene: Shewmr4_2468: outer membrane porin, putative |
*
Shewanella sp MR-7 Site: position = -140 score = 4.38176 sequence = TTTTGTGATGTTTCTCTACATA Gene: Shewmr7_2536: outer membrane porin, putative |
*
Shewanella baltica OS155 Site: position = -143 score = 4.54093 sequence = TTTTGTGATGTTAATCGACATA Gene: Sbal_1631: outer membrane porin, putative |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -307 score = 4.35854 sequence = AGTCGCGATCTACATCAAATAA Site: position = -140 score = 4.16268 sequence = TTATATGAGATATATCGCCTTT Gene: Sfri_3603: outer membrane porin, putative |
*
Shewanella amazonensis SB2B Site: position = -140 score = 4.53854 sequence = TGTTGTGATTTTTAACACGTTT Site: position = -168 score = 3.88342 sequence = TTATCTGATAGAGATTTCAATT Gene: Sama_1251: outer membrane porin, putative |
Gene: Shew_2481: outer membrane porin, putative |
|
|
|
Gene: Ssed_2557: outer membrane porin, putative |
Gene: Swoo_3084: outer membrane porin, putative |
outer membrane porin, putative |
| CRON 58. | |||||||||||||||||
| ygbA |
*
Shewanella oneidensis MR-1 Site: position = -97 score = 4.05487 sequence = TTTTGTGCGCACCTTCATAAAT Gene: SO0324: nitrosative stress induced protein |
*
Shewanella putrefaciens CN-32 Site: position = -96 score = 4.05487 sequence = TTTTGTGCGCACCTTCATAAAT Gene: Sputcn32_3663: nitrosative stress induced protein |
*
Shewanella sp W3-18-1 Site: position = -96 score = 4.05487 sequence = TTTTGTGCGCACCTTCATAAAT Gene: Sputw3181_3804: nitrosative stress induced protein |
*
Shewanella sp ANA-3 Site: position = -97 score = 4.06993 sequence = TTTTGTGCGCATCTTCATAAAT Gene: Shewana3_3845: nitrosative stress induced protein |
*
Shewanella sp MR-4 Site: position = -97 score = 4.06993 sequence = TTTTGTGCGCATCTTCATAAAT Gene: Shewmr4_3649: nitrosative stress induced protein |
*
Shewanella sp MR-7 Site: position = -97 score = 4.06993 sequence = TTTTGTGCGCATCTTCATAAAT Gene: Shewmr7_0295: nitrosative stress induced protein |
*
Shewanella baltica OS155 Site: position = -96 score = 4.05487 sequence = TTTTGTGCGCACCTTCATAAAT Gene: Sbal_4067: nitrosative stress induced protein |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -142 score = 3.98547 sequence = TTTTGCGATCCCAACCTCAAAA Gene: Sfri_0404: nitrosative stress induced protein |
*
Shewanella amazonensis SB2B Site: position = -94 score = 3.59739 sequence = TTTTGTGCGCATCTTCATGCTT Gene: Sama_3326: nitrosative stress induced protein |
*
Shewanella loihica PV-4 Site: position = -96 score = 4.06993 sequence = TTTTGTGCGCATCTTCATAATT Gene: Shew_0259: nitrosative stress induced protein |
*
Shewanella pealeana ATCC 700345 Site: position = -96 score = 3.89312 sequence = TTTTGTGCACATCTTCAAAGTT Gene: Spea_0303: nitrosative stress induced protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -96 score = 3.99827 sequence = TTTTGTGCACATCTTCAAACTT Gene: Shal_3986: nitrosative stress induced protein |
*
Shewanella piezotolerans WP3 Site: position = -96 score = 4.03726 sequence = TTTTGTGCGCACCTTCAAACTT Gene: swp_2171: nitrosative stress induced protein |
*
Shewanella sediminis HAW-EB3 Site: position = -187 score = 3.90078 sequence = TTTTGTGCACATCTTCATACTT Gene: Ssed_4199: nitrosative stress induced protein |
*
Shewanella woodyi ATCC 51908 Site: position = -82 score = 3.43868 sequence = TTCTGTGCGCACCTTCATAGAT Gene: Swoo_0395: nitrosative stress induced protein |
nitrosative stress induced protein |
| CRON 59. | |||||||||||||||||
| astC |
*
Shewanella oneidensis MR-1 Site: position = -142 score = 4.04968 sequence = AACTGGTATTTTGATCACAATT Gene: SO0617: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella putrefaciens CN-32 Site: position = -142 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: Sputcn32_0645: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella sp W3-18-1 Site: position = -142 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: Sputw3181_3529: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella sp ANA-3 Site: position = -142 score = 4.04968 sequence = AACTGGTATTTTGATCACAATT Gene: Shewana3_0610: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella sp MR-4 Site: position = -142 score = 4.04968 sequence = AACTGGTATTTTGATCACAATT Gene: Shewmr4_0611: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella sp MR-7 Site: position = -308 score = 3.8086 sequence = AATTGTGTAGTTATTCATATTC Gene: Shewmr7_3419: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella baltica OS155 Site: position = -142 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: Sbal_0571: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella denitrificans OS217 Site: position = -136 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: Sden_3193: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -137 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: Sfri_3299: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella amazonensis SB2B Site: position = -142 score = 4.03462 sequence = AACTGGTATTTCGATCACAATT Gene: Sama_3011: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella loihica PV-4 Site: position = -140 score = 3.77468 sequence = AACTGGTATTTTGATCACGTTT Gene: Shew_0578: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella pealeana ATCC 700345 Site: position = -138 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: Spea_3516: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -138 score = 3.68727 sequence = AACTGGCATTCTGATCACATTT Gene: Shal_3610: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella piezotolerans WP3 Site: position = -140 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Gene: swp_0747: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella sediminis HAW-EB3 Site: position = -141 score = 4.13212 sequence = AACTGGTATTTTGATCACATTT Site: position = -121 score = 3.90743 sequence = TTTCGTTATTAATGTCACTTAA Gene: Ssed_0809: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
*
Shewanella woodyi ATCC 51908 Site: position = -172 score = 4.29072 sequence = ATATGTGCTGCTGATCTTATTT Gene: Swoo_0655: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) |
| astA |
Gene: SO0618: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Sputcn32_0646: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Sputw3181_3528: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Shewana3_0611: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Shewmr4_0612: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Shewmr7_3418: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Sbal_0572: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Sden_3192: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Sfri_3298: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Sama_3010: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Shew_0579: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Spea_3515: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Shal_3609: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: swp_0748: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Ssed_0810: Arginine N-succinyltransferase (EC 2.3.1.109) |
Gene: Swoo_0656: Arginine N-succinyltransferase (EC 2.3.1.109) |
Arginine N-succinyltransferase (EC 2.3.1.109) |
| astD |
Gene: SO0619: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Sputcn32_0647: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Sputw3181_3527: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Shewana3_0612: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Shewmr4_0613: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Shewmr7_3417: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Sbal_0573: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Sden_3191: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Sfri_3297: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Sama_3009: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Shew_0580: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Spea_3514: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Shal_3608: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: swp_0749: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Ssed_0811: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Gene: Swoo_0657: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) |
| SO0620 |
Gene: SO0620: FIG008480: hypothetical protein |
Gene: Sputcn32_0648: FIG008480: hypothetical protein |
Gene: Sputw3181_3526: FIG008480: hypothetical protein |
Gene: Shewana3_0613: FIG008480: hypothetical protein |
Gene: Shewmr4_0614: FIG008480: hypothetical protein |
Gene: Shewmr7_3416: FIG008480: hypothetical protein |
Gene: Sbal_0574: FIG008480: hypothetical protein |
|
Gene: Sfri_3296: FIG008480: hypothetical protein |
Gene: Sama_3008: FIG008480: hypothetical protein |
Gene: Shew_0581: FIG008480: hypothetical protein |
Gene: Spea_3513: FIG008480: hypothetical protein |
Gene: Shal_3607: FIG008480: hypothetical protein |
Gene: swp_0750: FIG008480: hypothetical protein |
Gene: Ssed_0812: FIG008480: hypothetical protein |
Gene: Swoo_0658: FIG008480: hypothetical protein |
FIG008480: hypothetical protein |
| CRON 60. | |||||||||||||||||
| scyA |
*
Shewanella oneidensis MR-1 Site: position = -234 score = 3.96983 sequence = CAATTTGATATGGTTCCAATAA Site: position = -125 score = 4.12482 sequence = TGCTGAGATTCTAATCACAAAA Gene: SO0264: cytochrome c-type protein |
*
Shewanella putrefaciens CN-32 Site: position = -229 score = 4.04351 sequence = CAATTTGATGTGGTTCCAATAA Site: position = -129 score = 3.74717 sequence = CGCTGAGATTCTAATCACAAAA Gene: Sputcn32_3726: cytochrome c-type protein |
*
Shewanella sp W3-18-1 Site: position = -229 score = 4.04351 sequence = CAATTTGATGTGGTTCCAATAA Site: position = -129 score = 3.74717 sequence = CGCTGAGATTCTAATCACAAAA Gene: Sputw3181_0189: cytochrome c-type protein |
*
Shewanella sp ANA-3 Site: position = -234 score = 4.04351 sequence = CAATTTGATGTGGTTCCAATAA Site: position = -125 score = 4.12482 sequence = TGCTGAGATTCTAATCACAAAA Gene: Shewana3_0232: cytochrome c-type protein |
*
Shewanella sp MR-4 Site: position = -234 score = 4.04351 sequence = CAATTTGATGTGGTTCCAATAA Site: position = -125 score = 4.12482 sequence = TGCTGAGATTCTAATCACAAAA Gene: Shewmr4_0232: cytochrome c-type protein |
*
Shewanella sp MR-7 Site: position = -234 score = 4.04351 sequence = CAATTTGATGTGGTTCCAATAA Site: position = -125 score = 3.74717 sequence = CGCTGAGATTCTAATCACAAAA Gene: Shewmr7_0227: cytochrome c-type protein |
*
Shewanella baltica OS155 Site: position = -228 score = 3.94327 sequence = CAATATGATGTGGTTCCAATAA Site: position = -128 score = 4.52076 sequence = TGTTGAGATTCTAATCACAAAA Gene: Sbal_0229: cytochrome c-type protein |
*
Shewanella denitrificans OS217 Site: position = -131 score = 3.79793 sequence = AGCTGGGAGGCTTATCACAAAA Site: position = -109 score = 4.10054 sequence = AGGTGTGATTTTATTAACTTTA Gene: Sden_3568: cytochrome c-type protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -233 score = 3.91585 sequence = CAATTTGATATGGTTCCAAAAT Site: position = -133 score = 4.09514 sequence = AGCTGAGATTGTTATCACAAAA Gene: Sfri_0180: cytochrome c-type protein |
*
Shewanella amazonensis SB2B Site: position = -225 score = 3.99267 sequence = CAATTTGATGCAGTTCCAATAA Gene: Sama_0246: cytochrome c-type protein |
*
Shewanella loihica PV-4 Site: position = -131 score = 4.83681 sequence = AATTCTGATATTAATCACAAAA Site: position = -242 score = 3.80276 sequence = CAATTTGATATGCTTCCAAAAA Gene: Shew_0191: cytochrome c-type protein |
*
Shewanella pealeana ATCC 700345 Site: position = -230 score = 4.38557 sequence = CAATTTGATGTAGTTCGAATAT Site: position = -130 score = 3.96819 sequence = TGGCGAGATTAATATCACAAAA Gene: Spea_0216: cytochrome c-type protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -230 score = 4.38557 sequence = CAATTTGATGTAGTTCGAATAT Gene: Shal_4103: cytochrome c-type protein |
*
Shewanella piezotolerans WP3 Site: position = -131 score = 4.80485 sequence = TAACGCGATTTAAATCACAAAT Site: position = -231 score = 4.38557 sequence = CAATTTGATGTAGTTCGAATAT Gene: swp_2044: cytochrome c-type protein |
*
Shewanella sediminis HAW-EB3 Site: position = -145 score = 4.39142 sequence = AGCTTTGATTGAAATCACAAAA Gene: Ssed_4286: cytochrome c-type protein |
*
Shewanella woodyi ATCC 51908 Site: position = -256 score = 3.80276 sequence = CAATTTGATATGCTTCCAAAAA Site: position = -144 score = 3.94285 sequence = TACTTTGATTAAAGTCATAAAA Gene: Swoo_4658: cytochrome c-type protein |
cytochrome c-type protein |
| CRON 61. | |||||||||||||||||
| sodB |
*
Shewanella oneidensis MR-1 Site: position = -91 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: SO2881: superoxide dismutase [Fe] (EC 1.15.1.1) |
*
Shewanella putrefaciens CN-32 Site: position = -91 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: Sputcn32_1687: superoxide dismutase [Fe] (EC 1.15.1.1) |
*
Shewanella sp W3-18-1 Site: position = -91 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: Sputw3181_2338: superoxide dismutase [Fe] (EC 1.15.1.1) |
*
Shewanella sp ANA-3 Site: position = -91 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: Shewana3_1639: superoxide dismutase [Fe] (EC 1.15.1.1) |
*
Shewanella sp MR-4 Site: position = -91 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: Shewmr4_1572: superoxide dismutase [Fe] (EC 1.15.1.1) |
*
Shewanella sp MR-7 Site: position = -91 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: Shewmr7_1647: superoxide dismutase [Fe] (EC 1.15.1.1) |
*
Shewanella baltica OS155 Site: position = -90 score = 4.26429 sequence = AACAATGATTCACATCACAAAT Gene: Sbal_1782: superoxide dismutase [Fe] (EC 1.15.1.1) |
*
Shewanella denitrificans OS217 Site: position = -106 score = 4.30949 sequence = AACAATGATGCACATCACAAAA Gene: Sden_1639: superoxide dismutase [Fe] (EC 1.15.1.1) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -102 score = 4.23581 sequence = AACAATGATTCACATCACAAAA Gene: Sfri_1747: superoxide dismutase [Fe] (EC 1.15.1.1) |
*
Shewanella amazonensis SB2B Site: position = -91 score = 4.2131 sequence = AAGAATGATTCACATCACAGAT Gene: Sama_1920: superoxide dismutase [Fe] (EC 1.15.1.1) |
*
Shewanella loihica PV-4 Site: position = -89 score = 3.79477 sequence = AACAATGATTCACATCACAACT Gene: Shew_1834: superoxide dismutase [Fe] (EC 1.15.1.1) |
Gene: Spea_1963: superoxide dismutase [Fe] (EC 1.15.1.1) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -93 score = 3.73953 sequence = AACAATGATACACTTCACAACT Gene: Shal_2336: superoxide dismutase [Fe] (EC 1.15.1.1) |
Gene: swp_2754: superoxide dismutase [Fe] (EC 1.15.1.1) |
Gene: Ssed_2445: superoxide dismutase [Fe] (EC 1.15.1.1) |
Gene: Swoo_2159: superoxide dismutase [Fe] (EC 1.15.1.1) |
superoxide dismutase [Fe] (EC 1.15.1.1) |
| CRON 62. | |||||||||||||||||
| ccmA |
*
Shewanella oneidensis MR-1 Site: position = -222 score = 4.2202 sequence = TTTTGTGATTAGAATCTCAGCA Gene: SO0263: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella putrefaciens CN-32 Site: position = -213 score = 3.91053 sequence = TTTTGTGATTAGAATCTCAGCG Gene: Sputcn32_3727: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella sp W3-18-1 Site: position = -213 score = 3.91053 sequence = TTTTGTGATTAGAATCTCAGCG Gene: Sputw3181_0188: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella sp ANA-3 Site: position = -222 score = 4.2202 sequence = TTTTGTGATTAGAATCTCAGCA Gene: Shewana3_0231: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella sp MR-4 Site: position = -222 score = 4.2202 sequence = TTTTGTGATTAGAATCTCAGCA Gene: Shewmr4_0231: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella sp MR-7 Site: position = -222 score = 3.91053 sequence = TTTTGTGATTAGAATCTCAGCG Gene: Shewmr7_0226: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella baltica OS155 Site: position = -212 score = 4.44046 sequence = TTTTGTGATTAGAATCTCAACA Gene: Sbal_0228: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella denitrificans OS217 Site: position = -186 score = 3.9967 sequence = TTTTGTGATAAGCCTCCCAGCT Gene: Sden_3569: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella frigidimarina NCIMB 400 Site: position = -213 score = 4.15994 sequence = TTTTGTGATAACAATCTCAGCT Gene: Sfri_0179: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella amazonensis SB2B Site: position = -207 score = 3.79572 sequence = TTTTGTGAGTTCCCTCCCAGCT Gene: Sama_0245: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella loihica PV-4 Site: position = -223 score = 4.83884 sequence = TTTTGTGATTAATATCAGAATT Gene: Shew_0190: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella pealeana ATCC 700345 Site: position = -112 score = 3.75256 sequence = ATATTCGAACTACATCAAATTG Site: position = -212 score = 4.13455 sequence = TTTTGTGATATTAATCTCGCCA Gene: Spea_0215: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella halifaxensis HAW-EB4 Site: position = -212 score = 3.937 sequence = TTTTGTGACATAAACCGTACTA Site: position = -112 score = 3.75256 sequence = ATATTCGAACTACATCAAATTG Gene: Shal_4104: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella piezotolerans WP3 Site: position = -112 score = 3.75256 sequence = ATATTCGAACTACATCAAATTG Site: position = -212 score = 5.00451 sequence = ATTTGTGATTTAAATCGCGTTA Gene: swp_2043: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella sediminis HAW-EB3 Site: position = -223 score = 4.49775 sequence = TTTTGTGATTTCAATCAAAGCT Gene: Ssed_4287: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
*
Shewanella woodyi ATCC 51908 Site: position = -224 score = 4.15542 sequence = TTTTATGACTTTAATCAAAGTA Gene: Swoo_4659: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA |
| ccmB |
Gene: SO0262: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Sputcn32_3728: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Sputw3181_0187: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Shewana3_0230: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Shewmr4_0230: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Shewmr7_0225: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Sbal_0227: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Sden_3570: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Sfri_0178: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Sama_0244: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Shew_0189: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Spea_0214: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Shal_4105: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: swp_2042: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Ssed_4288: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
Gene: Swoo_4660: ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
ABC transporter involved in cytochrome c biogenesis, CcmB subunit |
| ccmC |
Gene: SO0261: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Sputcn32_3729: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Sputw3181_0186: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Shewana3_0229: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Shewmr4_0229: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Shewmr7_0224: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Sbal_0226: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Sden_3571: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Sfri_0177: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Sama_0243: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Shew_0188: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Spea_0213: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Shal_4106: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: swp_2041: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Ssed_4289: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
Gene: Swoo_4661: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE |
| ccmD |
Gene: SO0260: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Sputcn32_3730: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Sputw3181_0185: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Shewana3_0228: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Shewmr4_0228: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Shewmr7_0223: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Sbal_0225: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Sden_3572: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Sfri_0176: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Sama_0242: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Shew_0187: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Spea_0212: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Shal_4107: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: swp_2040: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Ssed_4290: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
Gene: Swoo_4662: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
cytochrome c-type biogenesis protein CcmD, interacts with CcmCE |
| ccmE |
Gene: SO0259: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Sputcn32_3731: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Sputw3181_0184: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Shewana3_0227: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Shewmr4_0227: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Shewmr7_0222: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Sbal_0224: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Sden_3573: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Sfri_0175: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Sama_0241: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Shew_0186: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Spea_0211: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Shal_4108: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: swp_2039: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Ssed_4291: cytochrome c-type biogenesis protein CcmE, heme chaperone |
Gene: Swoo_4663: cytochrome c-type biogenesis protein CcmE, heme chaperone |
cytochrome c-type biogenesis protein CcmE, heme chaperone |
| CRON 63. | |||||||||||||||||
| rarD |
|
|
|
|
|
|
|
|
|
|
Gene: Shew_3322: RarD protein |
*
Shewanella pealeana ATCC 700345 Site: position = -85 score = 3.9001 sequence = CAAGGTGATTCAAGTCACACTC Gene: Spea_1861: RarD protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -85 score = 4.2445 sequence = CAGAGTGATTCAAGTCACACTT Gene: Shal_2568: RarD protein |
|
*
Shewanella sediminis HAW-EB3 Site: position = -88 score = 4.77918 sequence = TAGAGTGATCCAGCTCACATAC Gene: Ssed_0706: RarD protein |
*
Shewanella woodyi ATCC 51908 Site: position = -44 score = 4.50668 sequence = CATAGTGATCAATATCACATTC Gene: Swoo_4258: RarD protein |
RarD protein |
| CRON 64. | |||||||||||||||||
| nqrA-2 |
*
Shewanella oneidensis MR-1 Site: position = -129 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: SO1103: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella putrefaciens CN-32 Site: position = -129 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Sputcn32_0940: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella sp W3-18-1 Site: position = -129 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Sputw3181_3236: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella sp ANA-3 Site: position = -129 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Shewana3_0938: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella sp MR-4 Site: position = -129 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Shewmr4_0936: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella sp MR-7 Site: position = -129 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Shewmr7_0974: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella baltica OS155 Site: position = -128 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Sbal_0924: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella denitrificans OS217 Site: position = -128 score = 4.31963 sequence = CAGCGTGATTGCGATCGCATTA Gene: Sden_0982: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -127 score = 4.27497 sequence = CAGCGTGATTATGATCGCATTT Gene: Sfri_0949: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella amazonensis SB2B Site: position = -127 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: Sama_2539: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella loihica PV-4 Site: position = -131 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Site: position = -73 score = 4.13073 sequence = ATGTTTGAAATCTATCTCATTT Gene: Shew_2881: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella pealeana ATCC 700345 Site: position = -133 score = 4.42614 sequence = CAGCGTGATTCTGATCGCATTT Gene: Spea_3103: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -127 score = 3.73326 sequence = CAGCGTGATTACAGTCGCACTT Gene: Shal_3187: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella piezotolerans WP3 Site: position = -132 score = 4.34811 sequence = CAGCGTGATTGCGATCGCATTT Gene: swp_1167: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella sediminis HAW-EB3 Site: position = -130 score = 4.13099 sequence = CAGCGTGATTGCGGTCGCATTT Gene: Ssed_3431: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
*
Shewanella woodyi ATCC 51908 Site: position = -46 score = 4.04855 sequence = CAGCGTGATTGCGGTCGCAAAT Gene: Swoo_3617: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) |
| nqrB-2 |
Gene: SO1104: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Sputcn32_0941: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Sputw3181_3235: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Shewana3_0939: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Shewmr4_0937: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Shewmr7_0975: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Sbal_0925: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Sden_0983: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Sfri_0950: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Sama_2538: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Shew_2880: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Spea_3102: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Shal_3186: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: swp_1168: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Ssed_3430: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Gene: Swoo_3616: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) |
| nqrC-2 |
Gene: SO1105: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Sputcn32_0942: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Sputw3181_3234: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Shewana3_0940: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Shewmr4_0938: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Shewmr7_0976: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Sbal_0926: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Sden_0984: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Sfri_0951: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Sama_2537: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Shew_2879: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Spea_3101: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Shal_3185: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: swp_1169: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Ssed_3429: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Gene: Swoo_3615: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) |
| nqrD-1 |
Gene: SO1106: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Sputcn32_0943: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Sputw3181_3233: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Shewana3_0941: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Shewmr4_0939: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Shewmr7_0977: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Sbal_0927: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Sden_0985: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Sfri_0952: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Sama_2536: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Shew_2878: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Spea_3100: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Shal_3184: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: swp_1170: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Ssed_3428: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Gene: Swoo_3614: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) |
| nqrE-2 |
Gene: SO1107: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Sputcn32_0944: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Sputw3181_3232: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Shewana3_0942: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Shewmr4_0940: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Shewmr7_0978: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Sbal_0928: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Sden_0986: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Sfri_0953: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Sama_2535: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Shew_2877: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Spea_3099: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Shal_3183: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: swp_1171: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Ssed_3427: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Gene: Swoo_3613: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) |
| nqrF-2 |
Gene: SO1108: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Sputcn32_0945: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Sputw3181_3231: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Shewana3_0943: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Shewmr4_0941: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Shewmr7_0979: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Sbal_0929: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Sden_0987: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Sfri_0954: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Sama_2534: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Shew_2876: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Spea_3098: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Shal_3182: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: swp_1172: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Ssed_3426: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Gene: Swoo_3612: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-) |
| CRON 65. | |||||||||||||||||
| hemC |
*
Shewanella oneidensis MR-1 Site: position = -132 score = 4.52477 sequence = AAATGAGAGGTCCATCACACTT Site: position = -172 score = 3.8681 sequence = GATTGTGCTCATGTTAACACTT Gene: SO4313: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella putrefaciens CN-32 Site: position = -173 score = 4.13546 sequence = AAGTGTGCTTATGTTAACACTT Site: position = -133 score = 5.19295 sequence = AAATGAGATCTGCATCACATTT Gene: Sputcn32_3587: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella sp W3-18-1 Site: position = -173 score = 4.13546 sequence = AAGTGTGCTTATGTTAACACTT Site: position = -133 score = 5.19295 sequence = AAATGAGATCTGCATCACATTT Gene: Sputw3181_3726: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella sp ANA-3 Site: position = -172 score = 4.23847 sequence = AAGTGTGCTCATGTTAACACTT Site: position = -132 score = 4.26867 sequence = AAATGAGAAGTTCGTCACACTT Gene: Shewana3_0386: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella sp MR-4 Site: position = -132 score = 4.26867 sequence = AAATGAGAAGTTCGTCACACTT Site: position = -172 score = 4.23847 sequence = AAGTGTGCTCATGTTAACACTT Gene: Shewmr4_0388: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella sp MR-7 Site: position = -132 score = 4.26867 sequence = AAATGAGAAGTTCGTCACACTT Site: position = -172 score = 4.23847 sequence = AAGTGTGCTCATGTTAACACTT Gene: Shewmr7_3638: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella baltica OS155 Site: position = -132 score = 4.91933 sequence = AAATGTGAAGTCCGTCACACTT Gene: Sbal_4000: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella denitrificans OS217 Site: position = -85 score = 3.90673 sequence = AAATCTGCTTTGCTTCAAACAT Gene: Sden_0388: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -167 score = 3.96383 sequence = AATGGTGATCATCGTAGCATTT Gene: Sfri_0440: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella amazonensis SB2B Site: position = -89 score = 5.14021 sequence = ATTTGCGATAGAGATCACATTT Gene: Sama_3254: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella loihica PV-4 Site: position = -119 score = 4.7007 sequence = ATTTGAGAGCTGGATCACACTT Gene: Shew_0318: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella pealeana ATCC 700345 Site: position = -133 score = 4.98423 sequence = AAATGCGATCAAGATCACACTT Gene: Spea_0373: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -133 score = 5.10167 sequence = AAATGTGATCAACATCACGCTT Gene: Shal_3917: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella piezotolerans WP3 Site: position = -40 score = 4.29959 sequence = AAATGTAATCCGTATCGCAACA Gene: swp_0402: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella sediminis HAW-EB3 Site: position = -133 score = 4.87801 sequence = AAATGAGATCAAGATCACACTT Gene: Ssed_4133: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Shewanella woodyi ATCC 51908 Site: position = -229 score = 4.62137 sequence = AAATGAGACCAAGATCACACTT Gene: Swoo_0483: Porphobilinogen deaminase (EC 2.5.1.61) |
Porphobilinogen deaminase (EC 2.5.1.61) |
| hemD |
Gene: SO4314: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Sputcn32_3588: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Sputw3181_3727: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Shewana3_0385: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Shewmr4_0387: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Shewmr7_3639: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Sbal_4001: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Sden_0387: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Sfri_0439: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Sama_3255: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Shew_0317: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Spea_0372: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Shal_3918: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: swp_0400: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Ssed_4134: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Swoo_0482: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Uroporphyrinogen-III synthase (EC 4.2.1.75) |
| hemX |
Gene: SO4315: Homolog of E. coli HemX protein |
Gene: Sputcn32_3589: Homolog of E. coli HemX protein |
Gene: Sputw3181_3728: Homolog of E. coli HemX protein |
Gene: Shewana3_0384: Homolog of E. coli HemX protein |
Gene: Shewmr4_0386: Homolog of E. coli HemX protein |
Gene: Shewmr7_3640: Homolog of E. coli HemX protein |
Gene: Sbal_4002: Homolog of E. coli HemX protein |
Gene: Sden_0386: Homolog of E. coli HemX protein |
Gene: Sfri_0438: Homolog of E. coli HemX protein |
Gene: Sama_3256: Homolog of E. coli HemX protein |
Gene: Shew_0316: Homolog of E. coli HemX protein |
Gene: Spea_0371: Homolog of E. coli HemX protein |
Gene: Shal_3919: Homolog of E. coli HemX protein |
Gene: swp_0399: Homolog of E. coli HemX protein |
Gene: Ssed_4135: Homolog of E. coli HemX protein |
Gene: Swoo_0481: Homolog of E. coli HemX protein |
Homolog of E. coli HemX protein |
| hemY |
Gene: SO4316: HemY domain-containing protein |
Gene: Sputcn32_3590: HemY domain-containing protein |
Gene: Sputw3181_3729: HemY domain-containing protein |
Gene: Shewana3_0383: HemY domain-containing protein |
Gene: Shewmr4_0385: HemY domain-containing protein |
Gene: Shewmr7_3641: HemY domain-containing protein |
Gene: Sbal_4003: HemY domain-containing protein |
Gene: Sden_0385: HemY domain-containing protein |
Gene: Sfri_0437: HemY domain-containing protein |
Gene: Sama_3257: HemY domain-containing protein |
Gene: Shew_0315: HemY domain-containing protein |
Gene: Spea_0370: HemY domain-containing protein |
Gene: Shal_3920: HemY domain-containing protein |
Gene: swp_0398: HemY domain-containing protein |
Gene: Ssed_4136: HemY domain-containing protein |
Gene: Swoo_0480: HemY domain-containing protein |
HemY domain-containing protein |
| CRON 66. | |||||||||||||||||
| fumB |
*
Shewanella oneidensis MR-1 Site: position = -105 score = 4.55025 sequence = AAATGTGATGTAGCCCAAAAAG Gene: SO2222: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella putrefaciens CN-32 Site: position = -103 score = 4.55025 sequence = AAATGTGATGTAGCCCAAAAAG Gene: Sputcn32_1807: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella sp W3-18-1 Site: position = -103 score = 4.55025 sequence = AAATGTGATGTAGCCCAAAAAG Gene: Sputw3181_2218: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella sp ANA-3 Site: position = -104 score = 4.55025 sequence = AAATGTGATGTAGCCCAAAAAG Gene: Shewana3_2302: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella sp MR-4 Site: position = -104 score = 4.55025 sequence = AAATGTGATGTAGCCCAAAAAG Gene: Shewmr4_2124: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella sp MR-7 Site: position = -104 score = 4.55025 sequence = AAATGTGATGTAGCCCAAAAAG Gene: Shewmr7_2200: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella baltica OS155 Site: position = -103 score = 4.55025 sequence = AAATGTGATGTAGCCCAAAAAG Gene: Sbal_1918: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella denitrificans OS217 Site: position = -131 score = 3.92555 sequence = AAATGTGATGTAGCCCCAAAAG Gene: Sden_1912: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -122 score = 4.55025 sequence = AAATGTGATGTAGCCCAAAAAG Gene: Sfri_2156: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella amazonensis SB2B Site: position = -144 score = 4.16165 sequence = ACTTGTGATGTAGCCCAAAGAT Gene: Sama_1688: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella loihica PV-4 Site: position = -111 score = 3.90674 sequence = AAATGTGATGTTCCCCTAAAAG Site: position = -73 score = 4.78601 sequence = TATTGTGAACGGATTCAAAAAA Gene: Shew_1904: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella pealeana ATCC 700345 Site: position = -162 score = 4.33731 sequence = AAATGTGATGTTTAACTCAAAC Gene: Spea_2038: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -162 score = 4.33731 sequence = AAATGTGATGTTTAACTCAAAC Gene: Shal_2256: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella piezotolerans WP3 Site: position = -162 score = 4.37022 sequence = AAATGTGATGTTTAACTCAAAG Gene: swp_2633: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
*
Shewanella sediminis HAW-EB3 Site: position = -194 score = 3.83306 sequence = AAATGTGATATTCCCCTAAAAG Gene: Ssed_2358: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
Gene: Swoo_2227: Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
Fumarate hydratase class I, aerobic (EC 4.2.1.2) |
| CRON 67. | |||||||||||||||||
| SO3890 |
*
Shewanella oneidensis MR-1 Site: position = -196 score = 4.63865 sequence = CCATGTGATCTGGTTCAAATTT Gene: SO3890: methyl-accepting chemotaxis protein |
*
Shewanella putrefaciens CN-32 Site: position = -185 score = 4.42861 sequence = TTGTGTGACACGAATCAAGTTT Gene: Sputcn32_0776: methyl-accepting chemotaxis protein |
*
Shewanella sp W3-18-1 Site: position = -185 score = 4.42861 sequence = TTGTGTGACACGAATCAAGTTT Gene: Sputw3181_3399: methyl-accepting chemotaxis protein |
*
Shewanella sp ANA-3 Site: position = -181 score = 4.8846 sequence = CTGTGTGATGTGGTTCAAATTT Gene: Shewana3_0739: methyl-accepting chemotaxis protein |
*
Shewanella sp MR-4 Site: position = -198 score = 4.25712 sequence = CCCTGTGATCTAGCTCAAATTT Gene: Shewmr4_3223: methyl-accepting chemotaxis protein |
*
Shewanella sp MR-7 Site: position = -198 score = 4.25712 sequence = CCCTGTGATCTAGCTCAAATTT Gene: Shewmr7_0766: methyl-accepting chemotaxis protein |
*
Shewanella baltica OS155 Site: position = -196 score = 3.69134 sequence = CTCTGTGATCTTGGTCGTATTC Gene: Sbal_3564: methyl-accepting chemotaxis protein |
|
|
*
Shewanella amazonensis SB2B Site: position = -128 score = 4.66014 sequence = TAATTTGATGTGAATCAACTTT Gene: Sama_0550: methyl-accepting chemotaxis protein |
Gene: Shew_0492: methyl-accepting chemotaxis protein |
|
|
|
|
|
methyl-accepting chemotaxis protein |
| CRON 68. | |||||||||||||||||
| cydA |
*
Shewanella oneidensis MR-1 Site: position = -203 score = 4.15026 sequence = TAGTGTGACTAGGGTCTCAGTA Gene: SO3286: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella putrefaciens CN-32 Site: position = -204 score = 4.27178 sequence = TAGTGTGACGCTTGTCCCAATA Gene: Sputcn32_2641: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella sp W3-18-1 Site: position = -204 score = 4.27178 sequence = TAGTGTGACGCTTGTCCCAATA Gene: Sputw3181_1366: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella sp ANA-3 Site: position = -203 score = 4.15026 sequence = TAGTGTGACTAGGGTCTCAGTA Gene: Shewana3_1241: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella sp MR-4 Site: position = -203 score = 4.15026 sequence = TAGTGTGACTAGGGTCTCAGTA Gene: Shewmr4_1239: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella sp MR-7 Site: position = -203 score = 4.15026 sequence = TAGTGTGACTAGGGTCTCAGTA Gene: Shewmr7_1310: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella baltica OS155 Site: position = -207 score = 4.43706 sequence = TAGTGTGACTCGCGTCTCAATA Gene: Sbal_2979: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella denitrificans OS217 Site: position = -157 score = 4.0613 sequence = TAAATTGATCTAAATCAATTTA Gene: Sden_1274: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella frigidimarina NCIMB 400 Site: position = -240 score = 4.22365 sequence = AAATCTAATGCTGGTCACATAA Gene: Sfri_1142: cytochrome d ubiquinol oxidase, subunit I, CydA |
Gene: Sama_2349: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella loihica PV-4 Site: position = -206 score = 4.73741 sequence = TTTTGTGAGCCGCCTCTCAAAA Gene: Shew_1302: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella pealeana ATCC 700345 Site: position = -235 score = 3.95186 sequence = ATTCGGGATGGGTGTCACAAAG Gene: Spea_1318: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella halifaxensis HAW-EB4 Site: position = -234 score = 4.13914 sequence = ATTTGGGATGAGTATCACGGAA Gene: Shal_1381: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella piezotolerans WP3 Site: position = -231 score = 4.15335 sequence = AGGTGAGACGGTGATCACAATA Gene: swp_1469: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella sediminis HAW-EB3 Site: position = -203 score = 4.02682 sequence = TAGTGTGAAGTTCGTCGTAAAA Gene: Ssed_3118: cytochrome d ubiquinol oxidase, subunit I, CydA |
*
Shewanella woodyi ATCC 51908 Site: position = -204 score = 3.76698 sequence = TTTTGTGAGATCGGTCGGAAAG Gene: Swoo_1565: cytochrome d ubiquinol oxidase, subunit I, CydA |
cytochrome d ubiquinol oxidase, subunit I, CydA |
| cydB |
Gene: SO3285: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Sputcn32_2640: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Sputw3181_1367: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Shewana3_1242: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Shewmr4_1240: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Shewmr7_1311: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Sbal_2978: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Sden_1275: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Sfri_1143: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Sama_2348: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Shew_1303: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Spea_1319: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Shal_1382: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: swp_1470: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Ssed_3117: cytochrome d ubiquinol oxidase, subunit II, CydB |
Gene: Swoo_1566: cytochrome d ubiquinol oxidase, subunit II, CydB |
cytochrome d ubiquinol oxidase, subunit II, CydB |
| CRON 69. | |||||||||||||||||
| narQ |
*
Shewanella oneidensis MR-1 Site: position = -151 score = 4.50484 sequence = AATAGTGTTGTTGTTCACACTT Site: position = -174 score = 3.69559 sequence = AAGTTTGCGCTAGATCAAAATG Gene: SO3981: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
*
Shewanella putrefaciens CN-32 Site: position = -114 score = 4.50484 sequence = AATAGTGTTGTTGTTCACACTT Gene: Sputcn32_0684: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
*
Shewanella sp W3-18-1 Site: position = -114 score = 4.50484 sequence = AATAGTGTTGTTGTTCACACTT Gene: Sputw3181_3487: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
*
Shewanella sp ANA-3 Site: position = -115 score = 4.50484 sequence = AATAGTGTTGTTGTTCACACTT Site: position = -138 score = 3.69559 sequence = AAGTTTGCGCTAGATCAAAATG Gene: Shewana3_0657: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
*
Shewanella sp MR-4 Site: position = -139 score = 3.69559 sequence = AAGTTTGCGCTAGATCAAAATG Site: position = -116 score = 4.50484 sequence = AATAGTGTTGTTGTTCACACTT Gene: Shewmr4_0658: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
*
Shewanella sp MR-7 Site: position = -139 score = 3.69559 sequence = AAGTTTGCGCTAGATCAAAATG Site: position = -116 score = 4.50484 sequence = AATAGTGTTGTTGTTCACACTT Gene: Shewmr7_3364: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
*
Shewanella baltica OS155 Site: position = -121 score = 3.69559 sequence = AAGTTTGCGCTAGATCAAAATG Site: position = -98 score = 4.50218 sequence = AAAGGTGTTGTTGTTCACATTT Gene: Sbal_0793: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -140 score = 3.86071 sequence = AAACAGGATGTATCTCACAGTT Gene: Sfri_0621: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
*
Shewanella amazonensis SB2B Site: position = -112 score = 3.95721 sequence = GGATGTGTTATTGTTCACACTT Gene: Sama_0647: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
*
Shewanella loihica PV-4 Site: position = -113 score = 4.36363 sequence = GAATGTGTTGTTGGTCACATTT Site: position = -136 score = 3.87512 sequence = AAACTTGAGGCAGATCATAATG Gene: Shew_0843: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
*
Shewanella pealeana ATCC 700345 Site: position = -109 score = 3.95526 sequence = GAACGTGTTGTTGCTCACACTT Site: position = -81 score = 3.84835 sequence = ATTTGTTAATGTAATCAAGTAT Gene: Spea_0830: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -111 score = 4.28165 sequence = GAATGTGTTGTTGCTCACACTT Gene: Shal_0885: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
Gene: swp_3960: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
*
Shewanella sediminis HAW-EB3 Site: position = -113 score = 4.79759 sequence = AAATGTGGTGTTGCTCACACTT Gene: Ssed_0930: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
*
Shewanella woodyi ATCC 51908 Site: position = -112 score = 4.75006 sequence = AAACGTGTTGTTGCTCACATTT Gene: Swoo_0971: Nitrate/nitrite sensor protein (EC 2.7.3.-) |
Nitrate/nitrite sensor protein (EC 2.7.3.-) |
| narP |
Gene: SO3982: Nitrate/nitrite response regulator protein |
Gene: Sputcn32_0683: Nitrate/nitrite response regulator protein |
Gene: Sputw3181_3488: Nitrate/nitrite response regulator protein |
Gene: Shewana3_0656: Nitrate/nitrite response regulator protein |
Gene: Shewmr4_0657: Nitrate/nitrite response regulator protein |
Gene: Shewmr7_3365: Nitrate/nitrite response regulator protein |
Gene: Sbal_0792: Nitrate/nitrite response regulator protein |
|
Gene: Sfri_0620: Nitrate/nitrite response regulator protein |
Gene: Sama_0646: Nitrate/nitrite response regulator protein |
Gene: Shew_0842: Nitrate/nitrite response regulator protein |
Gene: Spea_0829: Nitrate/nitrite response regulator protein |
Gene: Shal_0884: Nitrate/nitrite response regulator protein |
Gene: swp_3961: Nitrate/nitrite response regulator protein |
Gene: Ssed_0929: Nitrate/nitrite response regulator protein |
Gene: Swoo_0970: Nitrate/nitrite response regulator protein |
Nitrate/nitrite response regulator protein |
| CRON 70. | |||||||||||||||||
| udp |
*
Shewanella oneidensis MR-1 Site: position = -92 score = 4.12525 sequence = TTCTGTGATCAAGTTAACCTTC Gene: SO4133: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella putrefaciens CN-32 Site: position = -230 score = 4.37877 sequence = AAGTTAGATCTGGTTCACACTT Site: position = -92 score = 4.12525 sequence = TTCTGTGATCAAGTTAACCTTC Gene: Sputcn32_0543: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella sp W3-18-1 Site: position = -92 score = 4.12525 sequence = TTCTGTGATCAAGTTAACCTTC Site: position = -230 score = 4.37877 sequence = AAGTTAGATCTGGTTCACACTT Gene: Sputw3181_3629: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella sp ANA-3 Site: position = -92 score = 4.12525 sequence = TTCTGTGATCAAGTTAACCTTC Gene: Shewana3_3680: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella sp MR-4 Site: position = -92 score = 4.12525 sequence = TTCTGTGATCAAGTTAACCTTC Gene: Shewmr4_3505: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella sp MR-7 Site: position = -92 score = 4.12525 sequence = TTCTGTGATCAAGTTAACCTTC Gene: Shewmr7_0447: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella baltica OS155 Site: position = -229 score = 3.82686 sequence = GATTAGGATCTGGTTCACACTT Site: position = -92 score = 4.12525 sequence = TTCTGTGATCAAGTTAACCTTC Gene: Sbal_3852: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella denitrificans OS217 Site: position = -92 score = 4.39866 sequence = AACTGTGATGAAGTTAACCAAA Gene: Sden_3074: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -244 score = 4.69301 sequence = TAACTTGATGTAAATCACGTTA Site: position = -92 score = 4.83478 sequence = ATATGTGATCAAGTTAACCTTA Gene: Sfri_3403: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella amazonensis SB2B Site: position = -92 score = 4.68199 sequence = ATTCGTGATCCAGTTAACCTTA Gene: Sama_0412: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella loihica PV-4 Site: position = -92 score = 4.6412 sequence = AAGTGTGATCAGGTTAACCTTA Gene: Shew_3390: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella pealeana ATCC 700345 Site: position = -92 score = 4.67325 sequence = AAGTGTGATCGGCTTAACCTTT Gene: Spea_0460: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -92 score = 4.59757 sequence = AAGTGTGATCAGTTTAACCTTT Gene: Shal_0535: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella piezotolerans WP3 Site: position = -92 score = 4.6412 sequence = AAGTGTGATCAGGTTAACCTTA Site: position = -310 score = 4.69492 sequence = ATTTGTGAGTTAGATCATGTTT Gene: swp_4702: Uridine phosphorylase (EC 2.4.2.3) |
*2
Shewanella sediminis HAW-EB3 Site: position = -92 score = 4.74986 sequence = AAGTGTGATCGAGCTAACCTTT Gene: Ssed_0461: Uridine phosphorylase (EC 2.4.2.3) Site: position = -84 score = 3.8854 sequence = CAATGTAATATGCAAAACATTT Gene: Ssed_2504: Uridine phosphorylase (EC 2.4.2.3) |
*
Shewanella woodyi ATCC 51908 Site: position = -272 score = 4.87907 sequence = AAATGTGATGTGGGTCAACAAA Site: position = -92 score = 4.6795 sequence = AAGTGTGATCAAGTTAACCTTA Gene: Swoo_4509: Uridine phosphorylase (EC 2.4.2.3) |
Uridine phosphorylase (EC 2.4.2.3) |
| CRON 71. | |||||||||||||||||
| SO4520 |
*
Shewanella oneidensis MR-1 Site: position = -172 score = 4.40817 sequence = AAACATGATCTGCTTAACAAAA Gene: SO4520: Oxygen-independent coproporphyrinogen III oxidase, putative |
*
Shewanella putrefaciens CN-32 Site: position = -172 score = 4.40817 sequence = AAACATGATCTGCTTAACAAAA Gene: Sputcn32_3506: Oxygen-independent coproporphyrinogen III oxidase, putative |
*
Shewanella sp W3-18-1 Site: position = -172 score = 4.40817 sequence = AAACATGATCTGCTTAACAAAA Gene: Sputw3181_0400: Oxygen-independent coproporphyrinogen III oxidase, putative |
*
Shewanella sp ANA-3 Site: position = -172 score = 4.40817 sequence = AAACATGATCTGCTTAACAAAA Gene: Shewana3_3926: Oxygen-independent coproporphyrinogen III oxidase, putative |
*
Shewanella sp MR-4 Site: position = -172 score = 4.40817 sequence = AAACATGATCTGCTTAACAAAA Gene: Shewmr4_3730: Oxygen-independent coproporphyrinogen III oxidase, putative |
*
Shewanella sp MR-7 Site: position = -172 score = 4.40817 sequence = AAACATGATCTGCTTAACAAAA Gene: Shewmr7_3801: Oxygen-independent coproporphyrinogen III oxidase, putative |
*
Shewanella baltica OS155 Site: position = -172 score = 4.40817 sequence = AAACATGATCTGCTTAACAAAA Gene: Sbal_0219: Oxygen-independent coproporphyrinogen III oxidase, putative |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -182 score = 4.43664 sequence = AAACATGATCTGCTTAACAAAT Gene: Sfri_0076: Oxygen-independent coproporphyrinogen III oxidase, putative |
*
Shewanella amazonensis SB2B Site: position = -171 score = 3.86458 sequence = AAATATGCGCTGCTTAACAAAA Gene: Sama_3604: Oxygen-independent coproporphyrinogen III oxidase, putative |
*
Shewanella loihica PV-4 Site: position = -182 score = 4.077 sequence = AAACATGACATGCTTAACAATT Gene: Shew_0073: Oxygen-independent coproporphyrinogen III oxidase, putative |
*
Shewanella pealeana ATCC 700345 Site: position = -164 score = 4.44095 sequence = AAGTATGATCCGCTTAACAAAA Gene: Spea_4126: Oxygen-independent coproporphyrinogen III oxidase, putative |
*
Shewanella halifaxensis HAW-EB4 Site: position = -164 score = 4.18431 sequence = AAGTATGACCCGCTTAACAAAA Gene: Shal_0116: Oxygen-independent coproporphyrinogen III oxidase, putative |
*
Shewanella piezotolerans WP3 Site: position = -166 score = 4.20876 sequence = AAGTATGACTTACTTAACAAAA Gene: swp_5018: Oxygen-independent coproporphyrinogen III oxidase, putative |
*
Shewanella sediminis HAW-EB3 Site: position = -203 score = 4.04852 sequence = AAACATGACTTGCTTAACAAAA Gene: Ssed_4414: Oxygen-independent coproporphyrinogen III oxidase, putative |
*
Shewanella woodyi ATCC 51908 Site: position = -184 score = 3.95938 sequence = AAACATGACTCGCTTAACAAAA Gene: Swoo_4806: Oxygen-independent coproporphyrinogen III oxidase, putative |
Oxygen-independent coproporphyrinogen III oxidase, putative |
| CRON 72. | |||||||||||||||||
| SO4232 |
*
Shewanella oneidensis MR-1 Site: position = -202 score = 4.35851 sequence = AAAAGTGATTTTCGTCACTAAA Gene: SO4232: long-chain fatty acid transport protein |
*
Shewanella putrefaciens CN-32 Site: position = -195 score = 4.58813 sequence = AAAAGTGATTTTTATCACTAAA Gene: Sputcn32_0475: long-chain fatty acid transport protein |
*
Shewanella sp W3-18-1 Site: position = -195 score = 4.58813 sequence = AAAAGTGATTTTTATCACTAAA Gene: Sputw3181_0378: long-chain fatty acid transport protein |
*
Shewanella sp ANA-3 Site: position = -201 score = 4.59856 sequence = AAAAGTGATTTATCTCACTAAA Gene: Shewana3_3757: long-chain fatty acid transport protein |
*
Shewanella sp MR-4 Site: position = -201 score = 4.59856 sequence = AAAAGTGATTTATCTCACTAAA Gene: Shewmr4_3584: long-chain fatty acid transport protein |
*
Shewanella sp MR-7 Site: position = -201 score = 4.59856 sequence = AAAAGTGATTTATCTCACTAAA Gene: Shewmr7_0372: long-chain fatty acid transport protein |
*
Shewanella baltica OS155 Site: position = -207 score = 4.28776 sequence = AATGGTGATATTGGTCACTAAA Gene: Sbal_0390: long-chain fatty acid transport protein |
Gene: Sden_0340: long-chain fatty acid transport protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -169 score = 4.90084 sequence = AAGTTTGATCATGATCACAATT Gene: Sfri_3816: long-chain fatty acid transport protein |
2
Shewanella amazonensis SB2B Gene: Sama_2552: long-chain fatty acid transport protein Gene: Sama_0339: long-chain fatty acid transport protein |
Gene: Shew_3468: long-chain fatty acid transport protein |
*
Shewanella pealeana ATCC 700345 Site: position = -164 score = 3.76872 sequence = AAGTGTGATCTACTCTGTATTT Gene: Spea_3824: long-chain fatty acid transport protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -114 score = 3.76605 sequence = TTTTGTGCTGTTTTTTATAAAG Gene: Shal_0442: long-chain fatty acid transport protein |
Gene: swp_2217: long-chain fatty acid transport protein |
Gene: Ssed_0397: long-chain fatty acid transport protein |
Gene: Swoo_4546: long-chain fatty acid transport protein |
long-chain fatty acid transport protein |
| Sden_0341 |
|
|
|
|
|
|
|
Gene: Sden_0341: hypothetical protein |
|
Gene: Sama_0340: hypothetical protein |
Gene: Shew_3467: hypothetical protein |
Gene: Spea_3823: hypothetical protein |
Gene: Shal_0443: hypothetical protein |
Gene: swp_2218: hypothetical protein |
Gene: Ssed_0398: hypothetical protein |
Gene: Swoo_4545: hypothetical protein |
hypothetical protein |
| glpK |
Gene: SO4230: glycerol kinase (EC 2.7.1.30) |
Gene: Sputcn32_0476: glycerol kinase (EC 2.7.1.30) |
Gene: Sputw3181_0379: glycerol kinase (EC 2.7.1.30) |
Gene: Shewana3_3756: glycerol kinase (EC 2.7.1.30) |
Gene: Shewmr4_3583: glycerol kinase (EC 2.7.1.30) |
Gene: Shewmr7_0373: glycerol kinase (EC 2.7.1.30) |
Gene: Sbal_0391: glycerol kinase (EC 2.7.1.30) |
Gene: Sden_0342: glycerol kinase (EC 2.7.1.30) |
Gene: Sfri_3815: glycerol kinase (EC 2.7.1.30) |
Gene: Sama_0341: glycerol kinase (EC 2.7.1.30) |
Gene: Shew_3466: glycerol kinase (EC 2.7.1.30) |
Gene: Spea_3822: glycerol kinase (EC 2.7.1.30) |
Gene: Shal_0444: glycerol kinase (EC 2.7.1.30) |
Gene: swp_2219: glycerol kinase (EC 2.7.1.30) |
Gene: Ssed_0399: glycerol kinase (EC 2.7.1.30) |
Gene: Swoo_4544: glycerol kinase (EC 2.7.1.30) |
glycerol kinase (EC 2.7.1.30) |
| CRON 73. | |||||||||||||||||
| lldP |
*
Shewanella oneidensis MR-1 Site: position = -262 score = 4.61769 sequence = TTAAGTGACACCGATCACAGTT Site: position = -180 score = 4.15058 sequence = CAAAATGATCTAGATCATATAA Gene: SO1522: L-lactate permease |
*
Shewanella putrefaciens CN-32 Site: position = -179 score = 3.97279 sequence = CAAGATGATCTAGATCATATTA Site: position = -261 score = 4.66376 sequence = CTAAGTGATCGAGATCACAGAT Gene: Sputcn32_1272: L-lactate permease |
*
Shewanella sp W3-18-1 Site: position = -179 score = 3.97279 sequence = CAAGATGATCTAGATCATATTA Site: position = -261 score = 4.66376 sequence = CTAAGTGATCGAGATCACAGAT Gene: Sputw3181_2834: L-lactate permease |
*
Shewanella sp ANA-3 Site: position = -263 score = 4.11137 sequence = TCGAGTGACATGGATCACAGTT Site: position = -181 score = 4.15058 sequence = CAAAATGATCTAGATCATATTA Gene: Shewana3_2904: L-lactate permease |
*
Shewanella sp MR-4 Site: position = -263 score = 4.14968 sequence = TCGAGTGACATAGATCACAGTT Site: position = -181 score = 4.15058 sequence = CAAAATGATCTAGATCATATTA Gene: Shewmr4_2734: L-lactate permease |
*
Shewanella sp MR-7 Site: position = -263 score = 4.14968 sequence = TCGAGTGACATAGATCACAGTT Site: position = -181 score = 4.15058 sequence = CAAAATGATCTAGATCATATTA Gene: Shewmr7_2807: L-lactate permease |
*
Shewanella baltica OS155 Site: position = -263 score = 4.1593 sequence = CTAAGTGATCACTGTCACAGAT Site: position = -181 score = 3.97279 sequence = CAAGATGATCTAGATCATATTA Gene: Sbal_1354: L-lactate permease |
Gene: Sden_2574: L-lactate permease |
*
Shewanella frigidimarina NCIMB 400 Site: position = -298 score = 4.30183 sequence = TCTAGTGAGCCCCTTCACATTA Site: position = -197 score = 3.70305 sequence = AAACGTGACCTCAAACACGCAC Gene: Sfri_2793: L-lactate permease |
Gene: Sama_2439: L-lactate permease |
*
Shewanella loihica PV-4 Site: position = -166 score = 4.20147 sequence = CATAATGATCTAGATCATATTT Site: position = -247 score = 4.18371 sequence = ACCAGTGATAGAGATCACACTT Gene: Shew_3135: L-lactate permease |
*
Shewanella pealeana ATCC 700345 Site: position = -241 score = 4.14276 sequence = AACCGTGACAGATCTCACAATC Site: position = -276 score = 3.95699 sequence = TTAGGTGACACAGGTCACACCA Gene: Spea_2994: L-lactate permease |
*
Shewanella halifaxensis HAW-EB4 Site: position = -300 score = 4.48467 sequence = TTACGTGACACGGATCACAGAG Site: position = -265 score = 4.52068 sequence = AACTGTGATCAGTCTCACTAAT Gene: Shal_3083: L-lactate permease |
Gene: swp_1813: L-lactate permease |
Gene: Ssed_0907: L-lactate permease |
|
L-lactate permease |
| dldD |
Gene: SO1521: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
Gene: Sputcn32_1271: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
Gene: Sputw3181_2835: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
Gene: Shewana3_2905: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
Gene: Shewmr4_2735: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
Gene: Shewmr7_2808: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
Gene: Sbal_1353: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
|
Gene: Sfri_2794: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
Gene: Sama_2440: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
Gene: Shew_3136: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
Gene: Spea_2995: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
Gene: Shal_3084: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
Gene: swp_1812: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
Gene: Ssed_0908: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
|
D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing |
| CRON 74. | |||||||||||||||||
| fadE2 |
*
Shewanella oneidensis MR-1 Site: position = -72 score = 4.79509 sequence = AATTGTGATCGCAATCAACAAA Gene: SO2536: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella putrefaciens CN-32 Site: position = -72 score = 4.62723 sequence = AATTGTGATCGCCATCAATAAA Gene: Sputcn32_1791: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella sp W3-18-1 Site: position = -72 score = 4.62723 sequence = AATTGTGATCGCCATCAATAAA Gene: Sputw3181_2234: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella sp ANA-3 Site: position = -72 score = 4.79509 sequence = AATTGTGATCGCAATCAACAAA Gene: Shewana3_2323: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella sp MR-4 Site: position = -72 score = 4.79509 sequence = AATTGTGATCGCAATCAACAAA Gene: Shewmr4_2146: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella sp MR-7 Site: position = -72 score = 4.79509 sequence = AATTGTGATCGCAATCAACAAA Gene: Shewmr7_2223: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella baltica OS155 Site: position = -72 score = 4.79509 sequence = AATTGTGATCGCAATCAACAAA Gene: Sbal_2306: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella denitrificans OS217 Site: position = -66 score = 3.77159 sequence = ACTTGTGAATAGGATCATCATA Gene: Sden_1764: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -67 score = 3.83542 sequence = TCTTGTGAATGAGATCAATAAT Gene: Sfri_1869: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella amazonensis SB2B Site: position = -64 score = 4.29439 sequence = ACTTGTGATCAGGATCGCTTAT Gene: Sama_1870: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella loihica PV-4 Site: position = -71 score = 4.85621 sequence = AATTGTGATTATGGTCATATAA Gene: Shew_2108: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella pealeana ATCC 700345 Site: position = -70 score = 4.46017 sequence = AATTGTGAGATAGAACTCAAAA Gene: Spea_2393: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -70 score = 4.34819 sequence = AATTGTGAGATAAACCTCAAAA Gene: Shal_1890: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella piezotolerans WP3 Site: position = -97 score = 3.46984 sequence = AATTGTGACGTAGACCCGCAAA Gene: swp_2312: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella sediminis HAW-EB3 Site: position = -71 score = 4.5357 sequence = AATTGTGATTATGATCAATAAA Gene: Ssed_1999: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella woodyi ATCC 51908 Site: position = -73 score = 4.76096 sequence = AATTGTGATATCGATCAATATA Gene: Swoo_2604: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
| CRON 75. | |||||||||||||||||
| galU |
|
|
|
|
|
|
|
|
|
*
Shewanella amazonensis SB2B Site: position = -304 score = 4.45896 sequence = TTTTGTTAACTGCCTCACGTTT Gene: Sama_2223: UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) |
|
|
|
|
|
|
UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) |
| galE |
|
|
|
|
|
|
|
|
|
Gene: Sama_2224: UDP-glucose 4-epimerase (EC 5.1.3.2) |
|
|
|
|
|
|
UDP-glucose 4-epimerase (EC 5.1.3.2) |
| napF |
|
|
|
|
|
|
|
|
|
Gene: Sama_2225: ferredoxin-type protein NapF |
|
|
|
|
|
|
Ferredoxin-type protein NapF (periplasmic nitrate reductase) |
| Sama_2226 |
|
|
|
|
|
|
|
|
|
Gene: Sama_2226: Protein of unknown function DUF583 |
|
|
|
|
|
|
Protein of unknown function DUF583 |
| SO1661 |
|
|
|
|
|
|
|
|
|
Gene: Sama_2227: Transcriptional regulator, LysR family |
|
|
|
|
|
|
transcriptional regulator, LysR family |
| mtrF |
Gene: SO1659: decaheme cytochrome c MtrF |
*
Shewanella putrefaciens CN-32 Site: position = -201 score = 4.54314 sequence = ATTTGCAATATTCATCACATTT Gene: Sputcn32_1380: decaheme cytochrome c MtrF |
*
Shewanella sp W3-18-1 Site: position = -201 score = 4.54314 sequence = ATTTGCAATATTCATCACATTT Gene: Sputw3181_2721: decaheme cytochrome c MtrF |
*
Shewanella sp ANA-3 Site: position = -201 score = 3.91075 sequence = ATCTGCGAGATACCTCATATAT Gene: Shewana3_2787: decaheme cytochrome c MtrF |
*
Shewanella sp MR-4 Site: position = -202 score = 4.01513 sequence = ATTTGTTACCCACCTCTTATTT Gene: Shewmr4_2613: decaheme cytochrome c MtrF |
*
Shewanella sp MR-7 Site: position = -202 score = 4.01513 sequence = ATTTGTTACCCACCTCTTATTT Gene: Shewmr7_2680: decaheme cytochrome c MtrF |
*
Shewanella baltica OS155 Site: position = -202 score = 4.11236 sequence = AATTGTGATGCTCATCATGGCT Gene: Sbal_1478: decaheme cytochrome c MtrF |
|
Gene: Sfri_0913: decaheme cytochrome c MtrF |
Gene: Sama_2228: decaheme cytochrome c MtrF |
Gene: Shew_0918: decaheme cytochrome c MtrF |
|
|
Gene: swp_0896: decaheme cytochrome c MtrF |
Gene: Ssed_0998: decaheme cytochrome c MtrF |
|
decaheme cytochrome c MtrF |
| CRON 76. | |||||||||||||||||
| phk |
*
Shewanella oneidensis MR-1 Site: position = -95 score = 4.16652 sequence = AATTTGGATGCAGAACACATTT Gene: SO3542: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella putrefaciens CN-32 Site: position = -234 score = 4.04517 sequence = TCATGTGATCAAGCCTACATTT Site: position = -95 score = 4.13878 sequence = AATTTGGATGTAGGGCACATTT Gene: Sputcn32_1051: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella sp W3-18-1 Site: position = -95 score = 4.13878 sequence = AATTTGGATGTAGGGCACATTT Site: position = -234 score = 4.04517 sequence = TCATGTGATCAAGCCTACATTT Gene: Sputw3181_3114: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella sp ANA-3 Site: position = -95 score = 4.04964 sequence = AATTTGGATGCAGGGCACATTT Gene: Shewana3_3145: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella sp MR-4 Site: position = -95 score = 4.25566 sequence = AATTTGGATGTAGAACACATTT Gene: Shewmr4_2965: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella sp MR-7 Site: position = -95 score = 4.25566 sequence = AATTTGGATGTAGAACACATTT Gene: Shewmr7_3047: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella baltica OS155 Site: position = -96 score = 4.13878 sequence = AATTTGGATGTAGGGCACATTT Site: position = -235 score = 4.41054 sequence = TCATGTGATCAAGCTCGCGTTT Gene: Sbal_1046: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella denitrificans OS217 Site: position = -233 score = 4.96814 sequence = CTTAGTGATCCAGTTCACATTA Site: position = -94 score = 3.73189 sequence = AAGTTAGATCGGGGACACATTT Gene: Sden_2731: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -233 score = 4.49768 sequence = ACAAGTGATATCCATCACACTT Site: position = -95 score = 3.75497 sequence = AAATTAGATAAAGGCCACATTA Gene: Sfri_2898: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella amazonensis SB2B Site: position = -240 score = 4.14671 sequence = ACTCGTGATCAAGCTCACGGTT Site: position = -99 score = 4.10048 sequence = AATTTGGATGTGGGGCACATTT Gene: Sama_0915: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella loihica PV-4 Site: position = -238 score = 4.58676 sequence = CCATGTGATACAGATCACAGTT Site: position = -97 score = 4.02865 sequence = AAATAAGATATTGAACACATTT Gene: Shew_1091: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella pealeana ATCC 700345 Site: position = -235 score = 3.9489 sequence = CTGAGCGATATAGATCACAGTT Gene: Spea_1076: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -56 score = 4.27456 sequence = TATAGTGAGTTATATAAAATTT Gene: Shal_1124: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella piezotolerans WP3 Site: position = -96 score = 3.83438 sequence = AAATAAGATACAGGACACATTT Site: position = -237 score = 4.52442 sequence = CTGAGTGATACAGATCACACAT Gene: swp_3738: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella sediminis HAW-EB3 Site: position = -238 score = 4.4038 sequence = CCATGTGACGCAGATCACAGTT Site: position = -97 score = 4.21431 sequence = AAATAAGATGTAGAACACATTT Gene: Ssed_1186: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
*
Shewanella woodyi ATCC 51908 Site: position = -238 score = 4.36352 sequence = TCGCGTGATCACGATCACACTT Site: position = -97 score = 3.81425 sequence = AAACAAGATATAGAACACATTT Gene: Swoo_1282: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
| CRON 77. | |||||||||||||||||
| SO4134 |
*
Shewanella oneidensis MR-1 Site: position = -91 score = 4.6731 sequence = AATATTGATCCAGATCACGTTT Gene: SO4134: Protein of unknown function DUF465 |
*
Shewanella putrefaciens CN-32 Site: position = -89 score = 4.70814 sequence = AATATTGATCTAAGTCACAATT Gene: Sputcn32_0542: Protein of unknown function DUF465 |
*
Shewanella sp W3-18-1 Site: position = -89 score = 4.70814 sequence = AATATTGATCTAAGTCACAATT Gene: Sputw3181_3630: Protein of unknown function DUF465 |
*
Shewanella sp ANA-3 Site: position = -91 score = 4.60099 sequence = AATATTGATCCATATCACGTTT Gene: Shewana3_3681: Protein of unknown function DUF465 |
*
Shewanella sp MR-4 Site: position = -205 score = 3.97049 sequence = AAGTGTGAGCCAGATCTAACTC Site: position = -91 score = 4.56111 sequence = AATATTGATCCAAATCACGTTT Gene: Shewmr4_3506: Protein of unknown function DUF465 |
*
Shewanella sp MR-7 Site: position = -205 score = 3.97049 sequence = AAGTGTGAGCCAGATCTAACTC Site: position = -91 score = 4.56111 sequence = AATATTGATCCAAATCACGTTT Gene: Shewmr7_0446: Protein of unknown function DUF465 |
*
Shewanella baltica OS155 Site: position = -206 score = 3.75626 sequence = AAGTGTGAACCAGATCCTAATC Site: position = -92 score = 5.00526 sequence = AAGAGTGATCTAAGTCACATTT Gene: Sbal_3853: Protein of unknown function DUF465 |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -219 score = 4.73884 sequence = TAACGTGATTTACATCAAGTTA Site: position = -81 score = 3.82791 sequence = CATTGTTATTGGAATAACATCT Gene: Sfri_3404: Protein of unknown function DUF465 |
*
Shewanella amazonensis SB2B Site: position = -89 score = 4.46088 sequence = CTTAGTGATCCGGATCACTTTT Gene: Sama_0411: Protein of unknown function DUF465 |
Gene: Shew_3391: Protein of unknown function DUF465 |
*
Shewanella pealeana ATCC 700345 Site: position = -99 score = 4.89558 sequence = CTATTTGATCGATATCACATTT Gene: Spea_0459: Protein of unknown function DUF465 |
*
Shewanella halifaxensis HAW-EB4 Site: position = -97 score = 4.58731 sequence = CAATTTGATCGATATCACGTTT Gene: Shal_0534: Protein of unknown function DUF465 |
*
Shewanella piezotolerans WP3 Site: position = -306 score = 4.04839 sequence = TAAGGTTAACCTGATCACACTT Site: position = -88 score = 4.81744 sequence = AAACATGATCTAACTCACAAAT Gene: swp_4703: Protein of unknown function DUF465 |
Gene: Ssed_0459: Protein of unknown function DUF465 |
|
Protein of unknown function DUF465 |
| CRON 78. | |||||||||||||||||
| lpdA |
*
Shewanella oneidensis MR-1 Site: position = -113 score = 4.74184 sequence = TATTGTGATCAGTATCAAACAC Gene: SO0426: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
*
Shewanella putrefaciens CN-32 Site: position = -111 score = 4.74184 sequence = TATTGTGATCAGTATCAAACAC Gene: Sputcn32_3415: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
*
Shewanella sp W3-18-1 Site: position = -111 score = 4.74184 sequence = TATTGTGATCAGTATCAAACAC Gene: Sputw3181_0528: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
*
Shewanella sp ANA-3 Site: position = -113 score = 4.74184 sequence = TATTGTGATCAGTATCAAACAC Gene: Shewana3_0428: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
*
Shewanella sp MR-4 Site: position = -113 score = 4.74184 sequence = TATTGTGATCAGTATCAAACAC Gene: Shewmr4_0430: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
*
Shewanella sp MR-7 Site: position = -113 score = 4.74184 sequence = TATTGTGATCAGTATCAAACAC Gene: Shewmr7_3597: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
*
Shewanella baltica OS155 Site: position = -111 score = 4.74184 sequence = TATTGTGATCAGTATCAAACAC Gene: Sbal_3911: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
Gene: Sden_3381: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -168 score = 5.11739 sequence = TATTGTGATCGGTTTCAAACAA Gene: Sfri_3775: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
Gene: Sama_0377: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
Gene: Shew_3429: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
*
Shewanella pealeana ATCC 700345 Site: position = -128 score = 4.46809 sequence = GATTGTGATCAGCATCAAACAA Gene: Spea_0421: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -130 score = 4.63177 sequence = GATTGTGATCCGTATCAAACAA Gene: Shal_0478: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
*
Shewanella piezotolerans WP3 Site: position = -113 score = 4.48061 sequence = GATTGTGATCAGTATCAAACAA Gene: swp_4749: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
Gene: Ssed_0433: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
Gene: Swoo_0321: Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
Dihydrolipoamide dehydrogenase (EC 1.8.1.4) |
| CRON 79. | |||||||||||||||||
| hcp |
*
Shewanella oneidensis MR-1 Site: position = -124 score = 4.16073 sequence = TAAAGTGATCTTTCTCTAAGAT Gene: SO1363: Hydroxylamine reductase (EC 1.7.-.-) |
*
Shewanella putrefaciens CN-32 Site: position = -124 score = 4.27921 sequence = TAAGGTGATAACCCTCGCAAAT Gene: Sputcn32_1174: Hydroxylamine reductase (EC 1.7.-.-) |
*
Shewanella sp W3-18-1 Site: position = -124 score = 4.27921 sequence = TAAGGTGATAACCCTCGCAAAT Gene: Sputw3181_2990: Hydroxylamine reductase (EC 1.7.-.-) |
Gene: Shewana3_3011: Hydroxylamine reductase (EC 1.7.-.-) |
*
Shewanella sp MR-4 Site: position = -124 score = 3.95536 sequence = TAAGGTGATCTCCCTCTAAGAT Gene: Shewmr4_2832: Hydroxylamine reductase (EC 1.7.-.-) |
*
Shewanella sp MR-7 Site: position = -124 score = 3.59023 sequence = CAAGGTGATCTCTCTCTAAGAT Gene: Shewmr7_2914: Hydroxylamine reductase (EC 1.7.-.-) |
*
Shewanella baltica OS155 Site: position = -124 score = 4.13352 sequence = TAAGGTGATCGTTCTCTAATAT Gene: Sbal_1216: Hydroxylamine reductase (EC 1.7.-.-) |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -125 score = 4.03676 sequence = GAAGGTGATGTGGCTCATAAAA Gene: Sfri_3609: Hydroxylamine reductase (EC 1.7.-.-) |
*
Shewanella amazonensis SB2B Site: position = -113 score = 3.60962 sequence = TAAGATGATCTGCTTCAAGGAA Gene: Sama_0895: Hydroxylamine reductase (EC 1.7.-.-) |
*
Shewanella loihica PV-4 Site: position = -125 score = 4.5297 sequence = TAATTTGATCCGCTTCATAGTT Gene: Shew_1069: Hydroxylamine reductase (EC 1.7.-.-) |
*
Shewanella pealeana ATCC 700345 Site: position = -125 score = 4.53482 sequence = AAAAGTGATCTCTTTCATAGTT Gene: Spea_1055: Hydroxylamine reductase (EC 1.7.-.-) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -96 score = 4.30887 sequence = TAAGGTGATCTCTTTCATGTTT Gene: Shal_1103: Hydroxylamine reductase (EC 1.7.-.-) |
*
Shewanella piezotolerans WP3 Site: position = -42 score = 4.36361 sequence = TAAGGTGATCTCTTTCATAGTT Gene: swp_3762: Hydroxylamine reductase (EC 1.7.-.-) |
*
Shewanella sediminis HAW-EB3 Site: position = -170 score = 3.4394 sequence = TAATGCAATTGGTATTATAATT Gene: Ssed_1165: Hydroxylamine reductase (EC 1.7.-.-) |
*
Shewanella woodyi ATCC 51908 Site: position = -125 score = 4.18387 sequence = GAATTTGATCTGTCTCAAACTT Gene: Swoo_1260: Hydroxylamine reductase (EC 1.7.-.-) |
Hydroxylamine reductase (EC 1.7.-.-) |
| hcr |
Gene: SO1364: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Gene: Sputcn32_1175: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Gene: Sputw3181_2989: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Gene: Shewana3_3010: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Gene: Shewmr4_2831: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Gene: Shewmr7_2913: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Gene: Sbal_1217: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
|
Gene: Sfri_3608: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Gene: Sama_0896: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Gene: Shew_1070: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Gene: Spea_1056: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Gene: Shal_1104: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Gene: swp_3761: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Gene: Ssed_1166: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Gene: Swoo_1261: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 |
| CRON 80. | |||||||||||||||||
| SO2753 |
*
Shewanella oneidensis MR-1 Site: position = -235 score = 4.69061 sequence = TTAAGTGATCTGCCTCACTTAA Gene: SO2753: prolyl endopeptidase (EC 3.4.21.26) |
*
Shewanella putrefaciens CN-32 Site: position = -234 score = 4.81353 sequence = TTAAGTGATCTAGCTCACTTAA Gene: Sputcn32_1602: prolyl endopeptidase (EC 3.4.21.26) |
*
Shewanella sp W3-18-1 Site: position = -234 score = 4.81353 sequence = TTAAGTGATCTAGCTCACTTAA Gene: Sputw3181_2420: prolyl endopeptidase (EC 3.4.21.26) |
*
Shewanella sp ANA-3 Site: position = -234 score = 4.77523 sequence = TTAAGTGATCTGGCTCACTTAA Gene: Shewana3_2536: prolyl endopeptidase (EC 3.4.21.26) |
*
Shewanella sp MR-4 Site: position = -234 score = 4.77523 sequence = TTAAGTGATCTGGCTCACTTAA Gene: Shewmr4_2373: prolyl endopeptidase (EC 3.4.21.26) |
*
Shewanella sp MR-7 Site: position = -234 score = 4.77523 sequence = TTAAGTGATCTGGCTCACTTAA Gene: Shewmr7_2445: prolyl endopeptidase (EC 3.4.21.26) |
*
Shewanella baltica OS155 Site: position = -233 score = 4.70778 sequence = AAAGGTGATCTATATCACTTAA Gene: Sbal_1741: prolyl endopeptidase (EC 3.4.21.26) |
|
|
*
Shewanella amazonensis SB2B Site: position = -226 score = 4.70489 sequence = TTGTGTGATCTTGCGCACGTTA Gene: Sama_2091: prolyl endopeptidase (EC 3.4.21.26) |
*
Shewanella loihica PV-4 Site: position = -276 score = 3.50467 sequence = ATTTGCGCTTGATTACGCAAAA Gene: Shew_1522: prolyl endopeptidase (EC 3.4.21.26) |
*
Shewanella pealeana ATCC 700345 Site: position = -251 score = 3.94593 sequence = TAGTGTGGGTTTAGTCACACTT Gene: Spea_2569: prolyl endopeptidase (EC 3.4.21.26) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -266 score = 3.56697 sequence = TATTGCGGGGTTTGTCACGTTT Gene: Shal_1686: prolyl endopeptidase (EC 3.4.21.26) |
*
Shewanella piezotolerans WP3 Site: position = -248 score = 3.56849 sequence = TTGTGAGTCCTTAATCACGTTT Gene: swp_1825: prolyl endopeptidase (EC 3.4.21.26) |
*
Shewanella sediminis HAW-EB3 Site: position = -257 score = 3.81034 sequence = AAGTGTGATCTTGGTCGGTAAA Gene: Ssed_1852: prolyl endopeptidase (EC 3.4.21.26) |
*
Shewanella woodyi ATCC 51908 Site: position = -259 score = 3.66479 sequence = TAGTGTGATCTAGGTTGGGTAA Gene: Swoo_2736: prolyl endopeptidase (EC 3.4.21.26) |
prolyl endopeptidase (EC 3.4.21.26) |
| CRON 81. | |||||||||||||||||
| lipB |
*
Shewanella oneidensis MR-1 Site: position = -68 score = 5.06169 sequence = AAGTGTGATCTATCTTACATTT Gene: SO1162: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
*
Shewanella putrefaciens CN-32 Site: position = -69 score = 5.26615 sequence = AAATGTGATCTATCTTACATTT Gene: Sputcn32_2875: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
*
Shewanella sp W3-18-1 Site: position = -75 score = 5.26615 sequence = AAATGTGATCTATCTTACATTT Gene: Sputw3181_1028: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
*
Shewanella sp ANA-3 Site: position = -74 score = 5.22784 sequence = AAATGTGATCTGTCTTACATTT Gene: Shewana3_0989: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
*
Shewanella sp MR-4 Site: position = -74 score = 5.22784 sequence = AAATGTGATCTGTCTTACATTT Gene: Shewmr4_0985: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
*
Shewanella sp MR-7 Site: position = -74 score = 5.22784 sequence = AAATGTGATCTGTCTTACATTT Gene: Shewmr7_1050: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
*
Shewanella baltica OS155 Site: position = -74 score = 5.22784 sequence = AAATGTGATCTGTCTTACATTT Gene: Sbal_3281: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
Gene: Sden_0868: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
Gene: Sfri_0693: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
Gene: Sama_2594: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
*
Shewanella loihica PV-4 Site: position = -70 score = 5.25363 sequence = AAATGTGATCTACCTTACATTT Gene: Shew_2941: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
*
Shewanella pealeana ATCC 700345 Site: position = -76 score = 5.24025 sequence = AAATGTGATCCGTATTACATTT Gene: Spea_3155: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
*
Shewanella halifaxensis HAW-EB4 Site: position = -76 score = 5.24025 sequence = AAATGTGATCCGTATTACATTT Gene: Shal_3240: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
*
Shewanella piezotolerans WP3 Site: position = -69 score = 5.22784 sequence = AAATGTGATCTGTCTTACATTT Gene: swp_3928: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
*
Shewanella sediminis HAW-EB3 Site: position = -75 score = 5.33825 sequence = AAATGTGATCTAGCTTACATTT Gene: Ssed_3491: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
*
Shewanella woodyi ATCC 51908 Site: position = -74 score = 5.05135 sequence = AAGTGTGATCTAGCTTACAATT Gene: Swoo_3714: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase |
| lipA |
Gene: SO1161: Lipoate synthase |
Gene: Sputcn32_2876: Lipoate synthase |
Gene: Sputw3181_1027: Lipoate synthase |
Gene: Shewana3_0988: Lipoate synthase |
Gene: Shewmr4_0984: Lipoate synthase |
Gene: Shewmr7_1049: Lipoate synthase |
Gene: Sbal_3282: Lipoate synthase |
Gene: Sden_0867: Lipoate synthase |
Gene: Sfri_0692: Lipoate synthase |
Gene: Sama_2595: Lipoate synthase |
Gene: Shew_2942: Lipoate synthase |
Gene: Spea_3156: Lipoate synthase |
Gene: Shal_3241: Lipoate synthase |
Gene: swp_3930: Lipoate synthase |
Gene: Ssed_3492: Lipoate synthase |
Gene: Swoo_3715: Lipoate synthase |
Lipoate synthase |
| CRON 82. | |||||||||||||||||
| cyaA |
*
Shewanella oneidensis MR-1 Site: position = -91 score = 4.96261 sequence = AAGTGTGATGGACCTCTCATTT Gene: SO4312: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella putrefaciens CN-32 Site: position = -91 score = 5.41621 sequence = AAATGTGATGCAGATCTCATTT Site: position = -51 score = 3.76456 sequence = AAGTGTTAACATAAGCACACTT Gene: Sputcn32_3586: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella sp W3-18-1 Site: position = -91 score = 5.41621 sequence = AAATGTGATGCAGATCTCATTT Site: position = -51 score = 3.76456 sequence = AAGTGTTAACATAAGCACACTT Gene: Sputw3181_3725: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella sp ANA-3 Site: position = -52 score = 3.87655 sequence = AAGTGTTAACATGAGCACACTT Site: position = -92 score = 4.66409 sequence = AAGTGTGACGAACTTCTCATTT Gene: Shewana3_0387: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella sp MR-4 Site: position = -92 score = 4.66409 sequence = AAGTGTGACGAACTTCTCATTT Site: position = -52 score = 3.87655 sequence = AAGTGTTAACATGAGCACACTT Gene: Shewmr4_0389: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella sp MR-7 Site: position = -92 score = 4.66409 sequence = AAGTGTGACGAACTTCTCATTT Site: position = -52 score = 3.87655 sequence = AAGTGTTAACATGAGCACACTT Gene: Shewmr7_3637: Adenylate cyclase (EC 4.6.1.1) |
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -129 score = 3.83001 sequence = AAATGCTACGATGATCACCATT Site: position = -100 score = 3.88534 sequence = AAATGTGATCTTGATTGGCAAA Gene: Sfri_0441: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella amazonensis SB2B Site: position = -90 score = 5.35058 sequence = AAATGTGATCTCTATCGCAAAT Gene: Sama_3253: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella loihica PV-4 Site: position = -88 score = 5.05708 sequence = AAGTGTGATCCAGCTCTCAAAT Gene: Shew_0319: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella pealeana ATCC 700345 Site: position = -87 score = 5.31574 sequence = AAGTGTGATCTTGATCGCATTT Gene: Spea_0374: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -88 score = 5.30944 sequence = AAGCGTGATGTTGATCACATTT Gene: Shal_3916: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella piezotolerans WP3 Site: position = -106 score = 5.46208 sequence = AAATGTGATCGGAGTCACATTT Gene: swp_0403: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella sediminis HAW-EB3 Site: position = -90 score = 5.21824 sequence = AAGTGTGATCTTGATCTCATTT Gene: Ssed_4132: Adenylate cyclase (EC 4.6.1.1) |
*
Shewanella woodyi ATCC 51908 Site: position = -98 score = 5.00113 sequence = AAGTGTGATCTTGGTCTCATTT Gene: Swoo_0484: Adenylate cyclase (EC 4.6.1.1) |
Adenylate cyclase (EC 4.6.1.1) |
| CRON 83. | |||||||||||||||||
| SO3552 |
*
Shewanella oneidensis MR-1 Site: position = -152 score = 4.05102 sequence = TTGTGTGATCATAGTTGCAAAA Gene: SO3552: Von Willebrand factor type A domain protein |
*
Shewanella putrefaciens CN-32 Site: position = -143 score = 4.03094 sequence = CTGTGTGATCATGATTGCAAAT Gene: Sputcn32_1043: Von Willebrand factor type A domain protein |
*
Shewanella sp W3-18-1 Site: position = -143 score = 4.03094 sequence = CTGTGTGATCATGATTGCAAAT Gene: Sputw3181_3122: Von Willebrand factor type A domain protein |
*
Shewanella sp ANA-3 Site: position = -165 score = 4.05102 sequence = TTGTGTGATCATAGTTGCAAAA Gene: Shewana3_3153: Von Willebrand factor type A domain protein |
*
Shewanella sp MR-4 Site: position = -165 score = 4.40044 sequence = TTGTGTGATCATAGTTACAAAA Gene: Shewmr4_2973: Von Willebrand factor type A domain protein |
*
Shewanella sp MR-7 Site: position = -165 score = 4.40044 sequence = TTGTGTGATCATAGTTACAAAA Gene: Shewmr7_3055: Von Willebrand factor type A domain protein |
*
Shewanella baltica OS155 Site: position = -126 score = 3.8319 sequence = CAGTGTGATCTTGTCAGCAAAA Gene: Sbal_1038: Von Willebrand factor type A domain protein |
|
Gene: Sfri_1077: Von Willebrand factor type A domain protein |
|
|
|
|
|
|
Gene: Swoo_3319: Von Willebrand factor type A domain protein |
Von Willebrand factor type A domain protein |
| SO3551 |
Gene: SO3551: RNA polymerase sigma-70 factor, ECF subfamily |
Gene: Sputcn32_1044: RNA polymerase sigma-70 factor, ECF subfamily |
Gene: Sputw3181_3121: RNA polymerase sigma-70 factor, ECF subfamily |
Gene: Shewana3_3152: RNA polymerase sigma-70 factor, ECF subfamily |
Gene: Shewmr4_2972: RNA polymerase sigma-70 factor, ECF subfamily |
Gene: Shewmr7_3054: RNA polymerase sigma-70 factor, ECF subfamily |
Gene: Sbal_1039: RNA polymerase sigma-70 factor, ECF subfamily |
|
Gene: Sfri_1078: RNA polymerase sigma-70 factor, ECF subfamily |
*
Shewanella amazonensis SB2B Site: position = -192 score = 4.19458 sequence = ATGTGTGAGCTTTGGCAAATTT Gene: Sama_1068: RNA polymerase sigma-70 factor, ECF subfamily |
Gene: Shew_1231: RNA polymerase sigma-70 factor, ECF subfamily |
Gene: Spea_1212: RNA polymerase sigma-70 factor, ECF subfamily |
Gene: Shal_1246: RNA polymerase sigma-70 factor, ECF subfamily |
Gene: swp_1397: RNA polymerase sigma-70 factor, ECF subfamily |
*
Shewanella sediminis HAW-EB3 Site: position = -273 score = 4.39877 sequence = AAATGTGATGCGTAGCACTTAC Gene: Ssed_1335: RNA polymerase sigma-70 factor, ECF subfamily |
Gene: Swoo_3318: RNA polymerase sigma-70 factor, ECF subfamily |
RNA polymerase sigma-70 factor, ECF subfamily |
| SO3550 |
Gene: SO3550: hypothetical protein |
Gene: Sputcn32_1045: hypothetical protein |
Gene: Sputw3181_3120: hypothetical protein |
Gene: Shewana3_3151: hypothetical protein |
Gene: Shewmr4_2971: hypothetical protein |
Gene: Shewmr7_3053: hypothetical protein |
Gene: Sbal_1040: hypothetical protein |
|
Gene: Sfri_1079: hypothetical protein |
Gene: Sama_1069: hypothetical protein |
Gene: Shew_1232: hypothetical protein |
Gene: Spea_1213: hypothetical protein |
Gene: Shal_1247: hypothetical protein |
Gene: swp_1398: hypothetical protein |
Gene: Ssed_1336: hypothetical protein |
Gene: Swoo_3317: hypothetical protein |
hypothetical protein |
| purE |
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella halifaxensis HAW-EB4 Site: position = -269 score = 4.35424 sequence = TTGTGGGATCTAGGTAACATTT Gene: Shal_1245: phosphoribosylaminoimidazole carboxylase, catalytic subunit |
|
|
|
Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
| CRON 84. | |||||||||||||||||
| SO1539 |
Gene: SO1539: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella putrefaciens CN-32 Site: position = -127 score = 4.54457 sequence = AATAGTGAGCGATATCACGATT Gene: Sputcn32_1287: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella sp W3-18-1 Site: position = -127 score = 4.54457 sequence = AATAGTGAGCGATATCACGATT Gene: Sputw3181_2819: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella sp ANA-3 Site: position = -127 score = 4.45637 sequence = AATAGTGAGCAATATCACGATT Gene: Shewana3_2889: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella sp MR-4 Site: position = -127 score = 4.45637 sequence = AATAGTGAGCAATATCACGATT Gene: Shewmr4_2719: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella sp MR-7 Site: position = -127 score = 4.45637 sequence = AATAGTGAGCAATATCACGATT Gene: Shewmr7_2790: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella baltica OS155 Site: position = -128 score = 4.45637 sequence = AATAGTGAGCAATATCACGATT Gene: Sbal_1369: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
Gene: Sden_2560: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -313 score = 4.65279 sequence = AATAGTGAGTATTATCACATTA Gene: Sfri_2778: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella amazonensis SB2B Site: position = -183 score = 4.65998 sequence = TTATGTGATTTATGTCTCGATT Gene: Sama_2422: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella loihica PV-4 Site: position = -171 score = 4.43727 sequence = AATAGTGAGCAATCTCACGTTT Gene: Shew_2759: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella pealeana ATCC 700345 Site: position = -113 score = 4.29859 sequence = AAGAGTGAGCGATCTCACGTTT Gene: Spea_2979: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -114 score = 4.43727 sequence = AATAGTGAGCAATCTCACGTTT Gene: Shal_3068: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella piezotolerans WP3 Site: position = -144 score = 4.23706 sequence = AAAGGTGAGCAATCTCACGTTT Gene: swp_3605: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella sediminis HAW-EB3 Site: position = -103 score = 4.79471 sequence = AATAGTGAGCAATCTCACATTT Gene: Ssed_3317: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
*
Shewanella woodyi ATCC 51908 Site: position = -159 score = 4.39896 sequence = AATAGTGAGCAGTCTCACGTTT Gene: Swoo_3465: Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
Probable acylaminoacyl-peptidase (EC 3.4.19.1) |
| CRON 85. | |||||||||||||||||
| engB |
*
Shewanella oneidensis MR-1 Site: position = -96 score = 4.71756 sequence = TAATGTGATCGGGGTAATATTT Gene: SO4667: GTP-binding protein EngB |
*
Shewanella putrefaciens CN-32 Site: position = -96 score = 4.60558 sequence = TAATGTGATCGGAGTAATATTT Gene: Sputcn32_3907: GTP-binding protein EngB |
*
Shewanella sp W3-18-1 Site: position = -96 score = 4.60558 sequence = TAATGTGATCGGAGTAATATTT Gene: Sputw3181_0044: GTP-binding protein EngB |
*
Shewanella sp ANA-3 Site: position = -96 score = 4.71756 sequence = TAATGTGATCGGGGTAATATTT Gene: Shewana3_4110: GTP-binding protein EngB |
*
Shewanella sp MR-4 Site: position = -96 score = 4.71756 sequence = TAATGTGATCGGGGTAATATTT Gene: Shewmr4_3906: GTP-binding protein EngB |
*
Shewanella sp MR-7 Site: position = -96 score = 4.71756 sequence = TAATGTGATCGGGGTAATATTT Gene: Shewmr7_3998: GTP-binding protein EngB |
*
Shewanella baltica OS155 Site: position = -95 score = 4.60558 sequence = TAATGTGATCGGAGTAATATTT Gene: Sbal_0052: GTP-binding protein EngB |
*
Shewanella denitrificans OS217 Site: position = -182 score = 3.82421 sequence = TATTATGCTCGAAATAATATTT Gene: Sden_3621: GTP-binding protein EngB |
*
Shewanella frigidimarina NCIMB 400 Site: position = -104 score = 4.74493 sequence = TAATGTGATCAGGCTAATATTT Gene: Sfri_3944: GTP-binding protein EngB |
*
Shewanella amazonensis SB2B Site: position = -96 score = 4.13136 sequence = ATATGTGATCGGGGCAATATTT Gene: Sama_0092: GTP-binding protein EngB |
*
Shewanella loihica PV-4 Site: position = -95 score = 4.66839 sequence = TTATGTGATCGGGGTAATATTT Gene: Shew_3715: GTP-binding protein EngB |
*
Shewanella pealeana ATCC 700345 Site: position = -96 score = 4.66839 sequence = TTATGTGATCGGGGTAATATTT Gene: Spea_0101: GTP-binding protein EngB |
*
Shewanella halifaxensis HAW-EB4 Site: position = -96 score = 4.66839 sequence = TTATGTGATCGGGGTAATATTT Gene: Shal_4221: GTP-binding protein EngB |
*
Shewanella piezotolerans WP3 Site: position = -96 score = 4.66839 sequence = TTATGTGATCGGGGTAATATTT Gene: swp_5074a: GTP-binding protein EngB |
*
Shewanella sediminis HAW-EB3 Site: position = -95 score = 4.70669 sequence = TTATGTGATCGAGGTAATATTT Gene: Ssed_0095: GTP-binding protein EngB |
*
Shewanella woodyi ATCC 51908 Site: position = -110 score = 4.77829 sequence = TATTGTGATCGAGGTAATATTT Gene: Swoo_0058: GTP-binding protein EngB |
GTP-binding protein EngB |
| CRON 86. | |||||||||||||||||
| cytcB |
*
Shewanella oneidensis MR-1 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATTA Gene: SO4666: Cytochrome c4 |
*
Shewanella putrefaciens CN-32 Site: position = -95 score = 4.32157 sequence = AAATATTACTCCGATCACATTA Gene: Sputcn32_3908: Cytochrome c4 |
*
Shewanella sp W3-18-1 Site: position = -95 score = 4.32157 sequence = AAATATTACTCCGATCACATTA Gene: Sputw3181_0043: Cytochrome c4 |
*
Shewanella sp ANA-3 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATTA Gene: Shewana3_4111: Cytochrome c4 |
*
Shewanella sp MR-4 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATTA Gene: Shewmr4_3907: Cytochrome c4 |
*
Shewanella sp MR-7 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATTA Gene: Shewmr7_3999: Cytochrome c4 |
*
Shewanella baltica OS155 Site: position = -95 score = 4.32157 sequence = AAATATTACTCCGATCACATTA Gene: Sbal_0051: Cytochrome c4 |
*
Shewanella denitrificans OS217 Site: position = -94 score = 3.70779 sequence = AAATATTATTTCGAGCATAATA Gene: Sden_3622: Cytochrome c4 |
*
Shewanella frigidimarina NCIMB 400 Site: position = -181 score = 4.34371 sequence = AAATATTAGCCTGATCACATTA Gene: Sfri_3945: Cytochrome c4 |
Gene: Sama_0091: Cytochrome c4 |
*
Shewanella loihica PV-4 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATAA Gene: Shew_3716: Cytochrome c4 |
*
Shewanella pealeana ATCC 700345 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATAA Gene: Spea_0100: Cytochrome c4 |
*
Shewanella halifaxensis HAW-EB4 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATAA Gene: Shal_4222: Cytochrome c4 |
*
Shewanella piezotolerans WP3 Site: position = -95 score = 4.42458 sequence = AAATATTACCCCGATCACATAA Gene: swp_5075: Cytochrome c4 |
*
Shewanella sediminis HAW-EB3 Site: position = -96 score = 4.51372 sequence = AAATATTACCTCGATCACATAA Gene: Ssed_0094: Cytochrome c4 |
*
Shewanella woodyi ATCC 51908 Site: position = -96 score = 4.43127 sequence = AAATATTACCTCGATCACAATA Site: position = -157 score = 4.1598 sequence = AAATATGATGTTTTGCACTTTA Gene: Swoo_0057: Cytochrome c4 |
Cytochrome c4 |
| CRON 87. | |||||||||||||||||
| SO4019 |
*
Shewanella oneidensis MR-1 Site: position = -233 score = 4.2183 sequence = GATATTGATACAAATCACATTT Gene: SO4019: DNA helicase |
*
Shewanella putrefaciens CN-32 Site: position = -235 score = 4.52911 sequence = AATAGTGATACAAACCACACTT Gene: Sputcn32_3259: DNA helicase |
*
Shewanella sp W3-18-1 Site: position = -236 score = 4.52911 sequence = AATAGTGATACAAACCACACTT Gene: Sputw3181_0682: DNA helicase |
|
Gene: Shewmr4_3416: DNA helicase |
Gene: Shewmr7_0536: DNA helicase |
*
Shewanella baltica OS155 Site: position = -239 score = 4.52911 sequence = AATAGTGATACAAACCACACTT Gene: Sbal_3742: DNA helicase |
|
Gene: Sfri_1250: DNA helicase |
|
Gene: Shew_3060: DNA helicase |
|
|
|
|
|
DNA helicase |
| CRON 88. | |||||||||||||||||
| petA |
*
Shewanella oneidensis MR-1 Site: position = -103 score = 3.73412 sequence = TAATGAGCCCCGCTTCAAACTT Site: position = -132 score = 3.72072 sequence = CACTATGATCTGCTTCTAATTT Gene: SO0608: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
*
Shewanella putrefaciens CN-32 Site: position = -130 score = 3.72072 sequence = CACTATGATCTGCTTCTAATTT Site: position = -101 score = 3.73412 sequence = TAATGAGCCCCGCTTCAAACTT Gene: Sputcn32_3276: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
*
Shewanella sp W3-18-1 Site: position = -130 score = 3.72072 sequence = CACTATGATCTGCTTCTAATTT Site: position = -101 score = 3.73412 sequence = TAATGAGCCCCGCTTCAAACTT Gene: Sputw3181_0665: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
*
Shewanella sp ANA-3 Site: position = -103 score = 3.73412 sequence = TAATGAGCCCCGCTTCAAACTT Site: position = -132 score = 3.72072 sequence = CACTATGATCTGCTTCTAATTT Gene: Shewana3_0601: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
*
Shewanella sp MR-4 Site: position = -103 score = 3.73412 sequence = TAATGAGCCCCGCTTCAAACTT Site: position = -132 score = 3.72072 sequence = CACTATGATCTGCTTCTAATTT Gene: Shewmr4_0602: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
*
Shewanella sp MR-7 Site: position = -132 score = 3.72072 sequence = CACTATGATCTGCTTCTAATTT Site: position = -103 score = 3.73412 sequence = TAATGAGCCCCGCTTCAAACTT Gene: Shewmr7_3428: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
*
Shewanella baltica OS155 Site: position = -102 score = 3.73412 sequence = TAATGAGCCCCGCTTCAAACTT Site: position = -131 score = 3.72072 sequence = CACTATGATCTGCTTCTAATTT Gene: Sbal_0562: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
Gene: Sden_3201: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -129 score = 3.80534 sequence = CACTATGATCTGGTTCTAATTT Gene: Sfri_3307: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
Gene: Sama_3021: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
*
Shewanella loihica PV-4 Site: position = -101 score = 3.88536 sequence = TAATGAGCCCCGCCTCAAATTT Site: position = -130 score = 4.09837 sequence = TACTATGATCTGCTTCTAATTT Gene: Shew_0570: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
*
Shewanella pealeana ATCC 700345 Site: position = -78 score = 4.17641 sequence = AACTATGATCTGGTTCTAATTT Gene: Spea_3536: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -128 score = 4.57701 sequence = AACTATGATCTGGCTCAAATTT Gene: Shal_3630: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
*
Shewanella piezotolerans WP3 Site: position = -131 score = 4.17641 sequence = AACTATGATCTGGTTCTAATTT Gene: swp_0793: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
*
Shewanella sediminis HAW-EB3 Site: position = -132 score = 4.38158 sequence = TACTATGATCAAGCTCAAATTT Gene: Ssed_0801: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
*
Shewanella woodyi ATCC 51908 Site: position = -129 score = 3.82309 sequence = TACTATGATCTGCTTCTGATTT Gene: Swoo_4166: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) |
| petB |
Gene: SO0609: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Sputcn32_3275: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Sputw3181_0666: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Shewana3_0602: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Shewmr4_0603: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Shewmr7_3427: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Sbal_0563: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Sden_3200: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Sfri_3306: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Sama_3020: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Shew_0571: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Spea_3535: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Shal_3629: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: swp_0794: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Ssed_0802: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
Gene: Swoo_4165: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) |
| petC |
Gene: SO0610: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Sputcn32_3274: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Sputw3181_0667: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Shewana3_0603: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Shewmr4_0604: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Shewmr7_3426: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Sbal_0564: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Sden_3199: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Sfri_3305: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Sama_3019: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Shew_0572: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Spea_3534: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Shal_3628: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: swp_0795: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Ssed_0803: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
Gene: Swoo_4164: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit |
| sspA |
Gene: SO0611: stringent starvation protein A |
Gene: Sputcn32_3273: stringent starvation protein A |
Gene: Sputw3181_0668: stringent starvation protein A |
Gene: Shewana3_0604: stringent starvation protein A |
Gene: Shewmr4_0605: stringent starvation protein A |
Gene: Shewmr7_3425: stringent starvation protein A |
Gene: Sbal_0565: stringent starvation protein A |
Gene: Sden_3198: stringent starvation protein A |
Gene: Sfri_3304: stringent starvation protein A |
Gene: Sama_3018: stringent starvation protein A |
Gene: Shew_0573: stringent starvation protein A |
Gene: Spea_3533: stringent starvation protein A |
Gene: Shal_3627: stringent starvation protein A |
Gene: swp_0796: stringent starvation protein A |
Gene: Ssed_0804: stringent starvation protein A |
Gene: Swoo_4163: stringent starvation protein A |
stringent starvation protein A |
| sspB |
Gene: SO0612: stringent starvation protein B |
Gene: Sputcn32_3272: stringent starvation protein B |
Gene: Sputw3181_0669: stringent starvation protein B |
Gene: Shewana3_0605: stringent starvation protein B |
Gene: Shewmr4_0606: stringent starvation protein B |
Gene: Shewmr7_3424: stringent starvation protein B |
Gene: Sbal_0566: stringent starvation protein B |
Gene: Sden_3197: stringent starvation protein B |
Gene: Sfri_3303: stringent starvation protein B |
Gene: Sama_3017: stringent starvation protein B |
Gene: Shew_0574: stringent starvation protein B |
Gene: Spea_3532: stringent starvation protein B |
Gene: Shal_3626: stringent starvation protein B |
Gene: swp_0797: stringent starvation protein B |
Gene: Ssed_0805: stringent starvation protein B |
Gene: Swoo_4162: stringent starvation protein B |
stringent starvation protein B |
| CRON 89. | |||||||||||||||||
| deoA |
*
Shewanella oneidensis MR-1 Site: position = -135 score = 3.9166 sequence = AAGTGTGACCTAAATCTAGTTG Gene: SO1218: thymidine phosphorylase (EC 2.4.2.4) |
*
Shewanella putrefaciens CN-32 Site: position = -136 score = 3.72137 sequence = AAGTGTGACCTAAATCTATTTG Gene: Sputcn32_2821: thymidine phosphorylase (EC 2.4.2.4) |
*
Shewanella sp W3-18-1 Site: position = -136 score = 3.72137 sequence = AAGTGTGACCTAAATCTATTTG Gene: Sputw3181_1190: thymidine phosphorylase (EC 2.4.2.4) |
*
Shewanella sp ANA-3 Site: position = -135 score = 3.9166 sequence = AAGTGTGACCTAAATCTAGTTG Gene: Shewana3_1042: thymidine phosphorylase (EC 2.4.2.4) |
*
Shewanella sp MR-4 Site: position = -135 score = 3.9166 sequence = AAGTGTGACCTAAATCTAGTTG Gene: Shewmr4_1038: thymidine phosphorylase (EC 2.4.2.4) |
*
Shewanella sp MR-7 Site: position = -135 score = 3.9166 sequence = AAGTGTGACCTAAATCTAGTTG Gene: Shewmr7_1103: thymidine phosphorylase (EC 2.4.2.4) |
*
Shewanella baltica OS155 Site: position = -136 score = 3.72137 sequence = AAGTGTGACCTAAATCTATTTG Gene: Sbal_3226: thymidine phosphorylase (EC 2.4.2.4) |
Gene: Sden_1026: thymidine phosphorylase (EC 2.4.2.4) |
Gene: Sfri_1003: thymidine phosphorylase (EC 2.4.2.4) |
*
Shewanella amazonensis SB2B Site: position = -135 score = 3.9367 sequence = ATTTGTGATCCGCGTCGAAACG Gene: Sama_0974: thymidine phosphorylase (EC 2.4.2.4) |
*
Shewanella loihica PV-4 Site: position = -133 score = 3.97801 sequence = AAGTGTGATCTAAATCTATTTG Gene: Shew_2814: thymidine phosphorylase (EC 2.4.2.4) |
*
Shewanella pealeana ATCC 700345 Site: position = -138 score = 4.84035 sequence = AAGTGTGATCTAAATCTAATTA Gene: Spea_3047: thymidine phosphorylase (EC 2.4.2.4) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -138 score = 4.84035 sequence = AAGTGTGATCTAAATCTAATTA Gene: Shal_3135: thymidine phosphorylase (EC 2.4.2.4) |
*
Shewanella piezotolerans WP3 Site: position = -139 score = 4.84035 sequence = AAGTGTGATCTAAATCTAATTA Gene: swp_1230: thymidine phosphorylase (EC 2.4.2.4) |
*
Shewanella sediminis HAW-EB3 Site: position = -134 score = 3.97801 sequence = AAGTGTGATCTAAATCTATTTG Gene: Ssed_3377: thymidine phosphorylase (EC 2.4.2.4) |
*
Shewanella woodyi ATCC 51908 Site: position = -157 score = 4.17323 sequence = AAGTGTGATCTAAATCTAGTTG Gene: Swoo_3548: thymidine phosphorylase (EC 2.4.2.4) |
thymidine phosphorylase (EC 2.4.2.4) |
| deoB |
Gene: SO1219: phosphopentomutase (EC 5.4.2.7) |
Gene: Sputcn32_2820: phosphopentomutase (EC 5.4.2.7) |
Gene: Sputw3181_1191: phosphopentomutase (EC 5.4.2.7) |
Gene: Shewana3_1043: phosphopentomutase (EC 5.4.2.7) |
Gene: Shewmr4_1039: phosphopentomutase (EC 5.4.2.7) |
Gene: Shewmr7_1104: phosphopentomutase (EC 5.4.2.7) |
Gene: Sbal_3225: phosphopentomutase (EC 5.4.2.7) |
Gene: Sden_1027: phosphopentomutase (EC 5.4.2.7) |
Gene: Sfri_1004: phosphopentomutase (EC 5.4.2.7) |
Gene: Sama_0975: phosphopentomutase (EC 5.4.2.7) |
Gene: Shew_2813: phosphopentomutase (EC 5.4.2.7) |
Gene: Spea_3046: phosphopentomutase (EC 5.4.2.7) |
Gene: Shal_3134: phosphopentomutase (EC 5.4.2.7) |
Gene: swp_1231: phosphopentomutase (EC 5.4.2.7) |
Gene: Ssed_3376: phosphopentomutase (EC 5.4.2.7) |
Gene: Swoo_3547: phosphopentomutase (EC 5.4.2.7) |
phosphopentomutase (EC 5.4.2.7) |
| deoD-2 |
Gene: SO1221: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Sputcn32_2819: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Sputw3181_1192: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Shewana3_1044: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Shewmr4_1040: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Shewmr7_1105: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Sbal_3224: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Sden_1028: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Sfri_1005: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Sama_0976: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Shew_2812: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Spea_3045: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Shal_3133: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: swp_1232: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Ssed_3375: purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Swoo_3546: purine nucleoside phosphorylase (EC 2.4.2.1) |
purine nucleoside phosphorylase (EC 2.4.2.1) |
| CRON 90. | |||||||||||||||||
| SO1613 |
*
Shewanella oneidensis MR-1 Site: position = -75 score = 4.02437 sequence = TTCCTTGATTTAGCTCACACTC Gene: SO1613: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -142 score = 4.12592 sequence = TTCCTTGATTTAGATCACACTC Gene: Sputcn32_1334: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -142 score = 4.12592 sequence = TTCCTTGATTTAGATCACACTC Gene: Sputw3181_2769: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -136 score = 4.12592 sequence = TTCCTTGATTTAGATCACACTC Gene: Shewana3_2830: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -136 score = 4.12592 sequence = TTCCTTGATTTAGATCACACTC Gene: Shewmr4_2656: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -136 score = 4.12592 sequence = TTCCTTGATTTAGATCACACTC Gene: Shewmr7_2723: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -138 score = 4.1388 sequence = TTCCTTGACTTAGCTCACACTT Gene: Sbal_1436: hypothetical protein |
Gene: Sden_1518: hypothetical protein |
Gene: Sfri_1254: hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -126 score = 4.51085 sequence = TTCCTTGATCCAGATCACACAT Gene: Sama_1125: hypothetical protein |
Gene: Shew_2649: hypothetical protein |
Gene: Spea_2897: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -181 score = 4.57152 sequence = TTCCTTGATCTAGATCACACTA Gene: Shal_2994: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -271 score = 4.41941 sequence = TTCCTTGATCGAGATCACACAA Gene: swp_3538: hypothetical protein |
Gene: Ssed_3174: hypothetical protein |
Gene: Swoo_3295: hypothetical protein |
hypothetical protein |
| CRON 91. | |||||||||||||||||
| swp_1867 |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -21 score = 4.15585 sequence = AAGTGTGATCCGCAACTAAATT Gene: swp_1867: hypothetical protein swp_1867 |
|
|
hypothetical protein swp_1867 |
| icd |
*
Shewanella oneidensis MR-1 Site: position = -199 score = 4.14961 sequence = AAATGTGATCTACACCTAAATG Gene: SO2629: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
*
Shewanella putrefaciens CN-32 Site: position = -212 score = 3.9067 sequence = AAATGTGATCTGTGCCTAAATG Gene: Sputcn32_2230: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
*
Shewanella sp W3-18-1 Site: position = -212 score = 3.9067 sequence = AAATGTGATCTGTGCCTAAATG Gene: Sputw3181_1779: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
*
Shewanella sp ANA-3 Site: position = -209 score = 3.93249 sequence = AAATGTGATCTACGCCTAAATG Gene: Shewana3_1750: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
*
Shewanella sp MR-4 Site: position = -208 score = 3.93249 sequence = AAATGTGATCTACGCCTAAATG Gene: Shewmr4_1606: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
*
Shewanella sp MR-7 Site: position = -208 score = 3.93249 sequence = AAATGTGATCTACGCCTAAATG Gene: Shewmr7_1681: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
*
Shewanella baltica OS155 Site: position = -212 score = 3.9067 sequence = AAATGTGATCTGTGCCTAAATG Gene: Sbal_2475: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
Gene: Sden_1831: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -242 score = 4.56683 sequence = AATTGTGATCTGTACCTAATTT Gene: Sfri_2257: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
Gene: Sama_2059: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
*
Shewanella loihica PV-4 Site: position = -237 score = 3.77379 sequence = ATTTATGATGTCGGCCAACTAA Site: position = -217 score = 4.08763 sequence = AAATGTGATCGATAGCAAAACG Gene: Shew_1563: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
*
Shewanella pealeana ATCC 700345 Site: position = -195 score = 4.20165 sequence = AAGTGTGATCTGCAGCTAACTA Gene: Spea_2535: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
Gene: Shal_1718: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
Gene: swp_1868: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
*
Shewanella sediminis HAW-EB3 Site: position = -275 score = 3.86165 sequence = AAGTGTGATCTGCGCCAAGTTG Gene: Ssed_1883: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
*
Shewanella woodyi ATCC 51908 Site: position = -304 score = 3.87259 sequence = AAGTGTGATCTAAGCCAAGTTG Gene: Swoo_2702: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42) |
| CRON 92. | |||||||||||||||||
| SO1689 |
*
Shewanella oneidensis MR-1 Site: position = -96 score = 4.54242 sequence = AAGTGTGATACTTGCCACAAAA Gene: SO1689: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: Sputcn32_1408: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: Sputw3181_2693: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella sp ANA-3 Site: position = -96 score = 4.54242 sequence = AAGTGTGATACTTGCCACAAAA Gene: Shewana3_2761: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella sp MR-4 Site: position = -96 score = 4.54242 sequence = AAGTGTGATACTTGCCACAAAA Gene: Shewmr4_2587: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella sp MR-7 Site: position = -96 score = 4.63157 sequence = AAGTGTGATATTTGCCACAAAA Gene: Shewmr7_2654: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: Sbal_1505: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
|
Gene: Spea_2772: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: Shal_2867: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: swp_3377: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: Ssed_1485: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: Swoo_3191: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4) |
lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4) |
| CRON 93. | |||||||||||||||||
| SO0141 |
*
Shewanella oneidensis MR-1 Site: position = -161 score = 4.11599 sequence = TTTCGTGAGCTAGATTAGATAT Gene: SO0141: sensory box/GGDEF family protein |
*
Shewanella putrefaciens CN-32 Site: position = -174 score = 4.21191 sequence = TTTCGTGACCTAGATTAGATAT Gene: Sputcn32_0133: sensory box/GGDEF family protein |
*
Shewanella sp W3-18-1 Site: position = -174 score = 4.21191 sequence = TTTCGTGACCTAGATTAGATAT Gene: Sputw3181_3939: sensory box/GGDEF family protein |
*
Shewanella sp ANA-3 Site: position = -163 score = 4.11599 sequence = TTTCGTGAGCTAGATTAGATAT Gene: Shewana3_0133: sensory box/GGDEF family protein |
*
Shewanella sp MR-4 Site: position = -161 score = 4.11599 sequence = TTTCGTGAGCTAGATTAGATAT Gene: Shewmr4_0134: sensory box/GGDEF family protein |
*
Shewanella sp MR-7 Site: position = -161 score = 4.11599 sequence = TTTCGTGAGCTAGATTAGATAT Gene: Shewmr7_0128: sensory box/GGDEF family protein |
*2
Shewanella baltica OS155 Site: position = -160 score = 4.21191 sequence = TTTCGTGACCTAGATTAGATAT Gene: Sbal_4220: sensory box/GGDEF family protein Gene: Sbal_4221: sensory box/GGDEF family protein |
|
|
*
Shewanella amazonensis SB2B Site: position = -137 score = 4.64484 sequence = TTTTGTGATGTGGATTAGAAAT Gene: Sama_0142: sensory box/GGDEF family protein |
*
Shewanella loihica PV-4 Site: position = -55 score = 4.01436 sequence = TTTCGTGACCTAGATTAGACTT Gene: Shew_0041: sensory box/GGDEF family protein |
Gene: Spea_0130: sensory box/GGDEF family protein |
Gene: Shal_4188: sensory box/GGDEF family protein |
*
Shewanella piezotolerans WP3 Site: position = -156 score = 4.00778 sequence = ATTCGTGACCTAGATTAGACTT Gene: swp_0168: sensory box/GGDEF family protein |
*
Shewanella sediminis HAW-EB3 Site: position = -198 score = 3.73205 sequence = ATCATTGATAAATATAACAAAA Gene: Ssed_4373: sensory box/GGDEF family protein |
*
Shewanella woodyi ATCC 51908 Site: position = -240 score = 3.95395 sequence = AATCGTGACTTAGATTAGACTT Gene: Swoo_4765: sensory box/GGDEF family protein |
sensory box/GGDEF family protein |
| CRON 94. | |||||||||||||||||
| ycbW |
*
Shewanella oneidensis MR-1 Site: position = -63 score = 3.82148 sequence = TATTTTGATATTGAATAAAATA Site: position = -34 score = 3.80713 sequence = TGATGTGCCAGTGTTCAAATAG Site: position = -2 score = 3.68977 sequence = TTATGTTATTATTGCCGCAAAA Gene: SO2591: probable membrane protein YcbW |
*
Shewanella putrefaciens CN-32 Site: position = -63 score = 3.82148 sequence = TATTTTGATATTGAATAAAATA Site: position = -2 score = 3.80175 sequence = TTATGTTATTAATGCCGCAAAA Site: position = -34 score = 3.95911 sequence = TTATGTGCGAGTGTTCAAATAG Gene: Sputcn32_2193: probable membrane protein YcbW |
*
Shewanella sp W3-18-1 Site: position = -34 score = 3.71121 sequence = TGATGTGCGAGTGTTCAAATAG Site: position = -2 score = 3.80175 sequence = TTATGTTATTAATGCCGCAAAA Site: position = -63 score = 3.82148 sequence = TATTTTGATATTGAATAAAATA Gene: Sputw3181_1816: probable membrane protein YcbW |
*
Shewanella sp ANA-3 Site: position = -63 score = 3.82148 sequence = TATTTTGATATTGAATAAAATA Site: position = -34 score = 3.71121 sequence = TGATGTGCGAGTGTTCAAATAG Site: position = -2 score = 4.03918 sequence = TTATGTTATTATTGCCACAAAA Gene: Shewana3_1787: probable membrane protein YcbW |
*
Shewanella sp MR-4 Site: position = -63 score = 3.82148 sequence = TATTTTGATATTGAATAAAATA Site: position = -34 score = 3.80713 sequence = TGATGTGCCAGTGTTCAAATAG Site: position = -2 score = 4.03918 sequence = TTATGTTATTATTGCCACAAAA Gene: Shewmr4_1682: probable membrane protein YcbW |
*
Shewanella sp MR-7 Site: position = -63 score = 3.82148 sequence = TATTTTGATATTGAATAAAATA Site: position = -34 score = 3.71121 sequence = TGATGTGCGAGTGTTCAAATAG Site: position = -2 score = 4.03918 sequence = TTATGTTATTATTGCCACAAAA Gene: Shewmr7_1757: probable membrane protein YcbW |
*
Shewanella baltica OS155 Site: position = -2 score = 4.15117 sequence = TTATGTTATTAATGCCACAAAA Gene: Sbal_2438: probable membrane protein YcbW |
*
Shewanella denitrificans OS217 Site: position = -139 score = 4.24646 sequence = ATTTATGAGTGCGATCAAAATT Gene: Sden_1731: probable membrane protein YcbW |
Gene: Sfri_2219: probable membrane protein YcbW |
*
Shewanella amazonensis SB2B Site: position = -2 score = 3.89102 sequence = TTATGTTATTAATGCCACATAC Gene: Sama_1594: probable membrane protein YcbW |
*
Shewanella loihica PV-4 Site: position = -94 score = 4.64192 sequence = TGTTGTAATCTATATCATATTT Gene: Shew_1811: probable membrane protein YcbW |
*
Shewanella pealeana ATCC 700345 Site: position = -62 score = 4.11731 sequence = TATTTTGATATTGATGAAATTA Gene: Spea_1944: probable membrane protein YcbW |
*
Shewanella halifaxensis HAW-EB4 Site: position = -62 score = 4.11731 sequence = TATTTTGATATTGATGAAATAA Gene: Shal_2355: probable membrane protein YcbW |
*
Shewanella piezotolerans WP3 Site: position = -239 score = 3.76343 sequence = TTTAATAATATAGATCATAAAA Site: position = -143 score = 4.11731 sequence = TATTTTGATATTGATGAAATTA Site: position = -2 score = 3.97321 sequence = ATATGGAATTTCTATCACCTTT Gene: swp_2809: probable membrane protein YcbW |
*
Shewanella sediminis HAW-EB3 Site: position = -94 score = 4.64407 sequence = TATTGTTATTCAACTCATATTT Gene: Ssed_2474: probable membrane protein YcbW |
*
Shewanella woodyi ATCC 51908 Site: position = -52 score = 3.96733 sequence = TACTTTGATATTGAACAAAATA Gene: Swoo_2142: probable membrane protein YcbW |
probable membrane protein YcbW |
| CRON 95. | |||||||||||||||||
| SO0075 |
Gene: SO0075: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Sputcn32_0061: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Sputw3181_4017: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Shewana3_0080: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Shewmr4_0078: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Shewmr7_0076: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Sbal_4274: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Sden_0072: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -107 score = 4.03446 sequence = AAACGTGACCGTAAGCTCAAAA Gene: Sfri_3973: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Sama_3571: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella loihica PV-4 Site: position = -110 score = 4.743 sequence = TTTTGTGCTCCAATTAACATTA Gene: Shew_3776: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella pealeana ATCC 700345 Site: position = -109 score = 4.26124 sequence = TTTTGTGTGTTAGTTAACAAAA Gene: Spea_4186: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -109 score = 4.46168 sequence = TTTTGTGTTTGAGTTAACAAAA Gene: Shal_0063: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: swp_0114: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Ssed_4459: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella woodyi ATCC 51908 Site: position = -110 score = 4.59894 sequence = ATCTGTGATCGGTTTAACACTA Gene: Swoo_4860: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
| CRON 96. | |||||||||||||||||
| Sfri_2271 |
|
|
|
|
|
|
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -125 score = 4.10754 sequence = TTTTATGACTTAGGTCAACTTA Gene: Sfri_2271: permease of the major facilitator superfamily |
|
*
Shewanella loihica PV-4 Site: position = -123 score = 4.28786 sequence = TAACTTGAACTGGCTCACGTAA Gene: Shew_1497: permease of the major facilitator superfamily |
*
Shewanella pealeana ATCC 700345 Site: position = -100 score = 4.7532 sequence = ATATTTGATCCAGCTCAAACTT Gene: Spea_1591: permease of the major facilitator superfamily |
*
Shewanella halifaxensis HAW-EB4 Site: position = -100 score = 4.31151 sequence = ATGCTTGATCTAGCTCAAACTT Gene: Shal_1659: permease of the major facilitator superfamily |
*
Shewanella piezotolerans WP3 Site: position = -100 score = 4.13878 sequence = CTCTATGATATAGCTCACAGAT Gene: swp_1789: permease of the major facilitator superfamily |
*
Shewanella sediminis HAW-EB3 Site: position = -165 score = 3.80413 sequence = CAACTTGATTTCGCTCAAGTAT Gene: Ssed_1826: permease of the major facilitator superfamily |
*
Shewanella woodyi ATCC 51908 Site: position = -220 score = 4.14673 sequence = AAACTTGATTTCGCTCAAGTAA Gene: Swoo_2762: permease of the major facilitator superfamily |
permease of the major facilitator superfamily |
| Sfri_2272 |
|
|
|
|
|
|
|
|
Gene: Sfri_2272: hypothetical protein |
|
Gene: Shew_1498: hypothetical protein |
Gene: Spea_1592: hypothetical protein |
Gene: Shal_1660: hypothetical protein |
Gene: swp_1790: hypothetical protein |
Gene: Ssed_1827: hypothetical protein |
Gene: Swoo_2761: hypothetical protein |
hypothetical protein |
| Sfri_2273 |
|
|
|
|
|
|
|
|
Gene: Sfri_2273: nitrogen regulatory protein P-II |
|
Gene: Shew_1499: nitrogen regulatory protein P-II |
Gene: Spea_1593: nitrogen regulatory protein P-II |
Gene: Shal_1661: nitrogen regulatory protein P-II |
Gene: swp_1791: nitrogen regulatory protein P-II |
Gene: Ssed_1828: nitrogen regulatory protein P-II |
Gene: Swoo_2760: nitrogen regulatory protein P-II |
nitrogen regulatory protein P-II |
| Sfri_2274 |
|
|
|
|
|
|
|
|
Gene: Sfri_2274: hypothetical protein |
|
Gene: Shew_1500: hypothetical protein |
Gene: Spea_1594: hypothetical protein |
Gene: Shal_1662: hypothetical protein |
Gene: swp_1792: hypothetical protein |
Gene: Ssed_1829: hypothetical protein |
Gene: Swoo_2759: hypothetical protein |
hypothetical protein |
| CRON 97. | |||||||||||||||||
| SO2797 |
*
Shewanella oneidensis MR-1 Site: position = -70 score = 4.53012 sequence = TTATGAGAGCAGAATCACATTT Gene: SO2797: glutaredoxin |
Gene: Sputcn32_1562: glutaredoxin |
Gene: Sputw3181_2537: glutaredoxin |
*
Shewanella sp ANA-3 Site: position = -102 score = 4.72453 sequence = TTATGCGAGCGGAATCACATTT Gene: Shewana3_2579: glutaredoxin |
*
Shewanella sp MR-4 Site: position = -101 score = 4.72453 sequence = TTATGCGAGCGGAATCACATTT Gene: Shewmr4_2417: glutaredoxin |
*
Shewanella sp MR-7 Site: position = -88 score = 4.76284 sequence = TTATGCGAGCGAAATCACATTT Gene: Shewmr7_2487: glutaredoxin |
Gene: Sbal_1688: glutaredoxin |
Gene: Sden_2005: glutaredoxin |
Gene: Sfri_1594: glutaredoxin |
|
Gene: Shew_1501: glutaredoxin |
Gene: Spea_1598: glutaredoxin |
Gene: Shal_1666: glutaredoxin |
|
*
Shewanella sediminis HAW-EB3 Site: position = -53 score = 3.84001 sequence = TTCTGTGACATGGGTTACACTC Gene: Ssed_1830: glutaredoxin |
Gene: Swoo_2758: glutaredoxin |
glutaredoxin |
| CRON 98. | |||||||||||||||||
| SO0934 |
|
|
|
|
|
|
|
|
|
*
Shewanella amazonensis SB2B Site: position = -87 score = 4.71173 sequence = TTTTGTGGTGTATTTCGCATTT Gene: Sama_2754: Putative salt-induced outer membrane protein |
|
|
|
|
|
|
Putative salt-induced outer membrane protein |
| nhaD |
*
Shewanella oneidensis MR-1 Site: position = -278 score = 4.33848 sequence = CAATGTGATTGCTATCAACATA Gene: SO0935: Na+/H+ antiporter NhaD type |
Gene: Sputcn32_0877: Na+/H+ antiporter NhaD type |
Gene: Sputw3181_3296: Na+/H+ antiporter NhaD type |
*
Shewanella sp ANA-3 Site: position = -239 score = 4.27029 sequence = CAATGTGATTGATATCAATAAA Gene: Shewana3_3348: Na+/H+ antiporter NhaD type |
*
Shewanella sp MR-4 Site: position = -239 score = 4.27029 sequence = CAATGTGATTGATATCAATAAA Gene: Shewmr4_0778: Na+/H+ antiporter NhaD type |
*
Shewanella sp MR-7 Site: position = -239 score = 4.27029 sequence = CAATGTGATTGATATCAATAAA Gene: Shewmr7_3245: Na+/H+ antiporter NhaD type |
Gene: Sbal_0832: Na+/H+ antiporter NhaD type |
|
|
*
Shewanella amazonensis SB2B Site: position = -112 score = 3.90386 sequence = AATTTTTACGTGATTCAGATAA Site: position = -107 score = 4.09989 sequence = TTACGTGATTCAGATAAAGCTT Gene: Sama_2753: Na+/H+ antiporter NhaD type |
*
Shewanella loihica PV-4 Site: position = -77 score = 4.18783 sequence = AAACTTGAGGCGCATCAAAATT Site: position = -227 score = 3.77031 sequence = AAGCGTGATCCTGTGCTAACTT Gene: Shew_0699: Na+/H+ antiporter NhaD type |
Gene: Spea_3272: Na+/H+ antiporter NhaD type |
|
|
Gene: Ssed_0679: Na+/H+ antiporter NhaD type |
|
Na+/H+ antiporter NhaD type |
| CRON 99. | |||||||||||||||||
| tsx |
Gene: SO1215: nucleoside-specific channel-forming protein, Tsx |
*
Shewanella putrefaciens CN-32 Site: position = -268 score = 3.80575 sequence = AATAGTGATTTCTGTCGTGAAT Gene: Sputcn32_2823: nucleoside-specific channel-forming protein, Tsx |
*
Shewanella sp W3-18-1 Site: position = -268 score = 3.80575 sequence = AATAGTGATTTCTGTCGTGAAT Gene: Sputw3181_1188: nucleoside-specific channel-forming protein, Tsx |
*
Shewanella sp ANA-3 Site: position = -144 score = 4.21174 sequence = AGTCGCGACTTTGTTCACAATT Gene: Shewana3_1040: nucleoside-specific channel-forming protein, Tsx |
*
Shewanella sp MR-4 Site: position = -144 score = 4.21174 sequence = AGTCGCGACTTTGTTCACAATT Gene: Shewmr4_1036: nucleoside-specific channel-forming protein, Tsx |
*
Shewanella sp MR-7 Site: position = -144 score = 4.21174 sequence = AGTCGCGACTTTGTTCACAATT Gene: Shewmr7_1101: nucleoside-specific channel-forming protein, Tsx |
*
Shewanella baltica OS155 Site: position = -145 score = 4.21174 sequence = AGTCGCGACTTTGTTCACAATT Gene: Sbal_3228: nucleoside-specific channel-forming protein, Tsx |
*
Shewanella denitrificans OS217 Site: position = -145 score = 4.00903 sequence = AGTCACGATATTGTTCACATAT Gene: Sden_1024: nucleoside-specific channel-forming protein, Tsx |
*
Shewanella frigidimarina NCIMB 400 Site: position = -146 score = 4.18327 sequence = AGTCGCGACATTGTTCACAAAA Gene: Sfri_1001: nucleoside-specific channel-forming protein, Tsx |
|
*
Shewanella loihica PV-4 Site: position = -99 score = 3.96969 sequence = TATTGTGATTTAATACAATTTG Gene: Shew_2816: nucleoside-specific channel-forming protein, Tsx |
Gene: Spea_3049: nucleoside-specific channel-forming protein, Tsx |
Gene: Shal_3137: nucleoside-specific channel-forming protein, Tsx |
Gene: swp_1228: nucleoside-specific channel-forming protein, Tsx |
*
Shewanella sediminis HAW-EB3 Site: position = -245 score = 3.89784 sequence = CTGTGTGAGGATAAACACAATT Gene: Ssed_3379: nucleoside-specific channel-forming protein, Tsx |
*
Shewanella woodyi ATCC 51908 Site: position = -103 score = 3.72548 sequence = TGTTGTGCTTTAGCACAGAATA Gene: Swoo_3550: nucleoside-specific channel-forming protein, Tsx |
nucleoside-specific channel-forming protein, Tsx |
| CRON 100. | |||||||||||||||||
| Sputcn32_3857 |
|
Gene: Sputcn32_3857: hypothetical protein |
Gene: Sputw3181_0096: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -316 score = 4.90993 sequence = TTTTCTGATTCAGCTCACATTA Gene: Shewana3_4030: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -316 score = 4.59993 sequence = TTTTCTGACGCCGCTCACATTA Gene: Shewmr4_3822: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -316 score = 4.52625 sequence = TTTTCTGACACCGCTCACATTA Gene: Shewmr7_3913: hypothetical protein |
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -184 score = 4.34569 sequence = ATAAGTGCTATTAGTCACAAAT Gene: Sfri_0225: hypothetical protein |
|
Gene: Shew_0365: hypothetical protein |
|
|
Gene: swp_1420: hypothetical protein |
|
Gene: Swoo_0434: hypothetical protein |
hypothetical protein |
| Sputcn32_3858 |
|
Gene: Sputcn32_3858: cytochrome O ubiquinol oxidase subunit II (EC 1.10.3.-) |
Gene: Sputw3181_0095: cytochrome O ubiquinol oxidase subunit II (EC 1.10.3.-) |
Gene: Shewana3_4031: cytochrome O ubiquinol oxidase subunit II (EC 1.10.3.-) |
Gene: Shewmr4_3823: cytochrome O ubiquinol oxidase subunit II (EC 1.10.3.-) |
Gene: Shewmr7_3914: cytochrome O ubiquinol oxidase subunit II (EC 1.10.3.-) |
|
|
Gene: Sfri_0224: cytochrome O ubiquinol oxidase subunit II (EC 1.10.3.-) |
|
Gene: Shew_0366: cytochrome O ubiquinol oxidase subunit II (EC 1.10.3.-) |
|
|
Gene: swp_1422: cytochrome O ubiquinol oxidase subunit II (EC 1.10.3.-) |
|
Gene: Swoo_0433: cytochrome O ubiquinol oxidase subunit II (EC 1.10.3.-) |
cytochrome O ubiquinol oxidase subunit II (EC 1.10.3.-) |
| Sputcn32_3859 |
|
Gene: Sputcn32_3859: cytochrome O ubiquinol oxidase subunit I (EC 1.10.3.-) |
Gene: Sputw3181_0094: cytochrome O ubiquinol oxidase subunit I (EC 1.10.3.-) |
Gene: Shewana3_4032: cytochrome O ubiquinol oxidase subunit I (EC 1.10.3.-) |
Gene: Shewmr4_3824: cytochrome O ubiquinol oxidase subunit I (EC 1.10.3.-) |
Gene: Shewmr7_3915: cytochrome O ubiquinol oxidase subunit I (EC 1.10.3.-) |
|
|
Gene: Sfri_0223: cytochrome O ubiquinol oxidase subunit I (EC 1.10.3.-) |
|
Gene: Shew_0367: cytochrome O ubiquinol oxidase subunit I (EC 1.10.3.-) |
|
|
Gene: swp_1424: cytochrome O ubiquinol oxidase subunit I (EC 1.10.3.-) |
|
Gene: Swoo_0432: cytochrome O ubiquinol oxidase subunit I (EC 1.10.3.-) |
cytochrome O ubiquinol oxidase subunit I (EC 1.10.3.-) |
| Sputcn32_3860 |
|
Gene: Sputcn32_3860: cytochrome O ubiquinol oxidase subunit III (EC 1.10.3.-) |
Gene: Sputw3181_0093: cytochrome O ubiquinol oxidase subunit III (EC 1.10.3.-) |
Gene: Shewana3_4033: cytochrome O ubiquinol oxidase subunit III (EC 1.10.3.-) |
Gene: Shewmr4_3825: cytochrome O ubiquinol oxidase subunit III (EC 1.10.3.-) |
Gene: Shewmr7_3916: cytochrome O ubiquinol oxidase subunit III (EC 1.10.3.-) |
|
|
Gene: Sfri_0222: cytochrome O ubiquinol oxidase subunit III (EC 1.10.3.-) |
|
Gene: Shew_0368: cytochrome O ubiquinol oxidase subunit III (EC 1.10.3.-) |
|
|
Gene: swp_1425: cytochrome O ubiquinol oxidase subunit III (EC 1.10.3.-) |
|
Gene: Swoo_0431: cytochrome O ubiquinol oxidase subunit III (EC 1.10.3.-) |
cytochrome O ubiquinol oxidase subunit III (EC 1.10.3.-) |
| Sputcn32_3861 |
|
Gene: Sputcn32_3861: cytochrome O ubiquinol oxidase subunit IV (EC 1.10.3.-) |
Gene: Sputw3181_0092: cytochrome O ubiquinol oxidase subunit IV (EC 1.10.3.-) |
Gene: Shewana3_4034: cytochrome O ubiquinol oxidase subunit IV (EC 1.10.3.-) |
Gene: Shewmr4_3826: cytochrome O ubiquinol oxidase subunit IV (EC 1.10.3.-) |
Gene: Shewmr7_3917: cytochrome O ubiquinol oxidase subunit IV (EC 1.10.3.-) |
|
|
Gene: Sfri_0221: cytochrome O ubiquinol oxidase subunit IV (EC 1.10.3.-) |
|
Gene: Shew_0369: cytochrome O ubiquinol oxidase subunit IV (EC 1.10.3.-) |
|
|
Gene: swp_1426: cytochrome O ubiquinol oxidase subunit IV (EC 1.10.3.-) |
|
Gene: Swoo_0430: cytochrome O ubiquinol oxidase subunit IV (EC 1.10.3.-) |
cytochrome O ubiquinol oxidase subunit IV (EC 1.10.3.-) |
| Sputcn32_3862 |
|
Gene: Sputcn32_3862: heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
Gene: Sputw3181_0091: heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
Gene: Shewana3_4035: heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
Gene: Shewmr4_3827: heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
Gene: Shewmr7_3918: heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
|
|
Gene: Sfri_0220: heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
|
Gene: Shew_0370: heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
|
|
Gene: swp_1427: heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
|
Gene: Swoo_0429: heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
| CRON 101. | |||||||||||||||||
| swp_5035 |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -87 score = 3.83642 sequence = AAGTTAGCTGCAGATCACACTT Site: position = -148 score = 4.03201 sequence = TTATGAGATTTCAATTACCTTT Gene: swp_5035: hypothetical protein swp_5035 |
|
|
hypothetical protein swp_5035 |
| SO4504 |
*
Shewanella oneidensis MR-1 Site: position = -130 score = 3.99462 sequence = TTTGATGATCCACTTCAAACTA Gene: SO4504: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -140 score = 4.11224 sequence = TTTGATGATCTACTTCAAACTT Gene: Sputcn32_0342: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -140 score = 4.11224 sequence = TTTGATGATCTACTTCAAACTT Gene: Sputw3181_3866: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -225 score = 3.76818 sequence = ATGCGTGATCCGTCGCAATTAT Site: position = -131 score = 3.94831 sequence = TTTGATGATCCACCTCAAACAA Gene: Shewana3_3911: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -225 score = 3.76818 sequence = ATGCGTGATCCGTCGCAATTAT Site: position = -131 score = 3.94831 sequence = TTTGATGATCCACCTCAAACAA Gene: Shewmr4_3715: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -225 score = 3.76818 sequence = ATGCGTGATCCGTCGCAATTAT Site: position = -131 score = 3.94831 sequence = TTTGATGATCCACCTCAAACAA Gene: Shewmr7_3786: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -136 score = 4.16838 sequence = TTTGATGATCTAGTTCAAACTA Gene: Sbal_4131: hypothetical protein |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -125 score = 4.18066 sequence = TTTCGGGATCTAGTTCAAAGTT Gene: Sfri_0052: hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -113 score = 4.02309 sequence = TTTGATGATCCACTTCAAACTT Gene: Sama_3618: hypothetical protein |
*
Shewanella loihica PV-4 Site: position = -127 score = 4.07924 sequence = TTTGATGATCCAGTTCAAACTA Gene: Shew_0054: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -123 score = 4.23962 sequence = ATAGTTGATCTAGTTCAAACTA Gene: Spea_4142: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -124 score = 4.23962 sequence = ATAGTTGATCTAGTTCAAACTA Gene: Shal_0100: hypothetical protein |
Gene: swp_5034: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -123 score = 3.86645 sequence = ATTGATGATCCAGCTCAAGTTA Site: position = -217 score = 4.07283 sequence = ATGCGTGATCTCTCTCATTTAA Gene: Ssed_4426: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -148 score = 4.23717 sequence = TTTGATGATCTAGCTCAAAAAA Gene: Swoo_4818: hypothetical protein |
hypothetical protein |
| SO4505 |
Gene: SO4505: hypothetical protein probably related to Formate dehydrogenase function |
Gene: Sputcn32_0341: hypothetical protein probably related to Formate dehydrogenase function |
Gene: Sputw3181_3867: hypothetical protein probably related to Formate dehydrogenase function |
Gene: Shewana3_3912: hypothetical protein probably related to Formate dehydrogenase function |
Gene: Shewmr4_3716: hypothetical protein probably related to Formate dehydrogenase function |
Gene: Shewmr7_3787: hypothetical protein probably related to Formate dehydrogenase function |
Gene: Sbal_4132: hypothetical protein probably related to Formate dehydrogenase function |
|
Gene: Sfri_0053: hypothetical protein probably related to Formate dehydrogenase function |
Gene: Sama_3617: hypothetical protein probably related to Formate dehydrogenase function |
Gene: Shew_0055: hypothetical protein probably related to Formate dehydrogenase function |
Gene: Spea_4141: hypothetical protein probably related to Formate dehydrogenase function |
Gene: Shal_0101: hypothetical protein probably related to Formate dehydrogenase function |
Gene: swp_5033: hypothetical protein probably related to Formate dehydrogenase function |
Gene: Ssed_4425: hypothetical protein probably related to Formate dehydrogenase function |
Gene: Swoo_4817: hypothetical protein probably related to Formate dehydrogenase function |
hypothetical protein probably related to Formate dehydrogenase function |
| SO4506 |
Gene: SO4506: iron-sulfur cluster-binding protein |
Gene: Sputcn32_0340: iron-sulfur cluster-binding protein |
Gene: Sputw3181_3868: iron-sulfur cluster-binding protein |
Gene: Shewana3_3913: iron-sulfur cluster-binding protein |
Gene: Shewmr4_3717: iron-sulfur cluster-binding protein |
Gene: Shewmr7_3788: iron-sulfur cluster-binding protein |
Gene: Sbal_4133: iron-sulfur cluster-binding protein |
|
Gene: Sfri_0054: iron-sulfur cluster-binding protein |
Gene: Sama_3616: iron-sulfur cluster-binding protein |
Gene: Shew_0056: iron-sulfur cluster-binding protein |
Gene: Spea_4140: iron-sulfur cluster-binding protein |
Gene: Shal_0102: iron-sulfur cluster-binding protein |
Gene: swp_5032: iron-sulfur cluster-binding protein |
Gene: Ssed_4424: iron-sulfur cluster-binding protein |
Gene: Swoo_4816: iron-sulfur cluster-binding protein |
iron-sulfur cluster-binding protein |
| SO4507 |
Gene: SO4507: putative formate dehydrogenase-specific chaperone |
Gene: Sputcn32_0339: putative formate dehydrogenase-specific chaperone |
Gene: Sputw3181_3869: putative formate dehydrogenase-specific chaperone |
Gene: Shewana3_3914: putative formate dehydrogenase-specific chaperone |
Gene: Shewmr4_3718: putative formate dehydrogenase-specific chaperone |
Gene: Shewmr7_3789: putative formate dehydrogenase-specific chaperone |
Gene: Sbal_4134: putative formate dehydrogenase-specific chaperone |
|
Gene: Sfri_0055: putative formate dehydrogenase-specific chaperone |
Gene: Sama_3615: putative formate dehydrogenase-specific chaperone |
Gene: Shew_0057: putative formate dehydrogenase-specific chaperone |
Gene: Spea_4139: putative formate dehydrogenase-specific chaperone |
Gene: Shal_0103: putative formate dehydrogenase-specific chaperone |
Gene: swp_5031: putative formate dehydrogenase-specific chaperone |
Gene: Ssed_4423: putative formate dehydrogenase-specific chaperone |
Gene: Swoo_4815: putative formate dehydrogenase-specific chaperone |
putative formate dehydrogenase-specific chaperone |
| SO4508 |
Gene: SO4508: formate dehydrogenase subunit or accessory protein |
Gene: Sputcn32_0338: formate dehydrogenase subunit or accessory protein |
Gene: Sputw3181_3870: formate dehydrogenase subunit or accessory protein |
Gene: Shewana3_3915: formate dehydrogenase subunit or accessory protein |
Gene: Shewmr4_3719: formate dehydrogenase subunit or accessory protein |
Gene: Shewmr7_3790: formate dehydrogenase subunit or accessory protein |
Gene: Sbal_4135: formate dehydrogenase subunit or accessory protein |
|
Gene: Sfri_0056: formate dehydrogenase subunit or accessory protein |
Gene: Sama_3614: formate dehydrogenase subunit or accessory protein |
Gene: Shew_0058: formate dehydrogenase subunit or accessory protein |
Gene: Spea_4138: formate dehydrogenase subunit or accessory protein |
Gene: Shal_0104: formate dehydrogenase subunit or accessory protein |
Gene: swp_5030: formate dehydrogenase subunit or accessory protein |
Gene: Ssed_4422: formate dehydrogenase subunit or accessory protein |
Gene: Swoo_4814: formate dehydrogenase subunit or accessory protein |
formate dehydrogenase subunit or accessory protein |
| SO4509 |
Gene: SO4509: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Sputcn32_0337: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Sputw3181_3871: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Shewana3_3916: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Shewmr4_3720: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Shewmr7_3791: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Sbal_4136: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
|
Gene: Sfri_0057: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Sama_3613: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Shew_0059: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Spea_4137: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Shal_0105: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: swp_5029: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Ssed_4421: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Swoo_4813: formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
| fdhB-1 |
Gene: SO4510: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
Gene: Sputcn32_0336: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
Gene: Sputw3181_3872: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
Gene: Shewana3_3917: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
Gene: Shewmr4_3721: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
Gene: Shewmr7_3792: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
Gene: Sbal_4137: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
|
Gene: Sfri_0058: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
Gene: Sama_3612: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
Gene: Shew_0060: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
Gene: Spea_4136: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
Gene: Shal_0106: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
Gene: swp_5028: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
Gene: Ssed_4420: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
Gene: Swoo_4812: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) |
| SO4511 |
Gene: SO4511: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
Gene: Sputcn32_0335: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
Gene: Sputw3181_3873: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
Gene: Shewana3_3918: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
Gene: Shewmr4_3722: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
Gene: Shewmr7_3793: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
Gene: Sbal_4138: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
|
Gene: Sfri_0059: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
Gene: Sama_3611: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
Gene: Shew_0061: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
Gene: Spea_4135: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
Gene: Shal_0107: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
Gene: swp_5027: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
Gene: Ssed_4419: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
Gene: Swoo_4811: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
formate dehydrogenase -O, gamma subunit (EC 1.2.1.2) |
| CRON 102. | |||||||||||||||||
| SO2773 |
Gene: SO2773: hypothetical protein |
Gene: Sputcn32_1585: hypothetical protein |
Gene: Sputw3181_2437: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -125 score = 4.05267 sequence = AATTGTGCCGGATATCACTTTC Gene: Shewana3_2556: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -125 score = 4.05267 sequence = AATTGTGCCGGATATCACTTTC Gene: Shewmr4_2393: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -125 score = 4.05267 sequence = AATTGTGCCGGATATCACTTTC Gene: Shewmr7_2463: hypothetical protein |
Gene: Sbal_1722: hypothetical protein |
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -172 score = 4.8608 sequence = ATATTTGAAGTGTTTCACATAA Gene: Spea_2491: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -174 score = 4.71885 sequence = ATATTTGAGTTGATTCACAAAA Gene: Shal_1780: hypothetical protein |
Gene: swp_3040: hypothetical protein |
Gene: Ssed_2621: hypothetical protein |
Gene: Swoo_2045: hypothetical protein |
hypothetical protein |
| CRON 103. | |||||||||||||||||
| pckA |
*
Shewanella oneidensis MR-1 Site: position = -150 score = 3.81502 sequence = CTCAATGATCCAGCTCACACTT Gene: SO0162: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Shewanella putrefaciens CN-32 Site: position = -151 score = 4.0269 sequence = CACCATGATCCAGTTCACACTT Gene: Sputcn32_3571: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Shewanella sp W3-18-1 Site: position = -151 score = 4.0269 sequence = CACCATGATCCAGTTCACACTT Gene: Sputw3181_3708: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Shewanella sp ANA-3 Site: position = -151 score = 3.81502 sequence = CTCAATGATCCAGCTCACACTT Gene: Shewana3_0147: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Shewanella sp MR-4 Site: position = -149 score = 3.81502 sequence = CTCAATGATCCAGCTCACACTT Gene: Shewmr4_0152: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Shewanella sp MR-7 Site: position = -149 score = 3.81502 sequence = CTCAATGATCCAGCTCACACTT Gene: Shewmr7_0147: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
Gene: Sbal_4210: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
Gene: Sden_0117: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
Gene: Sfri_0101: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Shewanella amazonensis SB2B Site: position = -145 score = 4.13984 sequence = TTTTCAGATCCGGCTCACACAT Gene: Sama_0165: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Shewanella loihica PV-4 Site: position = -128 score = 4.57983 sequence = TTTCGCGATCTTCCTCACACAT Gene: Shew_3623: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Shewanella pealeana ATCC 700345 Site: position = -112 score = 4.93419 sequence = TTTTTTGATCTAGTACACATAT Gene: Spea_0140: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -112 score = 4.77589 sequence = TTTTTTGATCTTGCCCACATAT Gene: Shal_4178: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Shewanella piezotolerans WP3 Site: position = -113 score = 4.93419 sequence = TTTTTTGATCTAGTCCACATAT Gene: swp_0182: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Shewanella sediminis HAW-EB3 Site: position = -142 score = 4.05822 sequence = AAACACGATCTTCCTCACACAT Gene: Ssed_4362: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Shewanella woodyi ATCC 51908 Site: position = -100 score = 3.76304 sequence = AATCGTGACATAGCGCAAAGAC Gene: Swoo_4740: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
| CRON 104. | |||||||||||||||||
| sfcA |
*
Shewanella oneidensis MR-1 Site: position = -66 score = 4.02671 sequence = TTACGTGACCTATAGCACGTCT Gene: SO3855: NAD-dependent malic enzyme (EC 1.1.1.38) |
*
Shewanella putrefaciens CN-32 Site: position = -54 score = 4.35334 sequence = TTACGTGACTTAAAGCACGTAT Gene: Sputcn32_0784: NAD-dependent malic enzyme (EC 1.1.1.38) |
*
Shewanella sp W3-18-1 Site: position = -54 score = 4.35334 sequence = TTACGTGACTTAAAGCACGTAT Gene: Sputw3181_3391: NAD-dependent malic enzyme (EC 1.1.1.38) |
*
Shewanella sp ANA-3 Site: position = -65 score = 3.91119 sequence = TTACGTGACTTACAGCACGTCT Gene: Shewana3_0750: NAD-dependent malic enzyme (EC 1.1.1.38) |
*
Shewanella sp MR-4 Site: position = -66 score = 3.91119 sequence = TTACGTGACTTACAGCACGTCT Gene: Shewmr4_3188: NAD-dependent malic enzyme (EC 1.1.1.38) |
*
Shewanella sp MR-7 Site: position = -66 score = 3.91119 sequence = TTACGTGACTTACAGCACGTCT Gene: Shewmr7_0778: NAD-dependent malic enzyme (EC 1.1.1.38) |
*
Shewanella baltica OS155 Site: position = -55 score = 4.38071 sequence = TTACGTGACTTACAGCACGTAT Gene: Sbal_0676: NAD-dependent malic enzyme (EC 1.1.1.38) |
Gene: Sden_0736: NAD-dependent malic enzyme (EC 1.1.1.38) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -122 score = 4.97851 sequence = TAATGTGATTTTACTCACTTAA Gene: Sfri_0833: NAD-dependent malic enzyme (EC 1.1.1.38) |
Gene: Sama_2621: NAD-dependent malic enzyme (EC 1.1.1.38) |
Gene: Shew_2962: NAD-dependent malic enzyme (EC 1.1.1.38) |
Gene: Spea_3186: NAD-dependent malic enzyme (EC 1.1.1.38) |
Gene: Shal_3267: NAD-dependent malic enzyme (EC 1.1.1.38) |
Gene: swp_3875: NAD-dependent malic enzyme (EC 1.1.1.38) |
*
Shewanella sediminis HAW-EB3 Site: position = -87 score = 3.74562 sequence = AAACGCAACAAAGATCACACTT Gene: Ssed_3518: NAD-dependent malic enzyme (EC 1.1.1.38) |
Gene: Swoo_0902: NAD-dependent malic enzyme (EC 1.1.1.38) |
NAD-dependent malic enzyme (EC 1.1.1.38) |
| CRON 105. | |||||||||||||||||
| Swoo_2741 |
|
*
Shewanella putrefaciens CN-32 Site: position = -183 score = 4.57322 sequence = AAATGTGATATTGGTCTTAAAT Gene: Sputcn32_1599: Alkyl hydroperoxide reductase subunit C-like protein |
*
Shewanella sp W3-18-1 Site: position = -183 score = 4.57322 sequence = AAATGTGATATTGGTCTTAAAT Gene: Sputw3181_2423: Alkyl hydroperoxide reductase subunit C-like protein |
*
Shewanella sp ANA-3 Site: position = -167 score = 4.57322 sequence = AAATGTGATATTGGTCTTAAAT Gene: Shewana3_2541: Alkyl hydroperoxide reductase subunit C-like protein |
*
Shewanella sp MR-4 Site: position = -167 score = 4.57322 sequence = AAATGTGATATTGGTCTTAAAT Gene: Shewmr4_2376: Alkyl hydroperoxide reductase subunit C-like protein |
*
Shewanella sp MR-7 Site: position = -167 score = 4.57322 sequence = AAATGTGATATTGGTCTTAAAT Gene: Shewmr7_2448: Alkyl hydroperoxide reductase subunit C-like protein |
*
Shewanella baltica OS155 Site: position = -183 score = 4.57322 sequence = AAATGTGATATTGGTCTTAAAT Gene: Sbal_1738: Alkyl hydroperoxide reductase subunit C-like protein |
*
Shewanella denitrificans OS217 Site: position = -88 score = 4.66751 sequence = GATTGTGATCCCTCTCGCATAT Gene: Sden_2091: Alkyl hydroperoxide reductase subunit C-like protein |
Gene: Sfri_1455: Alkyl hydroperoxide reductase subunit C-like protein |
*
Shewanella amazonensis SB2B Site: position = -115 score = 4.27681 sequence = TTGTGTGATATTCCTCCAAATT Gene: Sama_2094: Alkyl hydroperoxide reductase subunit C-like protein |
*
Shewanella loihica PV-4 Site: position = -105 score = 4.11973 sequence = AAAAGTGACAATGATCCCAAAT Gene: Shew_1516: Alkyl hydroperoxide reductase subunit C-like protein |
Gene: Spea_2574: Alkyl hydroperoxide reductase subunit C-like protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -108 score = 4.3783 sequence = AAAAGTGATATTGATATCAAAT Gene: Shal_1683: Alkyl hydroperoxide reductase subunit C-like protein |
*
Shewanella piezotolerans WP3 Site: position = -108 score = 4.69291 sequence = AAAAGTGATATTGCTCTCAAAT Gene: swp_1821: Alkyl hydroperoxide reductase subunit C-like protein |
*
Shewanella sediminis HAW-EB3 Site: position = -106 score = 4.43889 sequence = AAAGGTGATATTGATCCCAAAT Gene: Ssed_1848: Alkyl hydroperoxide reductase subunit C-like protein |
Gene: Swoo_2741: Alkyl hydroperoxide reductase subunit C-like protein |
Alkyl hydroperoxide reductase subunit C-like protein |
| CRON 106. | |||||||||||||||||
| Sama_2899 |
|
|
|
|
|
|
|
|
|
*
Shewanella amazonensis SB2B Site: position = -126 score = 4.24675 sequence = AACTGTGATCTGAACCGCAGAA Gene: Sama_2899: transcriptional regulator, LysR family |
*
Shewanella loihica PV-4 Site: position = -137 score = 4.16218 sequence = AACTGTGATGTGATCCGCAGAA Gene: Shew_3153: transcriptional regulator, LysR family |
|
|
*
Shewanella piezotolerans WP3 Site: position = -157 score = 4.22516 sequence = TATTGTGACCGGTTACGCAGTA Gene: swp_4120: transcriptional regulator, LysR family |
*
Shewanella sediminis HAW-EB3 Site: position = -184 score = 5.05502 sequence = ATGTGTGACCAGGTTCACAATT Gene: Ssed_3566: transcriptional regulator, LysR family |
|
transcriptional regulator, LysR family |
| CRON 107. | |||||||||||||||||
| SO3987 |
*
Shewanella oneidensis MR-1 Site: position = -83 score = 3.89726 sequence = TCTTGTGAGCGAGTTCACGCCT Gene: SO3987: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -83 score = 3.96023 sequence = TCTTGTGAGCCAGTTCACGCCT Gene: Sputcn32_0679: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -83 score = 3.96023 sequence = TCTTGTGAGCCAGTTCACGCCT Gene: Sputw3181_3492: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -83 score = 3.96023 sequence = TCTTGTGAGCCAGTTCACGCCT Gene: Shewana3_0651: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -83 score = 4.14529 sequence = TCTTGTGACCTAGTTCACGCCT Gene: Shewmr4_0652: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -83 score = 4.14529 sequence = TCTTGTGACCTAGTTCACGCCT Gene: Shewmr7_3370: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -277 score = 3.72399 sequence = TAAAGCGATATATGTAACAAAC Gene: Sbal_0787: hypothetical protein |
Gene: Sden_2983: hypothetical protein |
Gene: Sfri_0534: hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -307 score = 4.09911 sequence = AAATTGAATATGGATCACATTT Gene: Sama_0602: hypothetical protein |
*
Shewanella loihica PV-4 Site: position = -82 score = 4.40973 sequence = TAAAGTGACCTGTCTCACACCT Site: position = -147 score = 5.10165 sequence = AGATTTGATGTAAATCACATTT Gene: Shew_0778: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -147 score = 4.07768 sequence = CGATATGATTTGGATCACTTTT Site: position = -82 score = 4.21325 sequence = AATAGTGATATACATCACAAGG Gene: Spea_0734: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -81 score = 4.90706 sequence = AATAGTGATGCAGATCACACTG Gene: Shal_0787: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -4 score = 4.56347 sequence = TACTGTGATCGATATCACGTCT Gene: swp_4346: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -321 score = 3.94332 sequence = AAACTCAATATAGTTCACATTT Site: position = -147 score = 3.8978 sequence = GGATATGATCTAAATCACACTG Gene: Ssed_0816: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -82 score = 4.302 sequence = TTGTGTGACCTGCATCACGCCA Gene: Swoo_3763: hypothetical protein |
hypothetical protein |
| CRON 108. | |||||||||||||||||
| Spea_3921 |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -41 score = 4.373 sequence = AACTGTGACAAAGATCACTATT Gene: Spea_3921: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -42 score = 4.96214 sequence = AAGTGTGACGCAGATCACCATT Gene: Shal_0348: hypothetical protein |
Gene: swp_0262: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -42 score = 5.04394 sequence = TCTTGTGATACAGGTCACATTA Gene: Ssed_0288: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -48 score = 5.19147 sequence = AAGTGTGACTTAGATCACACAA Gene: Swoo_3910: hypothetical protein |
hypothetical protein |
| CRON 109. | |||||||||||||||||
| cctA |
*
Shewanella oneidensis MR-1 Site: position = -184 score = 4.4206 sequence = TTACATGATGCAGCGCACATTT Gene: SO2727: cytochrome c3 |
*
Shewanella putrefaciens CN-32 Site: position = -183 score = 4.4206 sequence = TTACATGATGCAGCGCACATTT Gene: Sputcn32_2333: cytochrome c3 |
*
Shewanella sp W3-18-1 Site: position = -183 score = 4.4206 sequence = TTACATGATGCAGCGCACATTT Gene: Sputw3181_1675: cytochrome c3 |
*
Shewanella sp ANA-3 Site: position = -183 score = 4.4206 sequence = TTACATGATGCAGCGCACATTT Gene: Shewana3_2511: cytochrome c3 |
*
Shewanella sp MR-4 Site: position = -184 score = 4.4206 sequence = TTACATGATGCAGCGCACATTT Gene: Shewmr4_2318: cytochrome c3 |
*
Shewanella sp MR-7 Site: position = -184 score = 4.4206 sequence = TTACATGATGCAGCGCACATTT Gene: Shewmr7_2388: cytochrome c3 |
*
Shewanella baltica OS155 Site: position = -184 score = 4.4206 sequence = TTACATGATGCAGCGCACATTT Gene: Sbal_1793: cytochrome c3 |
|
|
|
*
Shewanella loihica PV-4 Site: position = -224 score = 4.60426 sequence = TAGTGTGACGCAGATCATGTTT Site: position = -174 score = 4.6621 sequence = ATATTTGATTAAGTGCACATTT Gene: Shew_1724: cytochrome c3 |
|
|
|
|
|
cytochrome c3 |
| CRON 110. | |||||||||||||||||
| fadD-2 |
Gene: SO3664: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella putrefaciens CN-32 Site: position = -118 score = 4.59885 sequence = CGTTGTGATGTTTTTCACGATA Gene: Sputcn32_0970: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella sp W3-18-1 Site: position = -117 score = 4.59885 sequence = CGTTGTGATGTTTTTCACGATA Gene: Sputw3181_3197: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Shewana3_3231: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Shewmr4_0883: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Shewmr7_3139: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Sbal_0956: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Sden_2934: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -256 score = 4.98121 sequence = TTTGGTGACATAGATCACATAT Gene: Sfri_3097: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Sama_2897: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Shew_3084: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Spea_3322: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Shal_3395: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella piezotolerans WP3 Site: position = -222 score = 3.71691 sequence = ATGCGCGATTTGCATTACCTTT Gene: swp_3965: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella sediminis HAW-EB3 Site: position = -135 score = 5.41392 sequence = TAATGTGATCTATTTCTCATAT Gene: Ssed_3695: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella woodyi ATCC 51908 Site: position = -147 score = 3.73378 sequence = AACCATGATCTATTTCGTAATT Gene: Swoo_3995: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
| CRON 111. | |||||||||||||||||
| Sama_3134 |
|
|
|
|
|
|
|
|
|
Gene: Sama_3134: membrane protein |
*
Shewanella loihica PV-4 Site: position = -94 score = 4.86375 sequence = CAATGTGATCTGCTTCACACTC Gene: Shew_0455: membrane protein |
*
Shewanella pealeana ATCC 700345 Site: position = -85 score = 4.74675 sequence = AAGTGTGACCAGGTTCACGAAT Gene: Spea_3708: membrane protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -156 score = 4.91732 sequence = AAGCGTGATCTGGTTCACGAAT Gene: Shal_3793: membrane protein |
*
Shewanella piezotolerans WP3 Site: position = -100 score = 5.65449 sequence = TTTTGTGATCTGCCTCACAAAT Gene: swp_0564: membrane protein |
|
Gene: Swoo_4326: membrane protein |
membrane protein |
| CRON 112. | |||||||||||||||||
| acnB |
*
Shewanella oneidensis MR-1 Site: position = -141 score = 4.07327 sequence = GAGTGTGACCTGATTCATACTT Gene: SO0432: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella putrefaciens CN-32 Site: position = -141 score = 4.07327 sequence = GAGTGTGACCTGATTCATACTT Gene: Sputcn32_3409: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella sp W3-18-1 Site: position = -141 score = 4.07327 sequence = GAGTGTGACCTGATTCATACTT Gene: Sputw3181_0534: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella sp ANA-3 Site: position = -66 score = 4.07327 sequence = GAGTGTGACCTGATTCATACTT Gene: Shewana3_0433: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella sp MR-4 Site: position = -66 score = 4.07327 sequence = GAGTGTGACCTGATTCATACTT Gene: Shewmr4_0437: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella sp MR-7 Site: position = -66 score = 4.07327 sequence = GAGTGTGACCTGATTCATACTT Gene: Shewmr7_3592: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella baltica OS155 Site: position = -66 score = 4.07327 sequence = GAGTGTGACCTGATTCATACTT Gene: Sbal_3905: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella denitrificans OS217 Site: position = -139 score = 4.11438 sequence = CAGTGTGAGCCGATTCATACTT Site: position = -67 score = 3.89103 sequence = AATTGTTAGCCTTATCACTATG Gene: Sden_3377: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -139 score = 4.58117 sequence = TAGTGTGAGCTGATTCATACTT Gene: Sfri_3771: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella amazonensis SB2B Site: position = -138 score = 3.97735 sequence = GAGTGTGAGCTGATTCATACTT Gene: Sama_0382: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella loihica PV-4 Site: position = -140 score = 4.32991 sequence = GAGTGTGATCTGATTCATACTT Gene: Shew_3424: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella pealeana ATCC 700345 Site: position = -268 score = 4.03476 sequence = TTATATAATTTAGATCAAGTTT Site: position = -160 score = 4.77503 sequence = AAGTGTGATCGGATTCATACTT Gene: Spea_0425: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -247 score = 3.73206 sequence = TTATATAATTTAGATCAAGGTT Site: position = -139 score = 4.97949 sequence = AAATGTGATCGGATTCATACTT Gene: Shal_0482: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella piezotolerans WP3 Site: position = -245 score = 3.94195 sequence = TTATGTGATTAATCTCAGTGTT Site: position = -139 score = 4.92715 sequence = AAGTGTGATCTGATTCATACTT Gene: swp_4740: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella sediminis HAW-EB3 Site: position = -141 score = 4.4274 sequence = GAGTGTGATCTGATTCAAACTT Gene: Ssed_0438: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
*
Shewanella woodyi ATCC 51908 Site: position = -139 score = 4.4274 sequence = GAGTGTGATCTGATTCAAACTT Gene: Swoo_0285: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99) |
| CRON 113. | |||||||||||||||||
| SO3120 |
*
Shewanella oneidensis MR-1 Site: position = -186 score = 4.27651 sequence = AAACGCGATCTTTATCACTATT Gene: SO3120: oxidoreductase, Gfo/Idh/MocA family |
*
Shewanella putrefaciens CN-32 Site: position = -173 score = 4.27651 sequence = AAACGCGATCTTTATCACTATT Gene: Sputcn32_2490: oxidoreductase, Gfo/Idh/MocA family |
*
Shewanella sp W3-18-1 Site: position = -173 score = 4.27651 sequence = AAACGCGATCTTTATCACTATT Gene: Sputw3181_1518: oxidoreductase, Gfo/Idh/MocA family |
*
Shewanella sp ANA-3 Site: position = -187 score = 4.27651 sequence = AAACGCGATCTTTATCACTATT Gene: Shewana3_1428: oxidoreductase, Gfo/Idh/MocA family |
*
Shewanella sp MR-4 Site: position = -186 score = 4.27651 sequence = AAACGCGATCTTTATCACTATT Gene: Shewmr4_1375: oxidoreductase, Gfo/Idh/MocA family |
*
Shewanella sp MR-7 Site: position = -186 score = 4.27651 sequence = AAACGCGATCTTTATCACTATT Gene: Shewmr7_1440: oxidoreductase, Gfo/Idh/MocA family |
*
Shewanella baltica OS155 Site: position = -202 score = 4.27651 sequence = AAACGCGATCTTTATCACTATT Gene: Sbal_2793: oxidoreductase, Gfo/Idh/MocA family |
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -158 score = 3.95699 sequence = AAACGCGATATAAATCACTTTC Gene: Spea_1465: oxidoreductase, Gfo/Idh/MocA family |
*
Shewanella halifaxensis HAW-EB4 Site: position = -207 score = 3.95699 sequence = AAACGCGATATAAATCACTTTC Gene: Shal_1548: oxidoreductase, Gfo/Idh/MocA family |
*
Shewanella piezotolerans WP3 Site: position = -185 score = 3.73987 sequence = AAACGCGATTTAAGTCACTTTC Gene: swp_1670: oxidoreductase, Gfo/Idh/MocA family |
|
*
Shewanella woodyi ATCC 51908 Site: position = -214 score = 4.18547 sequence = AAACGCGATCTAAGTCACTTAA Gene: Swoo_1749: oxidoreductase, Gfo/Idh/MocA family |
oxidoreductase, Gfo/Idh/MocA family |
| CRON 114. | |||||||||||||||||
| swp_3747 |
|
|
|
*
Shewanella sp ANA-3 Site: position = -85 score = 4.3711 sequence = GGATGTGAGTTGCTTCACAATT Gene: Shewana3_1142: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -85 score = 5.01795 sequence = AGATGTGACTTGCCTCACAATT Gene: Shewmr4_1141: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -85 score = 4.42071 sequence = GGATGTGACTTGCCTCACAATT Gene: Shewmr7_1212: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -78 score = 5.50059 sequence = AAATGTGATTAAGTTCACAATT Gene: Sbal_1230: hypothetical protein |
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -77 score = 4.38742 sequence = CTGTGCGATCTGTGTCACAATT Gene: Spea_1069: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -77 score = 3.80397 sequence = CGGTGCGATCTGTATCACTATT Gene: Shal_1117: hypothetical protein |
Gene: swp_3747: hypothetical protein |
|
|
hypothetical protein |
| CRON 115. | |||||||||||||||||
| yhgI |
*
Shewanella oneidensis MR-1 Site: position = -129 score = 3.91898 sequence = AATCGTGATCACTATGGCAAAA Gene: SO4619: NfuA Fe-S protein maturation |
*
Shewanella putrefaciens CN-32 Site: position = -129 score = 4.18081 sequence = AATCGTGATCACTTTTGCAAAA Gene: Sputcn32_3794: NfuA Fe-S protein maturation |
*
Shewanella sp W3-18-1 Site: position = -129 score = 4.18081 sequence = AATCGTGATCACTTTTGCAAAA Gene: Sputw3181_0119: NfuA Fe-S protein maturation |
*
Shewanella sp ANA-3 Site: position = -128 score = 4.13984 sequence = AAGCGTGATGGATTTTGCAAAA Gene: Shewana3_4003: NfuA Fe-S protein maturation |
*
Shewanella sp MR-4 Site: position = -128 score = 4.13984 sequence = AAGCGTGATGGATTTTGCAAAA Gene: Shewmr4_3804: NfuA Fe-S protein maturation |
*
Shewanella sp MR-7 Site: position = -128 score = 4.13984 sequence = AAGCGTGATGGATTTTGCAAAA Gene: Shewmr7_3880: NfuA Fe-S protein maturation |
*
Shewanella baltica OS155 Site: position = -129 score = 4.00718 sequence = AATCGTGATCGCTATGGCAAAA Gene: Sbal_0142: NfuA Fe-S protein maturation |
Gene: Sden_3528: NfuA Fe-S protein maturation |
Gene: Sfri_0244: NfuA Fe-S protein maturation |
Gene: Sama_3502: NfuA Fe-S protein maturation |
Gene: Shew_0106: NfuA Fe-S protein maturation |
Gene: Spea_4010: NfuA Fe-S protein maturation |
Gene: Shal_0247: NfuA Fe-S protein maturation |
*
Shewanella piezotolerans WP3 Site: position = -131 score = 3.78343 sequence = AAATGTGATCAGAACTGCGTTA Gene: swp_4841: NfuA Fe-S protein maturation |
Gene: Ssed_0179: NfuA Fe-S protein maturation |
Gene: Swoo_0159: NfuA Fe-S protein maturation |
NfuA Fe-S protein maturation |
| CRON 116. | |||||||||||||||||
| SO4118 |
*
Shewanella oneidensis MR-1 Site: position = -132 score = 4.34144 sequence = AAATGTGACCTAATTGACGTAT Site: position = -318 score = 4.35315 sequence = TATTGTAATTTAGTCAACATTT Gene: SO4118: NADP-dependent malic enzyme (EC 1.1.1.40) |
*
Shewanella putrefaciens CN-32 Site: position = -313 score = 3.95742 sequence = TATTGTAATTTAGCCAAAATTT Gene: Sputcn32_0554: NADP-dependent malic enzyme (EC 1.1.1.40) |
*
Shewanella sp W3-18-1 Site: position = -313 score = 3.95742 sequence = TATTGTAATTTAGCCAAAATTT Gene: Sputw3181_3618: NADP-dependent malic enzyme (EC 1.1.1.40) |
*
Shewanella sp ANA-3 Site: position = -312 score = 4.24117 sequence = TATTGTAATTTAATCAACATTT Gene: Shewana3_3669: NADP-dependent malic enzyme (EC 1.1.1.40) |
*
Shewanella sp MR-4 Site: position = -312 score = 4.24117 sequence = TATTGTAATTTAATCAACATTT Gene: Shewmr4_3492: NADP-dependent malic enzyme (EC 1.1.1.40) |
*
Shewanella sp MR-7 Site: position = -312 score = 4.24117 sequence = TATTGTAATTTAATCAACATTT Gene: Shewmr7_0460: NADP-dependent malic enzyme (EC 1.1.1.40) |
Gene: Sbal_3841: NADP-dependent malic enzyme (EC 1.1.1.40) |
*
Shewanella denitrificans OS217 Site: position = -298 score = 3.80615 sequence = TCTTGTTATTTAAACAACATTT Site: position = -197 score = 4.1877 sequence = TAATGTGATGCATAGCAGCCTT Gene: Sden_3353: NADP-dependent malic enzyme (EC 1.1.1.40) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -303 score = 4.06916 sequence = TATTGTTATTTAGACAAAATAA Gene: Sfri_3757: NADP-dependent malic enzyme (EC 1.1.1.40) |
Gene: Sama_0448: NADP-dependent malic enzyme (EC 1.1.1.40) |
Gene: Shew_0383: NADP-dependent malic enzyme (EC 1.1.1.40) |
*
Shewanella pealeana ATCC 700345 Site: position = -196 score = 3.76172 sequence = TATAGCGATAAAGTTAAAAAAT Gene: Spea_3774: NADP-dependent malic enzyme (EC 1.1.1.40) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -196 score = 3.76172 sequence = TATAGCGATAAAGTTAAAAAAT Gene: Shal_3859: NADP-dependent malic enzyme (EC 1.1.1.40) |
*
Shewanella piezotolerans WP3 Site: position = -181 score = 3.84417 sequence = TATAGCGATAAAGTTAAAATTT Gene: swp_0481: NADP-dependent malic enzyme (EC 1.1.1.40) |
Gene: Ssed_0538: NADP-dependent malic enzyme (EC 1.1.1.40) |
*
Shewanella woodyi ATCC 51908 Site: position = -345 score = 3.79525 sequence = AAGTTTTATCTAGTTAACCCTT Gene: Swoo_4423: NADP-dependent malic enzyme (EC 1.1.1.40) |
NADP-dependent malic enzyme (EC 1.1.1.40) |
| mshH |
Gene: SO4116: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
Gene: Sputcn32_0555: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
Gene: Sputw3181_3617: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
Gene: Shewana3_3668: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
Gene: Shewmr4_3491: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
Gene: Shewmr7_0461: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
Gene: Sbal_3840: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
Gene: Sden_3352: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
Gene: Sfri_3756: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
Gene: Sama_0449: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
Gene: Shew_0384: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
2
Shewanella pealeana ATCC 700345 Gene: Spea_3773: MSHA biogenesis protein MshH, GGDEF:EAL domain protein Gene: Spea_0796: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
2
Shewanella halifaxensis HAW-EB4 Gene: Shal_3858: MSHA biogenesis protein MshH, GGDEF:EAL domain protein Gene: Shal_0852: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
Gene: swp_0483: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
2
Shewanella sediminis HAW-EB3 Gene: Ssed_0539: MSHA biogenesis protein MshH, GGDEF:EAL domain protein Gene: Ssed_0886: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
Gene: Swoo_4422: MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
MSHA biogenesis protein MshH, GGDEF:EAL domain protein |
| mshI |
Gene: SO4114.2: MSHA biogenesis protein MshI |
*
Shewanella putrefaciens CN-32 Site: position = -114 score = 3.80771 sequence = GAATATGACAGGTTTCACGTTT Gene: Sputcn32_0556: MSHA biogenesis protein MshI |
*
Shewanella sp W3-18-1 Site: position = -114 score = 3.80771 sequence = GAATATGACAGGTTTCACGTTT Gene: Sputw3181_3616: MSHA biogenesis protein MshI |
*
Shewanella sp ANA-3 Site: position = -119 score = 4.19839 sequence = GGATATGATGGGTTTCACATTT Gene: Shewana3_3667: MSHA biogenesis protein MshI |
Gene: Shewmr4_3490: MSHA biogenesis protein MshI |
Gene: Shewmr7_0462: MSHA biogenesis protein MshI |
Gene: Sbal_3839: MSHA biogenesis protein MshI |
Gene: Sden_3351: MSHA biogenesis protein MshI |
Gene: Sfri_3755: MSHA biogenesis protein MshI |
Gene: Sama_0450: MSHA biogenesis protein MshI |
Gene: Shew_0385: MSHA biogenesis protein MshI |
Gene: Spea_3772: MSHA biogenesis protein MshI |
Gene: Shal_3857: MSHA biogenesis protein MshI |
Gene: swp_0484: MSHA biogenesis protein MshI |
Gene: Ssed_0540: MSHA biogenesis protein MshI |
Gene: Swoo_4421: MSHA biogenesis protein MshI |
MSHA biogenesis protein MshI |
| CRON 117. | |||||||||||||||||
| SO2757 |
*
Shewanella oneidensis MR-1 Site: position = -225 score = 4.17827 sequence = ATTTAAGACCAATATCACATTT Gene: SO2757: Histidine permease YuiF |
*
Shewanella putrefaciens CN-32 Site: position = -225 score = 4.17827 sequence = ATTTAAGACCAATATCACATTT Gene: Sputcn32_1598: Histidine permease YuiF |
*
Shewanella sp W3-18-1 Site: position = -225 score = 4.17827 sequence = ATTTAAGACCAATATCACATTT Gene: Sputw3181_2424: Histidine permease YuiF |
*
Shewanella sp ANA-3 Site: position = -225 score = 4.17827 sequence = ATTTAAGACCAATATCACATTT Gene: Shewana3_2542: Histidine permease YuiF |
*
Shewanella sp MR-4 Site: position = -225 score = 4.17827 sequence = ATTTAAGACCAATATCACATTT Gene: Shewmr4_2377: Histidine permease YuiF |
*
Shewanella sp MR-7 Site: position = -225 score = 4.17827 sequence = ATTTAAGACCAATATCACATTT Gene: Shewmr7_2449: Histidine permease YuiF |
*
Shewanella baltica OS155 Site: position = -227 score = 4.17827 sequence = ATTTAAGACCAATATCACATTT Gene: Sbal_1737: Histidine permease YuiF |
*
Shewanella denitrificans OS217 Site: position = -208 score = 4.27341 sequence = ATATGCGAGAGGGATCACAATC Gene: Sden_2092: Histidine permease YuiF |
*
Shewanella frigidimarina NCIMB 400 Site: position = -191 score = 3.54346 sequence = TTAAATAATAAGTTTCAAATAT Gene: Sfri_1454: Histidine permease YuiF |
*
Shewanella amazonensis SB2B Site: position = -210 score = 3.8951 sequence = AATTTGGAGGAATATCACACAA Gene: Sama_2095: Histidine permease YuiF |
*
Shewanella loihica PV-4 Site: position = -230 score = 4.01363 sequence = ATTTGGGATCATTGTCACTTTT Gene: Shew_1515: Histidine permease YuiF |
Gene: Spea_2575: Histidine permease YuiF |
*
Shewanella halifaxensis HAW-EB4 Site: position = -225 score = 3.9101 sequence = ATTTGATATCAATATCACTTTT Gene: Shal_1682: Histidine permease YuiF |
*
Shewanella piezotolerans WP3 Site: position = -77 score = 4.07147 sequence = ATTTGAGAGCAATATCACTTTT Gene: swp_1820: Histidine permease YuiF |
*
Shewanella sediminis HAW-EB3 Site: position = -226 score = 4.53795 sequence = ATTTGGGATCAATATCACCTTT Gene: Ssed_1847: Histidine permease YuiF |
*
Shewanella woodyi ATCC 51908 Site: position = -155 score = 3.95335 sequence = TTTAGTGCTGTTATTTACACTT Gene: Swoo_2742: Histidine permease YuiF |
Histidine permease YuiF |
| CRON 118. | |||||||||||||||||
| rplY |
*
Shewanella oneidensis MR-1 Site: position = -95 score = 4.43963 sequence = AAGTGTGATCAAGATCACGTGT Gene: SO2112: LSU ribosomal protein L25p |
*
Shewanella putrefaciens CN-32 Site: position = -245 score = 4.43749 sequence = AAATGTGATCTAGATCTCGTGT Gene: Sputcn32_1895: LSU ribosomal protein L25p |
*
Shewanella sp W3-18-1 Site: position = -245 score = 4.43749 sequence = AAATGTGATCTAGATCTCGTGT Gene: Sputw3181_2113: LSU ribosomal protein L25p |
*
Shewanella sp ANA-3 Site: position = -234 score = 3.83501 sequence = TTTTTTGATTCAGATCAAAGCC Gene: Shewana3_1892: LSU ribosomal protein L25p |
*
Shewanella sp MR-4 Site: position = -255 score = 4.09021 sequence = AAGTGTGATCAAGATCGCGTGT Site: position = -234 score = 4.30453 sequence = TTTTTTGATTCAGATCAAAGAC Gene: Shewmr4_1834: LSU ribosomal protein L25p |
*
Shewanella sp MR-7 Site: position = -255 score = 4.09021 sequence = AAGTGTGATCAAGATCGCGTGT Site: position = -234 score = 4.30453 sequence = TTTTTTGATTCAGATCAAAGAC Gene: Shewmr7_2143: LSU ribosomal protein L25p |
*
Shewanella baltica OS155 Site: position = -247 score = 3.95946 sequence = CAGTGTGATCTAGATCGCGTGT Gene: Sbal_1901: LSU ribosomal protein L25p |
Gene: Sden_1503: LSU ribosomal protein L25p |
Gene: Sfri_1442: LSU ribosomal protein L25p |
*
Shewanella amazonensis SB2B Site: position = -233 score = 3.92115 sequence = AAATGTGAACAAGATCACAGGC Gene: Sama_1614: LSU ribosomal protein L25p |
Gene: Shew_1830: LSU ribosomal protein L25p |
Gene: Spea_1959: LSU ribosomal protein L25p |
Gene: Shal_2340: LSU ribosomal protein L25p |
Gene: swp_2792: LSU ribosomal protein L25p |
Gene: Ssed_2449: LSU ribosomal protein L25p |
Gene: Swoo_2155: LSU ribosomal protein L25p |
LSU ribosomal protein L25p |
| CRON 119. | |||||||||||||||||
| SO0544 |
*
Shewanella oneidensis MR-1 Site: position = -141 score = 3.98963 sequence = TTTTGTGATTTAGCGCATAACG Gene: SO0544: sensory box histidine kinase |
*
Shewanella putrefaciens CN-32 Site: position = -242 score = 4.04794 sequence = TTTTGTGAATTAGAGTAAAAAT Gene: Sputcn32_3330: sensory box histidine kinase |
*
Shewanella sp W3-18-1 Site: position = -242 score = 4.04794 sequence = TTTTGTGAATTAGAGTAAAAAT Gene: Sputw3181_0611: sensory box histidine kinase |
*
Shewanella sp ANA-3 Site: position = -144 score = 4.32778 sequence = TTTTGTGATTTAGCGCATAACT Gene: Shewana3_0542: sensory box histidine kinase |
*
Shewanella sp MR-4 Site: position = -146 score = 4.08746 sequence = TTTTGTGATTAAGCGCATAACT Gene: Shewmr4_0543: sensory box histidine kinase |
*
Shewanella sp MR-7 Site: position = -145 score = 4.08746 sequence = TTTTGTGATTAAGCGCATAACT Gene: Shewmr7_3487: sensory box histidine kinase |
*
Shewanella baltica OS155 Site: position = -145 score = 4.69565 sequence = TTTTGTGATTGAGAGCACAACA Gene: Sbal_0502: sensory box histidine kinase |
|
|
Gene: Sama_3163: sensory box histidine kinase |
|
|
|
|
|
|
sensory box histidine kinase |
| SO0544.1 |
Gene: SO0544.1: response regulator receiver protein |
Gene: Sputcn32_3329: response regulator receiver protein |
Gene: Sputw3181_0612: response regulator receiver protein |
Gene: Shewana3_0543: response regulator receiver protein |
Gene: Shewmr4_0544: response regulator receiver protein |
Gene: Shewmr7_3486: response regulator receiver protein |
Gene: Sbal_0503: response regulator receiver protein |
|
|
Gene: Sama_3162: response regulator receiver protein |
|
|
|
|
|
|
response regulator receiver protein |
| CRON 120. | |||||||||||||||||
| Shewmr4_2871 |
|
|
|
|
*
Shewanella sp MR-4 Site: position = -55 score = 4.30048 sequence = AATAGTGATTTTTATTGCAAAT Gene: Shewmr4_2871: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -55 score = 4.30048 sequence = AATAGTGATTTTTATTGCAAAT Gene: Shewmr7_2953: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| SO1326 |
*
Shewanella oneidensis MR-1 Site: position = -294 score = 4.30048 sequence = AATAGTGATTTTTATTGCAAAT Gene: SO1326: COG1242: Predicted Fe-S oxidoreductase |
*
Shewanella putrefaciens CN-32 Site: position = -224 score = 4.55994 sequence = ATTTGTGAGGTAGATCGCTAAA Site: position = -293 score = 4.30048 sequence = AATAGTGATTTTTATTGCAAAT Gene: Sputcn32_1137: COG1242: Predicted Fe-S oxidoreductase |
*
Shewanella sp W3-18-1 Site: position = -293 score = 4.30048 sequence = AATAGTGATTTTTATTGCAAAT Site: position = -224 score = 4.31526 sequence = GTTTGTGATGTAGATCGCTAAA Gene: Sputw3181_3027: COG1242: Predicted Fe-S oxidoreductase |
*
Shewanella sp ANA-3 Site: position = -294 score = 4.30048 sequence = AATAGTGATTTTTATTGCAAAT Gene: Shewana3_3048: COG1242: Predicted Fe-S oxidoreductase |
Gene: Shewmr4_2870: COG1242: Predicted Fe-S oxidoreductase |
Gene: Shewmr7_2952: COG1242: Predicted Fe-S oxidoreductase |
*
Shewanella baltica OS155 Site: position = -293 score = 3.92942 sequence = AATAGTGATTTTTATTGCAAAC Site: position = -225 score = 4.15862 sequence = TGATGTGAGCAATATCTCAATG Site: position = -193 score = 4.28068 sequence = TAATTTGAGGATGCGCACATTT Gene: Sbal_1179: COG1242: Predicted Fe-S oxidoreductase |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -128 score = 3.91491 sequence = TTTTTTGAGTTTGTGCACAACT Gene: Sfri_2950: COG1242: Predicted Fe-S oxidoreductase |
Gene: Sama_0858: COG1242: Predicted Fe-S oxidoreductase |
*
Shewanella loihica PV-4 Site: position = -127 score = 4.0363 sequence = TACAGTGAATTATTTAACAAAT Site: position = -148 score = 4.36051 sequence = AAAAGTGATTTTTATTGCATAT Gene: Shew_1033: COG1242: Predicted Fe-S oxidoreductase |
*
Shewanella pealeana ATCC 700345 Site: position = -201 score = 4.00915 sequence = TAAAGTGATTTTTTTTGCAGAT Site: position = -303 score = 3.93471 sequence = TAAATTGACCTGTATAACCTTA Gene: Spea_1014: COG1242: Predicted Fe-S oxidoreductase |
*
Shewanella halifaxensis HAW-EB4 Site: position = -210 score = 3.96284 sequence = TAAAGTGATTTTTCTTGCAGAT Gene: Shal_1062: COG1242: Predicted Fe-S oxidoreductase |
*
Shewanella piezotolerans WP3 Site: position = -111 score = 3.78833 sequence = TTATTTGAGCTAGCGCTAATAA Gene: swp_3802: COG1242: Predicted Fe-S oxidoreductase |
Gene: Ssed_1127: COG1242: Predicted Fe-S oxidoreductase |
*
Shewanella woodyi ATCC 51908 Site: position = -229 score = 3.81144 sequence = AAATATGAGTTCTATTGCAAAT Gene: Swoo_1222: COG1242: Predicted Fe-S oxidoreductase |
COG1242: Predicted Fe-S oxidoreductase |
| CRON 121. | |||||||||||||||||
| SO3776 |
*
Shewanella oneidensis MR-1 Site: position = -137 score = 4.15767 sequence = CAATGTGAGCGGCTTCAAAATG Gene: SO3776: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -147 score = 4.24012 sequence = CAATGTGAGCGGCTTCAAATTG Gene: Sputcn32_3102: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -147 score = 4.24012 sequence = CAATGTGAGCGGCTTCAAATTG Gene: Sputw3181_0842: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -141 score = 4.24012 sequence = CAATGTGAGCGGCTTCAAATTG Gene: Shewana3_0817: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -141 score = 4.24012 sequence = CAATGTGAGCGGCTTCAAATTG Gene: Shewmr4_3123: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -30 score = 3.809 sequence = TAACGTGTTCTACAACAAACTA Gene: Shewmr7_0844: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -146 score = 3.81686 sequence = GAGTGCGAGCTAGCTCAAATTT Gene: Sbal_3459: hypothetical protein |
Gene: Sden_1017: hypothetical protein |
Gene: Sfri_3000: hypothetical protein |
|
Gene: Shew_2715: hypothetical protein |
Gene: Spea_2939: hypothetical protein |
Gene: Shal_3029: hypothetical protein |
Gene: swp_3580: hypothetical protein |
Gene: Ssed_3285: hypothetical protein |
|
hypothetical protein |
| CRON 122. | |||||||||||||||||
| SO1414 |
*
Shewanella oneidensis MR-1 Site: position = -220 score = 4.26786 sequence = CTTTGTGAGTTACTTCAAATAC Gene: SO1414: flavocytochrome c flavin subunit |
|
|
|
*
Shewanella sp MR-4 Site: position = -263 score = 3.98774 sequence = AATCGGGATTAAGCTCACATCA Gene: Shewmr4_0299: flavocytochrome c flavin subunit |
|
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -216 score = 4.19698 sequence = CTTTGTGAATTACGTCAAACAA Gene: Shew_0276: flavocytochrome c flavin subunit |
*
Shewanella pealeana ATCC 700345 Site: position = -181 score = 4.0752 sequence = CAGATTGATTCCTTTCACATTT Site: position = -78 score = 4.38794 sequence = TGGCGTGACTTAGTTCACCTTT Site: position = -228 score = 4.29704 sequence = CTTTGTGAATTACGTCATATAA Gene: Spea_0325: flavocytochrome c flavin subunit |
*
Shewanella halifaxensis HAW-EB4 Site: position = -269 score = 4.01514 sequence = AATCGGGATTCACTTCACGCTA Site: position = -228 score = 4.15354 sequence = CTTTGTGAGTTACGTCATACAA Site: position = -78 score = 4.38794 sequence = TGGCGTGACTTAGTTCACCTTT Gene: Shal_3966: flavocytochrome c flavin subunit |
|
*
Shewanella sediminis HAW-EB3 Site: position = -280 score = 3.82566 sequence = AATCGGGATTAGCTTCACGCAA Site: position = -239 score = 4.10921 sequence = CTTTGTGAGTTACCTCATGTAA Site: position = -116 score = 3.97362 sequence = CTTCGAGATCTGCTTCACGAAT Gene: Ssed_4184: flavocytochrome c flavin subunit |
|
flavocytochrome c flavin subunit |
| SO1413 |
Gene: SO1413: flavocytochrome c heme subunit |
|
|
|
Gene: Shewmr4_0300: flavocytochrome c heme subunit |
|
|
|
|
|
Gene: Shew_0275: flavocytochrome c heme subunit |
Gene: Spea_0324: flavocytochrome c heme subunit |
Gene: Shal_3967: flavocytochrome c heme subunit |
|
Gene: Ssed_4185: flavocytochrome c heme subunit |
|
flavocytochrome c heme subunit |
| CRON 123. | |||||||||||||||||
| fkpA |
*
Shewanella oneidensis MR-1 Site: position = -119 score = 4.30466 sequence = TAGAGTGAAATTAATCACAGTT Gene: SO1065: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
Gene: Sputcn32_3010: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
Gene: Sputw3181_0939: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
*
Shewanella sp ANA-3 Site: position = -120 score = 4.35871 sequence = TAGAGTGAGATTAATCACAGTT Gene: Shewana3_0903: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
*
Shewanella sp MR-4 Site: position = -120 score = 4.35871 sequence = TAGAGTGAGATTAATCACAGTT Gene: Shewmr4_3034: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
*
Shewanella sp MR-7 Site: position = -120 score = 4.35871 sequence = TAGAGTGAGATTAATCACAGTT Gene: Shewmr7_0940: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
Gene: Sbal_0889: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
Gene: Sden_2909: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
Gene: Sfri_3238: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
Gene: Sama_0642: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
Gene: Shew_0840: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
Gene: Spea_0827: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -99 score = 4.07984 sequence = TAATCTGATTGGAATAACCTAT Gene: Shal_0881: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
Gene: swp_0877: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
*
Shewanella sediminis HAW-EB3 Site: position = -96 score = 3.87892 sequence = CAATGTAATTGGAATAACGTAT Gene: Ssed_0918: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
*
Shewanella woodyi ATCC 51908 Site: position = -95 score = 4.1671 sequence = TAATGTAATTGGAATATCATAT Gene: Swoo_0968: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8) |
| CRON 124. | |||||||||||||||||
| SO3774 |
*
Shewanella oneidensis MR-1 Site: position = -146 score = 4.44742 sequence = TATAGTGTTGTCCGTCACATTT Gene: SO3774: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
*
Shewanella putrefaciens CN-32 Site: position = -128 score = 3.8436 sequence = GATAGTGTTGTCCGTCACATTT Gene: Sputcn32_3099: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
*
Shewanella sp W3-18-1 Site: position = -128 score = 3.8436 sequence = GATAGTGTTGTCCGTCACATTT Gene: Sputw3181_0845: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
*
Shewanella sp ANA-3 Site: position = -131 score = 4.44742 sequence = TATAGTGTTGTCCGTCACATTT Gene: Shewana3_0819: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
*
Shewanella sp MR-4 Site: position = -132 score = 4.44742 sequence = TATAGTGTTGTCCGTCACATTT Gene: Shewmr4_3122: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
*
Shewanella sp MR-7 Site: position = -131 score = 4.44742 sequence = TATAGTGTTGTCCGTCACATTT Gene: Shewmr7_0850: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
*
Shewanella baltica OS155 Site: position = -128 score = 4.44742 sequence = TATAGTGTTGTCCGTCACATTT Gene: Sbal_3458: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
Gene: Sden_0689: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -172 score = 3.78836 sequence = TTCAGTGAACAAAATCAAACAA Site: position = -131 score = 4.07729 sequence = TTGAGTGTCCAAGTTCACATTT Gene: Sfri_0568: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
Gene: Sama_2676: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
*
Shewanella loihica PV-4 Site: position = -146 score = 3.91257 sequence = AAGAGTGTCCCTCGTCACATTT Gene: Shew_0615: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
*
Shewanella pealeana ATCC 700345 Site: position = -127 score = 3.9077 sequence = ATTATTGCCACTCATCACATTT Gene: Spea_3490: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
Gene: Shal_3585: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
*
Shewanella piezotolerans WP3 Site: position = -137 score = 3.90991 sequence = AAAGGTGTCGCTCGTCACATTT Gene: swp_0809: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
*
Shewanella sediminis HAW-EB3 Site: position = -162 score = 3.96166 sequence = AATGGTGTCCCTCGTCACATTT Gene: Ssed_3846: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
*
Shewanella woodyi ATCC 51908 Site: position = -176 score = 3.91257 sequence = AAGAGTGTCCCTCGTCACATTT Gene: Swoo_0714: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12) |
| CRON 125. | |||||||||||||||||
| Sden_0863 |
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella halifaxensis HAW-EB4 Site: position = -36 score = 4.29117 sequence = AAATGGGATGTAAATAACGTAA Gene: Shal_0814: nitroreductase |
|
|
|
Nitroreductase family protein |
| Shal_0815 |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: Shal_0815: Cupin 2 conserved barrel domain protein |
|
|
|
Cupin 2 conserved barrel domain protein |
| SO3797 |
*
Shewanella oneidensis MR-1 Site: position = -53 score = 4.48418 sequence = TTTTGTTATACTCGTCACCTTT Gene: SO3797: probable collagenase (EC 3.4.24.3) |
Gene: Sputcn32_0835: probable collagenase (EC 3.4.24.3) |
Gene: Sputw3181_3338: probable collagenase (EC 3.4.24.3) |
*
Shewanella sp ANA-3 Site: position = -53 score = 4.48418 sequence = TTTTGTTATACTCGTCACCTTT Gene: Shewana3_0800: probable collagenase (EC 3.4.24.3) |
*
Shewanella sp MR-4 Site: position = -53 score = 4.48418 sequence = TTTTGTTATACTCGTCACCTTT Gene: Shewmr4_3138: probable collagenase (EC 3.4.24.3) |
*
Shewanella sp MR-7 Site: position = -53 score = 4.48418 sequence = TTTTGTTATACTCGTCACCTTT Gene: Shewmr7_0828: probable collagenase (EC 3.4.24.3) |
Gene: Sbal_0734: probable collagenase (EC 3.4.24.3) |
Gene: Sden_0726: probable collagenase (EC 3.4.24.3) |
Gene: Sfri_0821: probable collagenase (EC 3.4.24.3) |
Gene: Sama_0677: probable collagenase (EC 3.4.24.3) |
*
Shewanella loihica PV-4 Site: position = -26 score = 3.74513 sequence = ATCTGTGATCTGATTCGAGACT Gene: Shew_0818: probable collagenase (EC 3.4.24.3) |
Gene: Spea_0764: probable collagenase (EC 3.4.24.3) |
Gene: Shal_0816: probable collagenase (EC 3.4.24.3) |
Gene: swp_4276: probable collagenase (EC 3.4.24.3) |
Gene: Ssed_0847: probable collagenase (EC 3.4.24.3) |
Gene: Swoo_0949: probable collagenase (EC 3.4.24.3) |
probable collagenase (EC 3.4.24.3) |
| CRON 126. | |||||||||||||||||
| SO3553 |
*
Shewanella oneidensis MR-1 Site: position = -70 score = 3.91137 sequence = TTTTGCAACTATGATCACACAA Gene: SO3553: putative sulfate permease |
*
Shewanella putrefaciens CN-32 Site: position = -81 score = 3.95475 sequence = ATTTGCAATCATGATCACACAG Gene: Sputcn32_1042: putative sulfate permease |
*
Shewanella sp W3-18-1 Site: position = -81 score = 3.95475 sequence = ATTTGCAATCATGATCACACAG Gene: Sputw3181_3123: putative sulfate permease |
*
Shewanella sp ANA-3 Site: position = -70 score = 3.91137 sequence = TTTTGCAACTATGATCACACAA Gene: Shewana3_3154: putative sulfate permease |
*
Shewanella sp MR-4 Site: position = -70 score = 4.47087 sequence = TTTTGTAACTATGATCACACAA Gene: Shewmr4_2974: putative sulfate permease |
*
Shewanella sp MR-7 Site: position = -70 score = 4.47087 sequence = TTTTGTAACTATGATCACACAA Gene: Shewmr7_3056: putative sulfate permease |
Gene: Sbal_1037: putative sulfate permease |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -116 score = 4.47739 sequence = TAATGTGATGATAATTATATTA Gene: Sfri_3674: putative sulfate permease |
*
Shewanella amazonensis SB2B Site: position = -82 score = 4.12356 sequence = AAATTTGCCAAAGCTCACACAT Gene: Sama_1067: putative sulfate permease |
Gene: Shew_0497: putative sulfate permease |
|
|
|
*
Shewanella sediminis HAW-EB3 Site: position = -233 score = 4.0599 sequence = GTAAGTGCTACGCATCACATTT Gene: Ssed_1334: putative sulfate permease |
*
Shewanella woodyi ATCC 51908 Site: position = -288 score = 3.72381 sequence = TCCAGCGACTTAGATCACATTT Gene: Swoo_3320: putative sulfate permease |
putative sulfate permease |
| CRON 127. | |||||||||||||||||
| miaE |
*
Shewanella oneidensis MR-1 Site: position = -151 score = 4.32866 sequence = CTGTGTGATCAGGATCTCAGTT Site: position = -12 score = 3.68885 sequence = TTGAGTGATCCCATGCAACAAT Gene: SO1788: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
*
Shewanella putrefaciens CN-32 Site: position = -105 score = 4.49346 sequence = TCATGTGATCCCGATCTCAGTT Gene: Sputcn32_1484: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
*
Shewanella sp W3-18-1 Site: position = -105 score = 4.49346 sequence = TCATGTGATCCCGATCTCAGTT Gene: Sputw3181_2617: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
*
Shewanella sp ANA-3 Site: position = -150 score = 4.53312 sequence = CTATGTGATCAGGATCTCAGTT Gene: Shewana3_2667: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
*
Shewanella sp MR-4 Site: position = -151 score = 4.08076 sequence = CGGTGTGATCAGGATCTCAGTT Gene: Shewmr4_2501: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
*
Shewanella sp MR-7 Site: position = -150 score = 4.08076 sequence = CGGTGTGATCAGGATCTCAGTT Gene: Shewmr7_2569: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
*
Shewanella baltica OS155 Site: position = -149 score = 4.32866 sequence = CTGTGTGATCAGGATCTCAGTT Gene: Sbal_1598: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
Gene: Sden_2203: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
3
Shewanella frigidimarina NCIMB 400 Gene: Sfri_2613: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) Gene: Sfri_2611: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) Gene: Sfri_2602: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
Gene: Sama_1218: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
Gene: Shew_2514: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
Gene: Spea_2687: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
|
Gene: swp_3267: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
Gene: Ssed_1535: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
Gene: Swoo_3119: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-) |
| CRON 128. | |||||||||||||||||
| Sputcn32_1245 |
|
*
Shewanella putrefaciens CN-32 Site: position = -263 score = 4.46906 sequence = ATTTGTGACACAGATCGAATTG Site: position = -234 score = 3.8165 sequence = ATTTGTAAGTGATTTCCCACTA Gene: Sputcn32_1245: transcriptional regulator, MarR family |
*
Shewanella sp W3-18-1 Site: position = -263 score = 4.54274 sequence = ATTTGTGACGCAGATCGAATTG Site: position = -234 score = 3.8165 sequence = ATTTGTAAGTGATTTCCCACTA Gene: Sputw3181_2859: transcriptional regulator, MarR family |
*
Shewanella sp ANA-3 Site: position = -234 score = 4.32449 sequence = AGATGTGATCTAGATCGGCTTA Gene: Shewana3_2937: transcriptional regulator, MarR family |
*
Shewanella sp MR-4 Site: position = -234 score = 4.32449 sequence = AGATGTGATCTAGATCGGCTTA Gene: Shewmr4_2761: transcriptional regulator, MarR family |
*
Shewanella sp MR-7 Site: position = -255 score = 4.32449 sequence = AGATGTGATCTAGATCGGCTTA Gene: Shewmr7_2839: transcriptional regulator, MarR family |
Gene: Sbal_1328: transcriptional regulator, MarR family |
Gene: Sden_0718: transcriptional regulator, MarR family |
Gene: Sfri_1943: transcriptional regulator, MarR family |
|
Gene: Shew_2736: transcriptional regulator, MarR family |
Gene: Spea_1004: transcriptional regulator, MarR family |
Gene: Shal_1054: transcriptional regulator, MarR family |
Gene: swp_3815: transcriptional regulator, MarR family |
Gene: Ssed_1772: transcriptional regulator, MarR family |
Gene: Swoo_1193: transcriptional regulator, MarR family |
transcriptional regulator, MarR family |
| CRON 129. | |||||||||||||||||
| nrfA |
*
Shewanella oneidensis MR-1 Site: position = -149 score = 3.88004 sequence = AAGTGTGAACAACAACACTATT Site: position = -126 score = 4.11267 sequence = CATTTTGATCTAGCGCAAACTT Gene: SO3980: cytochrome c552 precursor (EC 1.7.2.2) |
*
Shewanella putrefaciens CN-32 Site: position = -149 score = 3.88004 sequence = AAGTGTGAACAACAACACTATT Site: position = -126 score = 4.07436 sequence = CATTTTGATCTGGCGCAAACTT Gene: Sputcn32_0685: cytochrome c552 precursor (EC 1.7.2.2) |
*
Shewanella sp W3-18-1 Site: position = -149 score = 3.88004 sequence = AAGTGTGAACAACAACACTATT Site: position = -126 score = 4.07436 sequence = CATTTTGATCTGGCGCAAACTT Gene: Sputw3181_3486: cytochrome c552 precursor (EC 1.7.2.2) |
*
Shewanella sp ANA-3 Site: position = -131 score = 3.88004 sequence = AAGTGTGAACAACAACACTATT Site: position = -108 score = 4.11267 sequence = CATTTTGATCTAGCGCAAACTT Gene: Shewana3_0658: cytochrome c552 precursor (EC 1.7.2.2) |
*
Shewanella sp MR-4 Site: position = -131 score = 3.88004 sequence = AAGTGTGAACAACAACACTATT Site: position = -108 score = 4.11267 sequence = CATTTTGATCTAGCGCAAACTT Gene: Shewmr4_0659: cytochrome c552 precursor (EC 1.7.2.2) |
*
Shewanella sp MR-7 Site: position = -131 score = 3.88004 sequence = AAGTGTGAACAACAACACTATT Site: position = -108 score = 4.11267 sequence = CATTTTGATCTAGCGCAAACTT Gene: Shewmr7_3363: cytochrome c552 precursor (EC 1.7.2.2) |
*
Shewanella baltica OS155 Site: position = -149 score = 4.36217 sequence = AAATGTGAACAACAACACCTTT Site: position = -126 score = 4.11267 sequence = CATTTTGATCTAGCGCAAACTT Gene: Sbal_0794: cytochrome c552 precursor (EC 1.7.2.2) |
|
Gene: Sfri_0622: cytochrome c552 precursor (EC 1.7.2.2) |
Gene: Sama_0648: cytochrome c552 precursor (EC 1.7.2.2) |
*
Shewanella loihica PV-4 Site: position = -156 score = 4.49852 sequence = AAATGTGACCAACAACACATTC Site: position = -133 score = 4.15982 sequence = CATTATGATCTGCCTCAAGTTT Gene: Shew_0844: cytochrome c552 precursor (EC 1.7.2.2) |
*
Shewanella pealeana ATCC 700345 Site: position = -183 score = 4.02828 sequence = ATACTTGATTACATTAACAAAT Site: position = -155 score = 3.8407 sequence = AAGTGTGAGCAACAACACGTTC Site: position = -71 score = 4.07469 sequence = ATAAGTGATTAAATTCAACCTT Gene: Spea_0831: cytochrome c552 precursor (EC 1.7.2.2) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -152 score = 4.19814 sequence = AAGTGTGAGCAACAACACATTC Gene: Shal_0886: cytochrome c552 precursor (EC 1.7.2.2) |
*
Shewanella piezotolerans WP3 Site: position = -150 score = 4.04516 sequence = AAATGTGAGCAACAACACGTTC Gene: swp_3958: cytochrome c552 precursor (EC 1.7.2.2) |
*
Shewanella sediminis HAW-EB3 Site: position = -154 score = 4.56921 sequence = AAGTGTGAGCAACACCACATTT Site: position = -131 score = 3.93055 sequence = CATTTTGATCTACCGCATACTT Gene: Ssed_0931: cytochrome c552 precursor (EC 1.7.2.2) |
*
Shewanella woodyi ATCC 51908 Site: position = -154 score = 4.41622 sequence = AAATGTGAGCAACAACACGTTT Gene: Swoo_0972: cytochrome c552 precursor (EC 1.7.2.2) |
cytochrome c552 precursor (EC 1.7.2.2) |
| CRON 130. | |||||||||||||||||
| Sputcn32_1245 |
|
*
Shewanella putrefaciens CN-32 Site: position = -234 score = 3.8165 sequence = ATTTGTAAGTGATTTCCCACTA Site: position = -263 score = 4.46906 sequence = ATTTGTGACACAGATCGAATTG Gene: Sputcn32_1245: transcriptional regulator, MarR family |
*
Shewanella sp W3-18-1 Site: position = -234 score = 3.8165 sequence = ATTTGTAAGTGATTTCCCACTA Site: position = -263 score = 4.54274 sequence = ATTTGTGACGCAGATCGAATTG Gene: Sputw3181_2859: transcriptional regulator, MarR family |
*
Shewanella sp ANA-3 Site: position = -234 score = 4.32449 sequence = AGATGTGATCTAGATCGGCTTA Gene: Shewana3_2937: transcriptional regulator, MarR family |
*
Shewanella sp MR-4 Site: position = -234 score = 4.32449 sequence = AGATGTGATCTAGATCGGCTTA Gene: Shewmr4_2761: transcriptional regulator, MarR family |
*
Shewanella sp MR-7 Site: position = -255 score = 4.32449 sequence = AGATGTGATCTAGATCGGCTTA Gene: Shewmr7_2839: transcriptional regulator, MarR family |
Gene: Sbal_1328: transcriptional regulator, MarR family |
Gene: Sden_0718: transcriptional regulator, MarR family |
Gene: Sfri_1943: transcriptional regulator, MarR family |
|
Gene: Shew_2736: transcriptional regulator, MarR family |
Gene: Spea_1004: transcriptional regulator, MarR family |
Gene: Shal_1054: transcriptional regulator, MarR family |
Gene: swp_3815: transcriptional regulator, MarR family |
Gene: Ssed_1772: transcriptional regulator, MarR family |
Gene: Swoo_1193: transcriptional regulator, MarR family |
transcriptional regulator, MarR family |
| CRON 131. | |||||||||||||||||
| SO4743 |
*
Shewanella oneidensis MR-1 Site: position = -164 score = 4.86858 sequence = AATTTTGATCTGTATCACGCAA Gene: SO4743: ferrichrome-iron receptor |
*
Shewanella putrefaciens CN-32 Site: position = -116 score = 4.71548 sequence = TAATTTGATCGGTATCACACTC Gene: Sputcn32_3953: ferrichrome-iron receptor |
*
Shewanella sp W3-18-1 Site: position = -116 score = 4.71548 sequence = TAATTTGATCGGTATCACACTC Gene: Sputw3181_4050: ferrichrome-iron receptor |
Gene: Shewana3_4127: ferrichrome-iron receptor |
*
Shewanella sp MR-4 Site: position = -116 score = 4.3011 sequence = AAACTTGATCTAAGTCACGCTA Gene: Shewmr4_3922: ferrichrome-iron receptor |
*
Shewanella sp MR-7 Site: position = -116 score = 4.3011 sequence = AAACTTGATCTAAGTCACGCTA Gene: Shewmr7_4014: ferrichrome-iron receptor |
Gene: Sbal_4363: ferrichrome-iron receptor |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -116 score = 4.6644 sequence = ATTTTTGATATATATCACAGTC Gene: Sfri_4042: ferrichrome-iron receptor |
Gene: Sama_3641: ferrichrome-iron receptor |
Gene: Shew_3841: ferrichrome-iron receptor |
Gene: Spea_4236: ferrichrome-iron receptor |
*
Shewanella halifaxensis HAW-EB4 Site: position = -46 score = 3.77445 sequence = TATTGCGACTCAATTAATACAT Gene: Shal_4287: ferrichrome-iron receptor |
*
Shewanella piezotolerans WP3 Site: position = -117 score = 4.29804 sequence = TGTTGTGCGCGAGTTCACATTG Gene: swp_5150: ferrichrome-iron receptor |
Gene: Ssed_4483: ferrichrome-iron receptor |
Gene: Swoo_4894: ferrichrome-iron receptor |
ferrichrome-iron receptor |
| deoR |
Gene: SO4742: transcriptional regulator of glmS gene, DeoR family |
Gene: Sputcn32_3952: transcriptional regulator of glmS gene, DeoR family |
Gene: Sputw3181_4049: transcriptional regulator of glmS gene, DeoR family |
Gene: Shewana3_4126: transcriptional regulator of glmS gene, DeoR family |
Gene: Shewmr4_3921: transcriptional regulator of glmS gene, DeoR family |
Gene: Shewmr7_4013: transcriptional regulator of glmS gene, DeoR family |
Gene: Sbal_4362: transcriptional regulator of glmS gene, DeoR family |
Gene: Sden_3744: transcriptional regulator of glmS gene, DeoR family |
Gene: Sfri_4041: transcriptional regulator of glmS gene, DeoR family |
Gene: Sama_3640: transcriptional regulator of glmS gene, DeoR family |
Gene: Shew_3840: transcriptional regulator of glmS gene, DeoR family |
Gene: Spea_4235: transcriptional regulator of glmS gene, DeoR family |
Gene: Shal_4286: transcriptional regulator of glmS gene, DeoR family |
Gene: swp_5149: transcriptional regulator of glmS gene, DeoR family |
Gene: Ssed_4482: transcriptional regulator of glmS gene, DeoR family |
*
Shewanella woodyi ATCC 51908 Site: position = -91 score = 3.80436 sequence = CTTTTTGATCTTTATCTAGTTT Gene: Swoo_4893: transcriptional regulator of glmS gene, DeoR family |
transcriptional regulator of glmS gene, DeoR family |
| glmS |
Gene: SO4741: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Sputcn32_3951: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Sputw3181_4048: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Shewana3_4125: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Shewmr4_3920: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Shewmr7_4012: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Sbal_4361: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Sden_3743: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Sfri_4040: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Sama_3639: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Shew_3839: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Spea_4234: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Shal_4285: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: swp_5148: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Ssed_4481: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
Gene: Swoo_4892: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16) |
| CRON 132. | |||||||||||||||||
| swp_3409 |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -177 score = 4.05538 sequence = TGATGTGATAAAAAGCACTCAT Gene: swp_3409: hypothetical protein swp_3409 |
|
|
hypothetical protein swp_3409 |
| yfiA-1 |
*
Shewanella oneidensis MR-1 Site: position = -142 score = 4.65684 sequence = TTCTTTGATAGGTCTCACATTT Gene: SO3403: ribosomal subunit interface protein |
*
Shewanella putrefaciens CN-32 Site: position = -145 score = 4.88106 sequence = TTCTTTGATGTAACTCACATTT Gene: Sputcn32_2725: ribosomal subunit interface protein |
*
Shewanella sp W3-18-1 Site: position = -145 score = 4.88106 sequence = TTCTTTGATGTAACTCACATTT Gene: Sputw3181_1287: ribosomal subunit interface protein |
*
Shewanella sp ANA-3 Site: position = -142 score = 4.56864 sequence = TTCTTTGATAAGTCTCACATTT Gene: Shewana3_1151: ribosomal subunit interface protein |
*
Shewanella sp MR-4 Site: position = -142 score = 4.60695 sequence = TTCTTTGATAAATCTCACATTT Gene: Shewmr4_1150: ribosomal subunit interface protein |
*
Shewanella sp MR-7 Site: position = -142 score = 5.00289 sequence = TTTTTTGATAAATCTCACATTT Gene: Shewmr7_1221: ribosomal subunit interface protein |
*
Shewanella baltica OS155 Site: position = -222 score = 4.24049 sequence = TTTTGTGATTGATTTATTATTA Site: position = -144 score = 4.29023 sequence = CTTCTTGATGGCGGTCACATTT Gene: Sbal_1239: ribosomal subunit interface protein |
Gene: Sden_1226: ribosomal subunit interface protein |
Gene: Sfri_1084: ribosomal subunit interface protein |
|
Gene: Shew_1241: ribosomal subunit interface protein |
Gene: Spea_1224: ribosomal subunit interface protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -319 score = 3.94617 sequence = AAGAGTGATAAAAATCAAGCTA Site: position = -230 score = 3.78315 sequence = TATCCTGATGAATGCCACAATT Gene: Shal_1258: ribosomal subunit interface protein |
Gene: swp_3408: ribosomal subunit interface protein |
Gene: Ssed_1346: ribosomal subunit interface protein |
Gene: Swoo_3306: ribosomal subunit interface protein |
ribosomal subunit interface protein |
| CRON 133. | |||||||||||||||||
| SO4138 |
*
Shewanella oneidensis MR-1 Site: position = -96 score = 4.16463 sequence = CATTGTGAAGCGTATCATGTAA Gene: SO4138: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -97 score = 4.16463 sequence = CATTGTGAAGCGTATCATGTAA Gene: Sputcn32_0540: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -97 score = 4.16463 sequence = CATTGTGAAGCGTATCATGTAA Gene: Sputw3181_3632: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -96 score = 4.16463 sequence = CATTGTGAAGCGTATCATGTAA Gene: Shewana3_3683: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -96 score = 4.16463 sequence = CATTGTGAAGCGTATCATGTAA Gene: Shewmr4_3508: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -96 score = 4.16463 sequence = CATTGTGAAGCGTATCATGTAA Gene: Shewmr7_0444: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -97 score = 4.25964 sequence = ATGTGTGAAGCGTATCATGTAA Gene: Sbal_3855: hypothetical protein |
|
|
|
*
Shewanella loihica PV-4 Site: position = -109 score = 3.92727 sequence = TAGCGTGAAGCATATCAAGCAA Gene: Shew_3393: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -96 score = 3.83837 sequence = TAGCGTGAAGAGGATCAAGCTT Gene: Spea_0458: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -96 score = 3.82908 sequence = TAGCGTGAAGGGGATCATGCTT Gene: Shal_0533: hypothetical protein |
Gene: swp_4704: hypothetical protein |
Gene: Ssed_0458: hypothetical protein |
Gene: Swoo_4511: hypothetical protein |
hypothetical protein |
| CRON 134. | |||||||||||||||||
| SO3682 |
*
Shewanella oneidensis MR-1 Site: position = -109 score = 3.80332 sequence = TTGCGTGATTTTGTGCAAGCAT Gene: SO3682: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -76 score = 3.79075 sequence = ATTTTTGAGCAAGATCACGGCT Gene: Sputcn32_2981: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -76 score = 3.79075 sequence = ATTTTTGAGCAAGATCACGGCT Gene: Sputw3181_0966: hypothetical protein |
Gene: Shewana3_3250: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -166 score = 3.67918 sequence = TGACGTGATTTGTGGCGTATAA Gene: Shewmr4_0873: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -166 score = 3.67918 sequence = TGACGTGATTTGTGGCGTATAA Gene: Shewmr7_3149: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -76 score = 3.71864 sequence = ATTTTTGAGCAATATCACGGCT Gene: Sbal_3331: hypothetical protein |
|
Gene: Sfri_0576: hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -78 score = 3.99571 sequence = AAACTTGATCTGGATCACGAGT Gene: Sama_2854: hypothetical protein |
*
Shewanella loihica PV-4 Site: position = -84 score = 4.15852 sequence = AAATGTGATCTGGATCAAGTGG Gene: Shew_3102: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -102 score = 4.73342 sequence = AATTGTGAGCTAGATCAAACTC Gene: Spea_3356: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -90 score = 4.77177 sequence = AATTGTGACTGAGATCAAATTC Gene: Shal_3428: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -79 score = 4.29062 sequence = TTTTGTGAGCAAGATCAACTTC Gene: swp_1054: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -111 score = 4.2011 sequence = CAGTGTGATCTCGATCAACTTC Gene: Ssed_3715: hypothetical protein |
|
hypothetical protein |
| SO3681 |
Gene: SO3681: universal stress protein family |
Gene: Sputcn32_2980: universal stress protein family |
Gene: Sputw3181_0967: universal stress protein family |
Gene: Shewana3_3249: universal stress protein family |
Gene: Shewmr4_0874: universal stress protein family |
Gene: Shewmr7_3148: universal stress protein family |
Gene: Sbal_3330: universal stress protein family |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -133 score = 4.06129 sequence = TGATTTGATTTTGATCACTAAG Gene: Sfri_0938: universal stress protein family |
Gene: Sama_2853: universal stress protein family |
Gene: Shew_3101: universal stress protein family |
Gene: Spea_3355: universal stress protein family |
Gene: Shal_3427: universal stress protein family |
Gene: swp_1055: universal stress protein family |
Gene: Ssed_3714: universal stress protein family |
*
Shewanella woodyi ATCC 51908 Site: position = -140 score = 4.69834 sequence = ATGTGTGATCAAGATCAACATT Gene: Swoo_4060: universal stress protein family |
universal stress protein family |
| Shewana3_3248 |
Gene: SO3680: UspA domain-containing protein |
|
|
Gene: Shewana3_3248: UspA domain-containing protein |
Gene: Shewmr4_0875: UspA domain-containing protein |
Gene: Shewmr7_3147: UspA domain-containing protein |
Gene: Sbal_3329: UspA domain-containing protein |
|
|
|
Gene: Shew_3100: UspA domain-containing protein |
Gene: Spea_3354: UspA domain-containing protein |
Gene: Shal_3426: UspA domain-containing protein |
|
Gene: Ssed_3713: UspA domain-containing protein |
Gene: Swoo_4059: UspA domain-containing protein |
UspA domain-containing protein |
| CRON 135. | |||||||||||||||||
| SO0318 |
Gene: SO0318: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -246 score = 3.83175 sequence = AAAAGTGATAATGTTCTTAGAT Site: position = -173 score = 3.91797 sequence = TATCGTGATTAGCTTGACGTAA Gene: Sputcn32_3677: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -245 score = 3.83175 sequence = AAAAGTGATAATGTTCTTAGAT Site: position = -173 score = 3.91797 sequence = TATCGTGATTAGCTTGACGTAA Gene: Sputw3181_3818: hypothetical protein |
Gene: Shewana3_3867: hypothetical protein |
Gene: Shewmr4_3655: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -267 score = 4.37319 sequence = ATGTGTGAATAGGGTCAAATAT Gene: Shewmr7_0289: hypothetical protein |
Gene: Sbal_4080: hypothetical protein |
|
|
*
Shewanella amazonensis SB2B Site: position = -282 score = 4.40256 sequence = TAATTTGAAGTGAATCATAAAA Gene: Sama_3332: hypothetical protein |
Gene: Shew_0234: hypothetical protein |
Gene: Spea_0280: hypothetical protein |
Gene: Shal_4025: hypothetical protein |
Gene: swp_2131: hypothetical protein |
Gene: Ssed_4217: hypothetical protein |
Gene: Swoo_0383: hypothetical protein |
hypothetical protein |
| SO0319 |
Gene: SO0319: conserved domain protein |
*
Shewanella putrefaciens CN-32 Site: position = -130 score = 3.9893 sequence = AAATATGATTTTATTAGCAGTT Gene: Sputcn32_3676: conserved domain protein |
*
Shewanella sp W3-18-1 Site: position = -130 score = 3.9893 sequence = AAATATGATTTTATTAGCAGTT Gene: Sputw3181_3817: conserved domain protein |
*
Shewanella sp ANA-3 Site: position = -84 score = 4.5619 sequence = TTTTGTGAAACGTTTCACTATT Gene: Shewana3_3866: conserved domain protein |
*
Shewanella sp MR-4 Site: position = -66 score = 4.5619 sequence = TTTTGTGAAACGTTTCACTATT Gene: Shewmr4_3654: conserved domain protein |
*
Shewanella sp MR-7 Site: position = -66 score = 4.5619 sequence = TTTTGTGAAACGTTTCACTATT Gene: Shewmr7_0290: conserved domain protein |
Gene: Sbal_4079: conserved domain protein |
|
|
|
|
|
|
|
|
|
conserved domain protein |
| SO0320 |
Gene: SO0320: conserved domain protein |
Gene: Sputcn32_3675: conserved domain protein |
Gene: Sputw3181_3816: conserved domain protein |
Gene: Shewana3_3865: conserved domain protein |
Gene: Shewmr4_3653: conserved domain protein |
Gene: Shewmr7_0291: conserved domain protein |
Gene: Sbal_4078: conserved domain protein |
Gene: Sden_2797: conserved domain protein |
|
Gene: Sama_3331: conserved domain protein |
|
Gene: Spea_1158: conserved domain protein |
Gene: Shal_1201: conserved domain protein |
Gene: swp_1332: conserved domain protein |
|
|
conserved domain protein |
| SO0321 |
Gene: SO0321: hypothetical protein |
Gene: Sputcn32_3674: hypothetical protein |
Gene: Sputw3181_3815: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -25 score = 3.7966 sequence = TAGCGTGTTTTTCATCGAATTT Gene: Shewana3_3864: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -25 score = 3.7966 sequence = TAGCGTGTTTTTCATCGAATTT Gene: Shewmr4_3652: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -25 score = 3.7966 sequence = TAGCGTGTTTTTCATCGAATTT Gene: Shewmr7_0292: hypothetical protein |
Gene: Sbal_4077: hypothetical protein |
Gene: Sden_0278: hypothetical protein |
Gene: Sfri_0397: hypothetical protein |
Gene: Sama_3330: hypothetical protein |
Gene: Shew_0246: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -146 score = 4.68256 sequence = ATACGTGATATTTTTCACTTTA Gene: Spea_0282: hypothetical protein |
Gene: Shal_4007: hypothetical protein |
Gene: swp_2150: hypothetical protein |
Gene: Ssed_4207: hypothetical protein |
Gene: Swoo_0386: hypothetical protein |
hypothetical protein |
| CRON 136. | |||||||||||||||||
| SO2111 |
*
Shewanella oneidensis MR-1 Site: position = -79 score = 4.81676 sequence = ACACGTGATCTTGATCACACTT Gene: SO2111: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -66 score = 4.46057 sequence = ACACGAGATCTAGATCACATTT Gene: Sputcn32_1894: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -66 score = 4.46057 sequence = ACACGAGATCTAGATCACATTT Gene: Sputw3181_2114: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -79 score = 3.88374 sequence = ACCCGCGATCTTGATCACACTT Gene: Shewana3_1891: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -100 score = 3.90947 sequence = GTCTTTGATCTGAATCAAAAAA Site: position = -79 score = 4.25726 sequence = ACACGCGATCTTGATCACACTT Gene: Shewmr4_1833: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -100 score = 3.90947 sequence = GTCTTTGATCTGAATCAAAAAA Site: position = -79 score = 4.25726 sequence = ACACGCGATCTTGATCACACTT Gene: Shewmr7_2144: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -78 score = 4.03109 sequence = ACACGCGATCTAGATCACACTG Gene: Sbal_1900: hypothetical protein |
|
|
|
|
|
|
|
|
|
hypothetical protein |
| CRON 137. | |||||||||||||||||
| nadC |
|
*
Shewanella putrefaciens CN-32 Site: position = -262 score = 4.47721 sequence = AAGCGTGATTAGTGTCACAGTT Site: position = -154 score = 4.10131 sequence = TTTGGTGATTTTTGTCGCGTAA Site: position = -125 score = 3.94762 sequence = TTTTGCGATTTTTATCGACAAA Site: position = -92 score = 3.77349 sequence = TGATGTGATAAAGCTACAAAAT Site: position = -57 score = 4.37894 sequence = ATGTGTGATCTATGCCATAAAT Gene: Sputcn32_3393: di-and tricarboxylate transporter |
*
Shewanella sp W3-18-1 Site: position = -154 score = 4.10131 sequence = TTTGGTGATTTTTGTCGCGTAA Site: position = -262 score = 4.80359 sequence = AAGTGTGATTAGTGTCACAGTT Site: position = -125 score = 3.94762 sequence = TTTTGCGATTTTTATCGACAAA Site: position = -92 score = 3.77349 sequence = TGATGTGATAAAGCTACAAAAT Site: position = -57 score = 3.7817 sequence = GTGTGTGATCTATGCCATAAAT Gene: Sputw3181_0550: di-and tricarboxylate transporter |
*
Shewanella sp ANA-3 Site: position = -262 score = 4.41782 sequence = AAGTTTGACATGGGTCACAGTT Gene: Shewana3_0451: di-and tricarboxylate transporter |
Gene: Shewmr4_0455: di-and tricarboxylate transporter |
Gene: Shewmr7_3574: di-and tricarboxylate transporter |
*
Shewanella baltica OS155 Site: position = -57 score = 3.80342 sequence = AAGTGTGATCTATGCCCTAAAT Gene: Sbal_0427: di-and tricarboxylate transporter |
|
|
|
Gene: Shew_2490: di-and tricarboxylate transporter |
*
Shewanella pealeana ATCC 700345 Site: position = -262 score = 4.26102 sequence = TAAAGTGATCGCGATCACACCG Site: position = -152 score = 4.37866 sequence = AATAGTGACAAACATCACATCA Gene: Spea_2663: di-and tricarboxylate transporter |
*
Shewanella halifaxensis HAW-EB4 Site: position = -250 score = 4.50154 sequence = TAAAGAGATCGAGATCACACTA Site: position = -140 score = 3.81415 sequence = TTAAGAGATGTTTATCGCAATC Gene: Shal_2750: di-and tricarboxylate transporter |
*
Shewanella piezotolerans WP3 Site: position = -123 score = 3.82538 sequence = TTATGCGCCCTTCATCACCCTA Gene: swp_3241: di-and tricarboxylate transporter |
*
Shewanella sediminis HAW-EB3 Site: position = -127 score = 3.93424 sequence = AAAATAGATCTACTTCACCTAT Gene: Ssed_1560: di-and tricarboxylate transporter |
Gene: Swoo_3094: di-and tricarboxylate transporter |
di-and tricarboxylate transporter |
| CRON 138. | |||||||||||||||||
| gloA |
Gene: SO2044: lactoylglutathione lyase (EC 4.4.1.5) |
*
Shewanella putrefaciens CN-32 Site: position = -4 score = 3.78836 sequence = ATTAATGATCTCGTTAACGCAA Site: position = -120 score = 3.77937 sequence = TTTTGTGAGCAACAACCAATTT Gene: Sputcn32_2101: lactoylglutathione lyase (EC 4.4.1.5) |
*
Shewanella sp W3-18-1 Site: position = -4 score = 3.78836 sequence = ATTAATGATCTCGTTAACGCAA Site: position = -120 score = 3.77937 sequence = TTTTGTGAGCAACAACCAATTT Gene: Sputw3181_1911: lactoylglutathione lyase (EC 4.4.1.5) |
*
Shewanella sp ANA-3 Site: position = -153 score = 4.35963 sequence = CAAAGTGACGTAGCTCACAAAG Site: position = -205 score = 4.03109 sequence = TTTTGTGAGCAAGAGCTAAATA Gene: Shewana3_2232: lactoylglutathione lyase (EC 4.4.1.5) |
*
Shewanella sp MR-4 Site: position = -153 score = 4.84557 sequence = CAAAGTGATACAGCTCACATTA Site: position = -205 score = 4.03109 sequence = TTTTGTGAGCAAGAGCTAAATA Gene: Shewmr4_2107: lactoylglutathione lyase (EC 4.4.1.5) |
*
Shewanella sp MR-7 Site: position = -153 score = 4.84557 sequence = CAAAGTGATACAGCTCACATTA Site: position = -205 score = 4.03109 sequence = TTTTGTGAGCAAGAGCTAAATA Gene: Shewmr7_1867: lactoylglutathione lyase (EC 4.4.1.5) |
*2
Shewanella baltica OS155 Site: position = -196 score = 3.9678 sequence = TTTTGTGAGCGACAGCCAATTT Gene: Sbal_4555: lactoylglutathione lyase (EC 4.4.1.5) Site: position = -196 score = 3.9678 sequence = TTTTGTGAGCGACAGCCAATTT Gene: Sbal_2269: lactoylglutathione lyase (EC 4.4.1.5) |
Gene: Sden_1873: lactoylglutathione lyase (EC 4.4.1.5) |
*2
Shewanella frigidimarina NCIMB 400 Site: position = -101 score = 4.60093 sequence = AAATGTGAACTAAAGCAAAATT Gene: Sfri_2179: lactoylglutathione lyase (EC 4.4.1.5) Site: position = -213 score = 3.84974 sequence = AAACGTTAAATCCATTACATTA Site: position = -41 score = 3.72545 sequence = TTTAATGATGCGATTCAGAGAT Gene: Sfri_2098: lactoylglutathione lyase (EC 4.4.1.5) |
*
Shewanella amazonensis SB2B Site: position = -96 score = 4.34964 sequence = AACTGTGAGTTGCTTCAGATTT Gene: Sama_1837: lactoylglutathione lyase (EC 4.4.1.5) |
Gene: Shew_2073: lactoylglutathione lyase (EC 4.4.1.5) |
Gene: Spea_2360: lactoylglutathione lyase (EC 4.4.1.5) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -95 score = 3.97317 sequence = TAAATTGATCTCGCTCAATTTT Gene: Shal_1924: lactoylglutathione lyase (EC 4.4.1.5) |
2
Shewanella piezotolerans WP3 Gene: swp_1083: lactoylglutathione lyase (EC 4.4.1.5) Gene: swp_2363: lactoylglutathione lyase (EC 4.4.1.5) |
*2
Shewanella sediminis HAW-EB3 Site: position = -312 score = 3.78871 sequence = TTTTGTAATTTTTTAAACAGTA Gene: Ssed_2709: lactoylglutathione lyase (EC 4.4.1.5) Gene: Ssed_2037: lactoylglutathione lyase (EC 4.4.1.5) |
*
Shewanella woodyi ATCC 51908 Site: position = -243 score = 3.80008 sequence = TTTTATGACTCTATTAATATAA Gene: Swoo_2563: lactoylglutathione lyase (EC 4.4.1.5) |
lactoylglutathione lyase (EC 4.4.1.5) |
| CRON 139. | |||||||||||||||||
| prmA |
Gene: SO0395: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
Gene: Sputcn32_3442: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
Gene: Sputw3181_0497: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
Gene: Shewana3_0400: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
Gene: Shewmr4_0401: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
Gene: Shewmr7_3624: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
Gene: Sbal_3938: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
Gene: Sden_0446: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
Gene: Sfri_0455: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
Gene: Sama_3224: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
*
Shewanella loihica PV-4 Site: position = -274 score = 3.82674 sequence = AAGCGTGAGACACCTCACCCTG Site: position = -242 score = 4.1446 sequence = ACATTTGACGTCGATCACAAAC Gene: Shew_0331: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
*
Shewanella pealeana ATCC 700345 Site: position = -251 score = 4.13131 sequence = CTATTAGATCAAGATCACAAAT Site: position = -283 score = 4.27846 sequence = TTTCGTGAAGGAACTCACCCTT Gene: Spea_0391: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -249 score = 3.71459 sequence = CTATTAGACGTAGATCACAAAC Site: position = -281 score = 3.93409 sequence = TTTCGTGATCAGTGTCACTACA Gene: Shal_3900: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
*
Shewanella piezotolerans WP3 Site: position = -286 score = 4.52099 sequence = AATCGTGACTTTGCTCACCCTA Gene: swp_0427: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
*
Shewanella sediminis HAW-EB3 Site: position = -53 score = 4.96993 sequence = TAATGTGATTGGTATTACAATA Gene: Ssed_4117: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
*
Shewanella woodyi ATCC 51908 Site: position = -233 score = 4.48598 sequence = TTTTTTGAACCACATCACAAAC Gene: Swoo_0506: ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
ribosomal protein L11 methyltransferase (EC 2.1.1.-) |
| nifR3 |
Gene: SO0394: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Sputcn32_3443: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Sputw3181_0496: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Shewana3_0399: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Shewmr4_0400: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Shewmr7_3625: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Sbal_3939: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Sden_0445: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Sfri_0454: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Sama_3225: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Shew_0330: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Spea_0390: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Shal_3901: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: swp_0426: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Ssed_4118: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
Gene: Swoo_0505: tRNA dihydrouridine synthase B (EC 1.-.-.-) |
tRNA dihydrouridine synthase B (EC 1.-.-.-) |
| fis |
Gene: SO0393: DNA-binding protein Fis |
Gene: Sputcn32_3444: DNA-binding protein Fis |
Gene: Sputw3181_0495: DNA-binding protein Fis |
Gene: Shewana3_0398: DNA-binding protein Fis |
Gene: Shewmr4_0399: DNA-binding protein Fis |
Gene: Shewmr7_3626: DNA-binding protein Fis |
Gene: Sbal_3940: DNA-binding protein Fis |
Gene: Sden_0444: DNA-binding protein Fis |
Gene: Sfri_0453: DNA-binding protein Fis |
Gene: Sama_3226: DNA-binding protein Fis |
Gene: Shew_0329: DNA-binding protein Fis |
Gene: Spea_0389: DNA-binding protein Fis |
Gene: Shal_3902: DNA-binding protein Fis |
Gene: swp_0425: DNA-binding protein Fis |
Gene: Ssed_4119: DNA-binding protein Fis |
Gene: Swoo_0504: DNA-binding protein Fis |
DNA-binding protein Fis |
| CRON 140. | |||||||||||||||||
| apbE |
*
Shewanella oneidensis MR-1 Site: position = -91 score = 3.84627 sequence = ATCTATGAGTTAGCTAACACTT Gene: SO1418: thiamin biosynthesis lipoprotein ApbE |
|
|
|
|
|
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -99 score = 4.86379 sequence = TATTTTGATCTGCTTAACAAAA Gene: Shew_1971: thiamin biosynthesis lipoprotein ApbE |
*
Shewanella pealeana ATCC 700345 Site: position = -32 score = 4.35123 sequence = TTATTTGACACAGTTAACACTA Gene: Spea_2090: thiamin biosynthesis lipoprotein ApbE |
*
Shewanella halifaxensis HAW-EB4 Site: position = -95 score = 4.42491 sequence = TTATTTGACGCAGTTAACACAA Gene: Shal_2063: thiamin biosynthesis lipoprotein ApbE |
*
Shewanella piezotolerans WP3 Site: position = -105 score = 4.36506 sequence = TTGTTTGACAGAGATAACATTT Gene: swp_2515: thiamin biosynthesis lipoprotein ApbE |
*
Shewanella sediminis HAW-EB3 Site: position = -209 score = 4.47613 sequence = ATATTTGACCCAGTTAACACAT Gene: Ssed_2280: thiamin biosynthesis lipoprotein ApbE |
|
thiamin biosynthesis lipoprotein ApbE |
| CRON 141. | |||||||||||||||||
| SO4154 |
*
Shewanella oneidensis MR-1 Site: position = -69 score = 3.70122 sequence = AATTGTGCATTAGTTAATCTAT Site: position = -9 score = 4.85782 sequence = TAATTTGATATGTATCATATAA Gene: SO4154: transcriptional regulator, LysR family |
|
|
*
Shewanella sp ANA-3 Site: position = -9 score = 4.32738 sequence = TAATTTGATATGTACCATATAA Gene: Shewana3_3695: transcriptional regulator, LysR family |
|
|
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -30 score = 3.85231 sequence = TATTGAAATCATTTTCAAAAAA Site: position = -9 score = 3.99752 sequence = ATTTTTGATATGTATCATCTCA Gene: Shew_0506: transcriptional regulator, LysR family |
|
|
*
Shewanella piezotolerans WP3 Site: position = -9 score = 4.36109 sequence = ATATTTGATATGTACCACCTTA Gene: swp_4588: transcriptional regulator, LysR family |
*
Shewanella sediminis HAW-EB3 Site: position = -9 score = 4.42201 sequence = ATATTTGATATGTATCACCTCA Gene: Ssed_4064: transcriptional regulator, LysR family |
*
Shewanella woodyi ATCC 51908 Site: position = -9 score = 4.18779 sequence = ATTTTTGACATGTATCACCTCA Gene: Swoo_0591: transcriptional regulator, LysR family |
transcriptional regulator, LysR family |
| CRON 142. | |||||||||||||||||
| fixA |
|
|
|
|
|
|
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -234 score = 4.21483 sequence = AAATGTGAAGCGTGTAACATCA Gene: Shew_2677: electron transfer flavoprotein, beta subunit FixA |
*
Shewanella pealeana ATCC 700345 Site: position = -267 score = 5.17949 sequence = TTGTGTGATCTGTATAACATTA Gene: Spea_4039: electron transfer flavoprotein, beta subunit FixA |
*
Shewanella halifaxensis HAW-EB4 Site: position = -274 score = 4.79909 sequence = AAGTGTGACACACATAACATTA Gene: Shal_0219: electron transfer flavoprotein, beta subunit FixA |
*
Shewanella piezotolerans WP3 Site: position = -269 score = 4.72159 sequence = AAGTGTGACGAACATAACATTA Gene: swp_4939: electron transfer flavoprotein, beta subunit FixA |
*
Shewanella sediminis HAW-EB3 Site: position = -306 score = 4.76224 sequence = AAGTGTGACCCGCCTAACATTA Gene: Ssed_3230: electron transfer flavoprotein, beta subunit FixA |
|
electron transfer flavoprotein, beta subunit FixA |
| fixB |
|
|
|
|
|
|
|
|
|
|
Gene: Shew_2678: electron transfer flavoprotein, alpha subunit FixB |
Gene: Spea_4040: electron transfer flavoprotein, alpha subunit FixB |
Gene: Shal_0218: electron transfer flavoprotein, alpha subunit FixB |
Gene: swp_4940: electron transfer flavoprotein, alpha subunit FixB |
Gene: Ssed_3231: electron transfer flavoprotein, alpha subunit FixB |
|
electron transfer flavoprotein, alpha subunit FixB |
| fixC |
|
|
|
|
|
|
|
|
|
|
Gene: Shew_2679: probable electron transfer flavoprotein-quinone oxidoreductase FixC (EC 1.5.5.-) |
Gene: Spea_4041: probable electron transfer flavoprotein-quinone oxidoreductase FixC (EC 1.5.5.-) |
Gene: Shal_0217: probable electron transfer flavoprotein-quinone oxidoreductase FixC (EC 1.5.5.-) |
Gene: swp_4941: probable electron transfer flavoprotein-quinone oxidoreductase FixC (EC 1.5.5.-) |
Gene: Ssed_3232: probable electron transfer flavoprotein-quinone oxidoreductase FixC (EC 1.5.5.-) |
|
probable electron transfer flavoprotein-quinone oxidoreductase FixC (EC 1.5.5.-) |
| fixX |
|
|
|
|
|
|
|
|
|
|
Gene: Shew_2680: ferredoxin-like protein FixX |
Gene: Spea_4042: ferredoxin-like protein FixX |
Gene: Shal_0216: ferredoxin-like protein FixX |
Gene: swp_4942: ferredoxin-like protein FixX |
Gene: Ssed_3233: ferredoxin-like protein FixX |
|
ferredoxin-like protein FixX |
| CRON 143. | |||||||||||||||||
| Sbal_1323 |
|
|
|
|
|
|
Gene: Sbal_1323: HTH-type transcriptional regulator BetI |
Gene: Sden_0713: HTH-type transcriptional regulator BetI |
*
Shewanella frigidimarina NCIMB 400 Site: position = -111 score = 4.90608 sequence = TGTTGTGATCTATATCAAGTTA Gene: Sfri_1948: HTH-type transcriptional regulator BetI |
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -135 score = 3.67337 sequence = AAGCTTGATCGTTATAACCCTA Site: position = -164 score = 4.0973 sequence = ATGCGTGAGGTGAGTCACGCTT Gene: Spea_1009: HTH-type transcriptional regulator BetI |
*
Shewanella halifaxensis HAW-EB4 Site: position = -163 score = 4.31252 sequence = ATCTGTGAACCTTGTCGCATTT Gene: Shal_1059: HTH-type transcriptional regulator BetI |
*
Shewanella piezotolerans WP3 Site: position = -141 score = 4.72435 sequence = TTCTGTGATTCAGGTCGCAAAT Gene: swp_3809: HTH-type transcriptional regulator BetI |
*
Shewanella sediminis HAW-EB3 Site: position = -140 score = 4.30839 sequence = ATCTGTGATGCAAGTCGCAATC Gene: Ssed_1121: HTH-type transcriptional regulator BetI |
Gene: Swoo_1198: HTH-type transcriptional regulator BetI |
HTH-type transcriptional regulator BetI |
| Sbal_1324 |
|
|
|
|
|
|
Gene: Sbal_1324: betaine aldehyde dehydrogenase (EC 1.2.1.8) |
Gene: Sden_0714: betaine aldehyde dehydrogenase (EC 1.2.1.8) |
Gene: Sfri_1947: betaine aldehyde dehydrogenase (EC 1.2.1.8) |
|
|
Gene: Spea_1008: betaine aldehyde dehydrogenase (EC 1.2.1.8) |
Gene: Shal_1058: betaine aldehyde dehydrogenase (EC 1.2.1.8) |
Gene: swp_3810: betaine aldehyde dehydrogenase (EC 1.2.1.8) |
Gene: Ssed_1120: betaine aldehyde dehydrogenase (EC 1.2.1.8) |
Gene: Swoo_1197: betaine aldehyde dehydrogenase (EC 1.2.1.8) |
betaine aldehyde dehydrogenase (EC 1.2.1.8) |
| Sbal_1325 |
|
|
|
|
|
|
Gene: Sbal_1325: choline dehydrogenase (EC 1.1.99.1) |
Gene: Sden_0715: choline dehydrogenase (EC 1.1.99.1) |
Gene: Sfri_1946: choline dehydrogenase (EC 1.1.99.1) |
|
|
Gene: Spea_1007: choline dehydrogenase (EC 1.1.99.1) |
Gene: Shal_1057: choline dehydrogenase (EC 1.1.99.1) |
Gene: swp_3811: choline dehydrogenase (EC 1.1.99.1) |
Gene: Ssed_1119: choline dehydrogenase (EC 1.1.99.1) |
Gene: Swoo_1196: choline dehydrogenase (EC 1.1.99.1) |
choline dehydrogenase (EC 1.1.99.1) |
| swp_3812 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: swp_3812: hypothetical protein swp_3812 |
|
|
hypothetical protein swp_3812 |
| Sden_0716 |
|
|
|
|
|
|
Gene: Sbal_1326: predicted choline transporter BetT-II |
Gene: Sden_0716: predicted choline transporter BetT-II |
Gene: Sfri_1945: predicted choline transporter BetT-II |
|
|
Gene: Spea_1006: predicted choline transporter BetT-II |
Gene: Shal_1056: predicted choline transporter BetT-II |
Gene: swp_3813: predicted choline transporter BetT-II |
Gene: Ssed_1118: predicted choline transporter BetT-II |
Gene: Swoo_1195: predicted choline transporter BetT-II |
predicted choline transporter BetT-II |
| Sbal_1327 |
|
|
|
|
|
|
Gene: Sbal_1327: conserved hypothetical protein 2001 |
Gene: Sden_0717: conserved hypothetical protein 2001 |
Gene: Sfri_1944: conserved hypothetical protein 2001 |
|
|
Gene: Spea_1005: conserved hypothetical protein 2001 |
Gene: Shal_1055: conserved hypothetical protein 2001 |
Gene: swp_3814: conserved hypothetical protein 2001 |
Gene: Ssed_1117: conserved hypothetical protein 2001 |
Gene: Swoo_1194: conserved hypothetical protein 2001 |
conserved hypothetical protein 2001 |
| marR |
|
|
|
|
|
|
Gene: Sbal_1328: transcriptional regulator, MarR family |
Gene: Sden_0718: transcriptional regulator, MarR family |
Gene: Sfri_1943: transcriptional regulator, MarR family |
|
|
Gene: Spea_1004: transcriptional regulator, MarR family |
Gene: Shal_1054: transcriptional regulator, MarR family |
Gene: swp_3815: transcriptional regulator, MarR family |
Gene: Ssed_1772: transcriptional regulator, MarR family |
Gene: Swoo_1193: transcriptional regulator, MarR family |
transcriptional regulator, MarR family |
| CRON 144. | |||||||||||||||||
| Sbal_4271 |
|
*
Shewanella putrefaciens CN-32 Site: position = -57 score = 4.61055 sequence = AACCGTGATGCAGATCACTTAT Gene: Sputcn32_0064: membrane protein, HPP family |
|
*
Shewanella sp ANA-3 Site: position = -54 score = 4.94577 sequence = AAACGTGATGCGGATCACTTAT Gene: Shewana3_0083: membrane protein, HPP family |
*
Shewanella sp MR-4 Site: position = -53 score = 5.01551 sequence = AAATGTGACGCGGATCACTTAT Gene: Shewmr4_0081: membrane protein, HPP family |
*
Shewanella sp MR-7 Site: position = -53 score = 5.01551 sequence = AAATGTGACGCGGATCACTTAT Gene: Shewmr7_0079: membrane protein, HPP family |
*
Shewanella baltica OS155 Site: position = -57 score = 4.56587 sequence = AACTGTGATGCAGATCACTTAC Gene: Sbal_4271: membrane protein, HPP family |
|
Gene: Sfri_3855: membrane protein, HPP family |
Gene: Sama_3346: membrane protein, HPP family |
|
|
|
|
|
|
membrane protein, HPP family |
| CRON 145. | |||||||||||||||||
| SO2871 |
Gene: SO2871: arsenate reductase (EC 1.20.4.1) |
Gene: Sputcn32_1694: arsenate reductase (EC 1.20.4.1) |
Gene: Sputw3181_2331: arsenate reductase (EC 1.20.4.1) |
Gene: Shewana3_1648: arsenate reductase (EC 1.20.4.1) |
Gene: Shewmr4_2348: arsenate reductase (EC 1.20.4.1) |
Gene: Shewmr7_2420: arsenate reductase (EC 1.20.4.1) |
Gene: Sbal_1789: arsenate reductase (EC 1.20.4.1) |
Gene: Sden_1646: arsenate reductase (EC 1.20.4.1) |
Gene: Sfri_1754: arsenate reductase (EC 1.20.4.1) |
Gene: Sama_1914: arsenate reductase (EC 1.20.4.1) |
*
Shewanella loihica PV-4 Site: position = -51 score = 3.762 sequence = CCCTGTGACTCGGCTCACCTTT Gene: Shew_1840: arsenate reductase (EC 1.20.4.1) |
*
Shewanella pealeana ATCC 700345 Site: position = -64 score = 4.81008 sequence = CATTGTGACTATGATCACAAAA Gene: Spea_1970: arsenate reductase (EC 1.20.4.1) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -64 score = 5.0945 sequence = ATTTGTGACTCTGGTCACAAAT Gene: Shal_2329: arsenate reductase (EC 1.20.4.1) |
Gene: swp_2745: arsenate reductase (EC 1.20.4.1) |
*
Shewanella sediminis HAW-EB3 Site: position = -64 score = 5.0308 sequence = TTTTGTGACTTTGCTCACCTTT Gene: Ssed_2438: arsenate reductase (EC 1.20.4.1) |
*
Shewanella woodyi ATCC 51908 Site: position = -66 score = 4.15835 sequence = CCTTGTGACTTCGCTCACCTTT Gene: Swoo_2168: arsenate reductase (EC 1.20.4.1) |
arsenate reductase (EC 1.20.4.1) |
| SO2872 |
Gene: SO2872: hypothetical protein |
Gene: Sputcn32_1693: hypothetical protein |
Gene: Sputw3181_2332: hypothetical protein |
Gene: Shewana3_1647: hypothetical protein |
Gene: Shewmr4_2349: hypothetical protein |
Gene: Shewmr7_2421: hypothetical protein |
Gene: Sbal_1788: hypothetical protein |
Gene: Sden_1645: hypothetical protein |
Gene: Sfri_1753: hypothetical protein |
Gene: Sama_1915: hypothetical protein |
Gene: Shew_1839: hypothetical protein |
Gene: Spea_1969: hypothetical protein |
Gene: Shal_2330: hypothetical protein |
Gene: swp_2746: hypothetical protein |
Gene: Ssed_2439: hypothetical protein |
Gene: Swoo_2167: hypothetical protein |
hypothetical protein |
| CRON 146. | |||||||||||||||||
| SO4018 |
*
Shewanella oneidensis MR-1 Site: position = -158 score = 4.41258 sequence = AAATGTGATTTGTATCAATATC Gene: SO4018: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -158 score = 4.18501 sequence = AAGTGTGGTTTGTATCACTATT Gene: Sputcn32_3258: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -159 score = 4.18501 sequence = AAGTGTGGTTTGTATCACTATT Gene: Sputw3181_0683: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -159 score = 5.06132 sequence = AAATGTGATTTGTATCAACTTT Gene: Shewana3_3585: hypothetical protein |
Gene: Shewmr4_3415: hypothetical protein |
Gene: Shewmr7_0537: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -159 score = 4.18501 sequence = AAGTGTGGTTTGTATCACTATT Gene: Sbal_3741: hypothetical protein |
|
Gene: Sfri_3720: hypothetical protein |
|
Gene: Shew_1854: hypothetical protein |
|
Gene: Shal_3714: hypothetical protein |
Gene: swp_0666: hypothetical protein |
Gene: Ssed_0708: hypothetical protein |
Gene: Swoo_2602: hypothetical protein |
hypothetical protein |
| CRON 147. | |||||||||||||||||
| Shew_1222 |
|
|
|
|
|
|
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -66 score = 5.00586 sequence = TAGTGTGATGCAGCTCTCAATA Gene: Shew_1222: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -121 score = 4.42791 sequence = AAAGGTGAGCTCGATCACAAAC Site: position = -217 score = 3.68876 sequence = TTCAGTGATTTATATCGCCACT Gene: Spea_3260: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -216 score = 4.46502 sequence = TTAAGTGATTTGTATCGCCATA Site: position = -119 score = 4.84148 sequence = AATAGTGAGGTGGGTCACAAAT Gene: Shal_3336: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -105 score = 4.53382 sequence = AAAGGTGAACTAGATCACAAAG Gene: swp_1085: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -145 score = 5.13681 sequence = AAAGGTGATCGATATCACATAT Gene: Ssed_1323: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -69 score = 3.96244 sequence = GAAGGTGATTAATATCACGTTA Gene: Swoo_3332: hypothetical protein |
hypothetical protein |
| CRON 148. | |||||||||||||||||
| Shewana3_0734 |
|
|
|
*
Shewanella sp ANA-3 Site: position = -130 score = 4.77617 sequence = TCAAGTGATCAAGATCACATTT Gene: Shewana3_0734: outer membrane porin, putative |
*
Shewanella sp MR-4 Site: position = -130 score = 4.01203 sequence = TCCAATGATCCAGATCACATTT Gene: Shewmr4_3227: outer membrane porin, putative |
*
Shewanella sp MR-7 Site: position = -130 score = 4.01203 sequence = TCCAATGATCCAGATCACATTT Gene: Shewmr7_0762: outer membrane porin, putative |
*
Shewanella baltica OS155 Site: position = -127 score = 4.92696 sequence = AAACTTGATCCAGATCACACTT Gene: Sbal_3569: outer membrane porin, putative |
|
|
*
Shewanella amazonensis SB2B Site: position = -112 score = 5.12644 sequence = TGATGTGATAGTGATCACACTT Gene: Sama_0545: outer membrane porin, putative |
*
Shewanella loihica PV-4 Site: position = -163 score = 4.24117 sequence = ATTTGCGACACGGATCACACCT Site: position = -193 score = 3.79959 sequence = CAACATGATAAAACTCACGTAA Gene: Shew_3252: outer membrane porin, putative |
|
|
*
Shewanella piezotolerans WP3 Site: position = -177 score = 3.92439 sequence = ACCTATGATTAATATCACACAT Gene: swp_4513: outer membrane porin, putative |
*
Shewanella sediminis HAW-EB3 Site: position = -193 score = 4.79705 sequence = ATGCGTGATAAGAATCACAAAA Site: position = -223 score = 4.26599 sequence = AAAGATGATTGATATCACACAA Gene: Ssed_4008: outer membrane porin, putative |
|
outer membrane porin, putative |
| CRON 149. | |||||||||||||||||
| SO2589 |
Gene: SO2589: isopenicillin N synthase |
Gene: Sputcn32_1753: isopenicillin N synthase |
Gene: Sputw3181_2272: isopenicillin N synthase |
Gene: Shewana3_2394: isopenicillin N synthase |
Gene: Shewmr4_2185: isopenicillin N synthase |
Gene: Shewmr7_2262: isopenicillin N synthase |
Gene: Sbal_1856: isopenicillin N synthase |
Gene: Sden_2305: isopenicillin N synthase |
*
Shewanella frigidimarina NCIMB 400 Site: position = -55 score = 3.97839 sequence = AAGTGTGACTAAGGTTACCATT Gene: Sfri_1487: isopenicillin N synthase |
Gene: Sama_1992: isopenicillin N synthase |
*
Shewanella loihica PV-4 Site: position = -85 score = 4.32998 sequence = AAACGTGATTTTTATCACACCC Gene: Shew_1590: isopenicillin N synthase |
*
Shewanella pealeana ATCC 700345 Site: position = -84 score = 4.22792 sequence = AAGCGTGATCTAGCTCACTCAC Gene: Spea_2507: isopenicillin N synthase |
*
Shewanella halifaxensis HAW-EB4 Site: position = -84 score = 4.43981 sequence = CAGCGTGATCTACGTCACATTG Gene: Shal_1764: isopenicillin N synthase |
*
Shewanella piezotolerans WP3 Site: position = -87 score = 4.24034 sequence = GAATGTGATCTAGCTCACAGGT Gene: swp_3059: isopenicillin N synthase |
*
Shewanella sediminis HAW-EB3 Site: position = -51 score = 5.11563 sequence = AAACGTGATTTCAATCACACTT Gene: Ssed_2637: isopenicillin N synthase |
*
Shewanella woodyi ATCC 51908 Site: position = -82 score = 4.17759 sequence = CAAGGTGATTTATCTCACACAG Gene: Swoo_2030: isopenicillin N synthase |
isopenicillin N synthase |
| CRON 150. | |||||||||||||||||
| SO0584 |
Gene: SO0584: methyl-accepting chemotaxis protein |
*
Shewanella putrefaciens CN-32 Site: position = -147 score = 4.34837 sequence = ATTTGTTACTCTGCGCACATTT Gene: Sputcn32_3294: methyl-accepting chemotaxis protein |
*
Shewanella sp W3-18-1 Site: position = -147 score = 4.34837 sequence = ATTTGTTACTCTGCGCACATTT Gene: Sputw3181_0647: methyl-accepting chemotaxis protein |
*
Shewanella sp ANA-3 Site: position = -157 score = 4.39483 sequence = TTTTGTTACTCATCGCACATTT Gene: Shewana3_0582: methyl-accepting chemotaxis protein |
*
Shewanella sp MR-4 Site: position = -156 score = 4.39483 sequence = TTTTGTTACTCATCGCACATTT Gene: Shewmr4_0583: methyl-accepting chemotaxis protein |
*
Shewanella sp MR-7 Site: position = -156 score = 4.39483 sequence = TTTTGTTACTCATCGCACATTT Gene: Shewmr7_3447: methyl-accepting chemotaxis protein |
*
Shewanella baltica OS155 Site: position = -170 score = 4.16034 sequence = TTTTGTTACATGGCGCACGTTT Gene: Sbal_0543: methyl-accepting chemotaxis protein |
|
|
|
|
|
|
|
|
Gene: Swoo_4186: methyl-accepting chemotaxis protein |
methyl-accepting chemotaxis protein |
| CRON 151. | |||||||||||||||||
| rpsT |
*
Shewanella oneidensis MR-1 Site: position = -225 score = 4.49229 sequence = TTAGGTGATTCATCTCAAAAAA Gene: SO3537: SSU ribosomal protein S20p |
*
Shewanella putrefaciens CN-32 Site: position = -225 score = 4.49229 sequence = TTAGGTGATTCATCTCAAAAAA Gene: Sputcn32_1056: SSU ribosomal protein S20p |
*
Shewanella sp W3-18-1 Site: position = -225 score = 4.49229 sequence = TTAGGTGATTCATCTCAAAAAA Gene: Sputw3181_3109: SSU ribosomal protein S20p |
Gene: Shewana3_3140: SSU ribosomal protein S20p |
*
Shewanella sp MR-4 Site: position = -225 score = 4.49229 sequence = TTAGGTGATTCATCTCAAAAAA Gene: Shewmr4_2960: SSU ribosomal protein S20p |
*
Shewanella sp MR-7 Site: position = -225 score = 4.49229 sequence = TTAGGTGATTCATCTCAAAAAA Gene: Shewmr7_3042: SSU ribosomal protein S20p |
*
Shewanella baltica OS155 Site: position = -225 score = 4.49229 sequence = TTAGGTGATACATCTCAAAAAA Gene: Sbal_1051: SSU ribosomal protein S20p |
Gene: Sden_2726: SSU ribosomal protein S20p |
Gene: Sfri_2893: SSU ribosomal protein S20p |
Gene: Sama_0921: SSU ribosomal protein S20p |
Gene: Shew_1096: SSU ribosomal protein S20p |
Gene: Spea_1080: SSU ribosomal protein S20p |
Gene: Shal_1128: SSU ribosomal protein S20p |
Gene: swp_3733: SSU ribosomal protein S20p |
Gene: Ssed_1191: SSU ribosomal protein S20p |
Gene: Swoo_1288: SSU ribosomal protein S20p |
SSU ribosomal protein S20p |
| CRON 152. | |||||||||||||||||
| SO4503 |
Gene: SO4503: formate dehydrogenase chain D (EC 1.2.1.2) |
*
Shewanella putrefaciens CN-32 Site: position = -187 score = 3.98437 sequence = AAGTTTGAAGTAGATCATCAAA Site: position = -91 score = 4.13587 sequence = AATTGCGATAGATCACGCATTT Gene: Sputcn32_0343: formate dehydrogenase chain D (EC 1.2.1.2) |
*
Shewanella sp W3-18-1 Site: position = -131 score = 3.98437 sequence = AAGTTTGAAGTAGATCATCAAA Site: position = -35 score = 4.13587 sequence = AATTGCGATAGATCACGCATTT Gene: Sputw3181_3865: formate dehydrogenase chain D (EC 1.2.1.2) |
*
Shewanella sp ANA-3 Site: position = -187 score = 3.95752 sequence = TTGTTTGAGGTGGATCATCAAA Site: position = -91 score = 3.95291 sequence = AATTGCGACGGATCACGCATTT Gene: Shewana3_3910: formate dehydrogenase chain D (EC 1.2.1.2) |
*
Shewanella sp MR-4 Site: position = -91 score = 3.95291 sequence = AATTGCGACGGATCACGCATTT Site: position = -187 score = 3.95752 sequence = TTGTTTGAGGTGGATCATCAAA Gene: Shewmr4_3714: formate dehydrogenase chain D (EC 1.2.1.2) |
*
Shewanella sp MR-7 Site: position = -187 score = 3.95752 sequence = TTGTTTGAGGTGGATCATCAAA Site: position = -91 score = 3.95291 sequence = AATTGCGACGGATCACGCATTT Gene: Shewmr7_3785: formate dehydrogenase chain D (EC 1.2.1.2) |
*
Shewanella baltica OS155 Site: position = -187 score = 4.02029 sequence = TAGTTTGAACTAGATCATCAAA Gene: Sbal_4130: formate dehydrogenase chain D (EC 1.2.1.2) |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -139 score = 3.72886 sequence = AGATTTGCGCCAGATCACGCTT Gene: Sfri_0051: formate dehydrogenase chain D (EC 1.2.1.2) |
*
Shewanella amazonensis SB2B Site: position = -186 score = 3.94607 sequence = AAGTTTGAAGTGGATCATCAAA Gene: Sama_3619: formate dehydrogenase chain D (EC 1.2.1.2) |
*
Shewanella loihica PV-4 Site: position = -190 score = 3.98198 sequence = TAGTTTGAACTGGATCATCAAA Gene: Shew_0053: formate dehydrogenase chain D (EC 1.2.1.2) |
*
Shewanella pealeana ATCC 700345 Site: position = -87 score = 3.91453 sequence = AAGTGTGATCGACCACTAACTT Site: position = -183 score = 4.2287 sequence = TAGTTTGAACTAGATCAACTAT Gene: Spea_4143: formate dehydrogenase chain D (EC 1.2.1.2) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -85 score = 4.51497 sequence = AAATGTGATCTACTACTAATTT Site: position = -181 score = 4.2287 sequence = TAGTTTGAACTAGATCAACTAT Gene: Shal_0099: formate dehydrogenase chain D (EC 1.2.1.2) |
*
Shewanella piezotolerans WP3 Site: position = -25 score = 3.96595 sequence = AAAGGTAATTGAAATCTCATAA Site: position = -86 score = 4.23013 sequence = AAGTGTGATCTGCAGCTAACTT Gene: swp_5036: formate dehydrogenase chain D (EC 1.2.1.2) |
*
Shewanella sediminis HAW-EB3 Site: position = -153 score = 3.94258 sequence = TAACTTGAGCTGGATCATCAAT Site: position = -59 score = 3.79176 sequence = TTAAATGAGAGAGATCACGCAT Gene: Ssed_4427: formate dehydrogenase chain D (EC 1.2.1.2) |
*
Shewanella woodyi ATCC 51908 Site: position = -163 score = 4.25204 sequence = TTTTTTGAGCTAGATCATCAAA Gene: Swoo_4819: formate dehydrogenase chain D (EC 1.2.1.2) |
formate dehydrogenase chain D (EC 1.2.1.2) |
| SO4502 |
Gene: SO4502: conserved domain protein |
Gene: Sputcn32_0344: conserved domain protein |
Gene: Sputw3181_3864: conserved domain protein |
Gene: Shewana3_3909: conserved domain protein |
Gene: Shewmr4_3713: conserved domain protein |
Gene: Shewmr7_3784: conserved domain protein |
Gene: Sbal_4129: conserved domain protein |
|
|
Gene: Sama_3620: conserved domain protein |
Gene: Shew_0052: conserved domain protein |
*
Shewanella pealeana ATCC 700345 Site: position = -20 score = 3.92186 sequence = TTGCGTGACAAGGATAAAAAAT Gene: Spea_4144: conserved domain protein |
Gene: Shal_0098: conserved domain protein |
Gene: swp_5037: conserved domain protein |
Gene: Ssed_4428: conserved domain protein |
Gene: Swoo_4820: conserved domain protein |
conserved domain protein |
| CRON 153. | |||||||||||||||||
| yniC |
*
Shewanella oneidensis MR-1 Site: position = -302 score = 3.85086 sequence = AAGTATGAATCAGGTCACACTC Site: position = -118 score = 3.75451 sequence = TAACGAAATGCTTTTCACAGTA Gene: SO0431: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella putrefaciens CN-32 Site: position = -316 score = 3.85086 sequence = AAGTATGAATCAGGTCACACTC Gene: Sputcn32_3410: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella sp W3-18-1 Site: position = -316 score = 3.85086 sequence = AAGTATGAATCAGGTCACACTC Gene: Sputw3181_0533: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella sp ANA-3 Site: position = -315 score = 3.85086 sequence = AAGTATGAATCAGGTCACACTC Gene: Shewana3_0432: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella sp MR-4 Site: position = -315 score = 3.85086 sequence = AAGTATGAATCAGGTCACACTC Gene: Shewmr4_0436: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella sp MR-7 Site: position = -315 score = 3.85086 sequence = AAGTATGAATCAGGTCACACTC Gene: Shewmr7_3593: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella baltica OS155 Site: position = -315 score = 3.85086 sequence = AAGTATGAATCAGGTCACACTC Gene: Sbal_3906: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella denitrificans OS217 Site: position = -316 score = 3.96103 sequence = AAGTATGAATCGGCTCACACTG Gene: Sden_3378: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella frigidimarina NCIMB 400 Site: position = -288 score = 4.30901 sequence = AAGTATGAATCAGCTCACACTA Gene: Sfri_3772: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella amazonensis SB2B Site: position = -255 score = 3.96642 sequence = AAGTATGAATCAGCTCACACTC Gene: Sama_0381: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella loihica PV-4 Site: position = -295 score = 4.06797 sequence = AAGTATGAATCAGATCACACTC Gene: Shew_3425: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella pealeana ATCC 700345 Site: position = -286 score = 4.312 sequence = AAGTATGAATCCGATCACACTT Site: position = -178 score = 4.0845 sequence = AAACTTGATCTAAATTATATAA Gene: Spea_0424: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella halifaxensis HAW-EB4 Site: position = -178 score = 3.71098 sequence = AACCTTGATCTAAATTATATAA Site: position = -286 score = 4.50955 sequence = AAGTATGAATCCGATCACATTT Gene: Shal_0481: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella piezotolerans WP3 Site: position = -283 score = 4.43904 sequence = AAGTATGAATCAGATCACACTT Site: position = -177 score = 3.72798 sequence = AACACTGAGATTAATCACATAA Site: position = -101 score = 3.69204 sequence = TTTCGTAAAGCTAAACACAATA Gene: swp_4741: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella sediminis HAW-EB3 Site: position = -296 score = 4.16821 sequence = AAGTTTGAATCAGATCACACTC Gene: Ssed_0437: 2-deoxyglucose-6-phosphate hydrolase YniC |
*
Shewanella woodyi ATCC 51908 Site: position = -296 score = 4.16821 sequence = AAGTTTGAATCAGATCACACTC Gene: Swoo_0284: 2-deoxyglucose-6-phosphate hydrolase YniC |
2-deoxyglucose-6-phosphate hydrolase YniC |
| CRON 154. | |||||||||||||||||
| SO1410 |
*
Shewanella oneidensis MR-1 Site: position = -122 score = 4.54646 sequence = TGGCGTGATCCAATTCACCTTT Site: position = -82 score = 4.12313 sequence = TATTGTTAGTCACGTAACAAAA Gene: SO1410: conserved domain protein |
|
|
|
*
Shewanella sp MR-4 Site: position = -108 score = 4.37739 sequence = TGCCGTGATCCAATTCACCTTT Site: position = -68 score = 4.12313 sequence = TATTGTTAGTCACGTAACAATA Gene: Shewmr4_0303: conserved domain protein |
|
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -151 score = 3.85827 sequence = ATTCGCGAGCCAAGTCACGAAT Site: position = -110 score = 4.58634 sequence = TGGCGTGATCCATTTCACCTTT Gene: Shew_0272: conserved domain protein |
*
Shewanella pealeana ATCC 700345 Site: position = -157 score = 4.11876 sequence = ATTCGCGACCGAGCTCACGAAT Site: position = -116 score = 4.10717 sequence = CTGCGTGATCCATTTCAACTTT Gene: Spea_0321: conserved domain protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -156 score = 4.12956 sequence = ATTCGCGACTTGGCTCACGAAT Site: position = -115 score = 4.06729 sequence = CTGCGTGATCCAATTCAACTTT Gene: Shal_3970: conserved domain protein |
|
*
Shewanella sediminis HAW-EB3 Site: position = -154 score = 3.86025 sequence = ATTCGCGAGCTCTGTCACGAAT Site: position = -113 score = 4.19053 sequence = GTGCGTGATCCAATTCACCTTT Gene: Ssed_4188: conserved domain protein |
|
conserved domain protein |
| CRON 155. | |||||||||||||||||
| Spea_3089 |
|
*
Shewanella putrefaciens CN-32 Site: position = -213 score = 4.62461 sequence = TTATGTGAAGCAGATCGCCATT Gene: Sputcn32_0956: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -213 score = 4.62461 sequence = TTATGTGAAGCAGATCGCCATT Gene: Sputw3181_3220: hypothetical protein |
|
|
|
*
Shewanella baltica OS155 Site: position = -213 score = 4.62461 sequence = TTATGTGAAGCAGATCGCCATT Gene: Sbal_0942: hypothetical protein |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -141 score = 4.53172 sequence = TTTTGTGAATTAAAGCAAATAA Gene: Sfri_0964: hypothetical protein |
|
Gene: Shew_2850: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -256 score = 4.31895 sequence = TTTTGCGATTCAGATCACTTTG Gene: Spea_3089: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -268 score = 4.54077 sequence = TTCCGTGATCAATATCACCTTA Site: position = -40 score = 3.724 sequence = ATTTGAGATTCTATTTACAACT Gene: Shal_3174: hypothetical protein |
|
*2
Shewanella sediminis HAW-EB3 Site: position = -227 score = 3.88447 sequence = ATTTCAGATATAAATCAAAAAA Gene: Ssed_3419: hypothetical protein Site: position = -227 score = 3.8287 sequence = TTTTGTACTGTTTTTAAAATAA Gene: Ssed_3418: hypothetical protein |
Gene: Swoo_3601: hypothetical protein |
hypothetical protein |
| CRON 156. | |||||||||||||||||
| cymA |
*
Shewanella oneidensis MR-1 Site: position = -307 score = 3.99973 sequence = AAATGTCGCCTTGATCACATTT Gene: SO4591: membrane anchored tetraheme cytochrome c, CymA |
*
Shewanella putrefaciens CN-32 Site: position = -306 score = 4.73011 sequence = AAGTGTGCTATCGGTCACAATT Gene: Sputcn32_0286: membrane anchored tetraheme cytochrome c, CymA |
*
Shewanella sp W3-18-1 Site: position = -306 score = 4.1488 sequence = AAGTGTGCCATCGATTACAATT Gene: Sputw3181_3916: membrane anchored tetraheme cytochrome c, CymA |
*
Shewanella sp ANA-3 Site: position = -309 score = 4.04408 sequence = AAATGTCGCGTGGATCACATTT Gene: Shewana3_3977: membrane anchored tetraheme cytochrome c, CymA |
*
Shewanella sp MR-4 Site: position = -308 score = 4.25637 sequence = AAATGTCGTCTTGATCACATTT Gene: Shewmr4_3777: membrane anchored tetraheme cytochrome c, CymA |
*
Shewanella sp MR-7 Site: position = -318 score = 4.5441 sequence = AAATGTAGTGTTGATCACATTT Gene: Shewmr7_3850: membrane anchored tetraheme cytochrome c, CymA |
Gene: Sbal_0168: membrane anchored tetraheme cytochrome c, CymA |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -146 score = 4.26386 sequence = AGTCGAGATCTAGCTCGCATTT Gene: Sfri_0272: membrane anchored tetraheme cytochrome c, CymA |
Gene: Sama_3471: membrane anchored tetraheme cytochrome c, CymA |
*
Shewanella loihica PV-4 Site: position = -169 score = 4.19076 sequence = TATTATGAGCAATTTCATAAAA Gene: Shew_3540: membrane anchored tetraheme cytochrome c, CymA |
Gene: Spea_3983: membrane anchored tetraheme cytochrome c, CymA |
Gene: Shal_0284: membrane anchored tetraheme cytochrome c, CymA |
*
Shewanella piezotolerans WP3 Site: position = -276 score = 3.77018 sequence = ATTTGAGATCTAAAAAAAAATA Gene: swp_4806: membrane anchored tetraheme cytochrome c, CymA |
*
Shewanella sediminis HAW-EB3 Site: position = -86 score = 3.7379 sequence = CAGTATGATCTAGTTTATAATT Gene: Ssed_0216: membrane anchored tetraheme cytochrome c, CymA |
*
Shewanella woodyi ATCC 51908 Site: position = -152 score = 4.30109 sequence = AATTTTTATATTTATCAAAATA Gene: Swoo_0195: membrane anchored tetraheme cytochrome c, CymA |
membrane anchored tetraheme cytochrome c, CymA |
| CRON 157. | |||||||||||||||||
| mccA |
*
Shewanella oneidensis MR-1 Site: position = -111 score = 3.79582 sequence = TTTTTTGCTTTTTCTCTCATTC Site: position = -130 score = 4.3143 sequence = TAATGTGCTCTAGCGCAGATTT Gene: SO0479: cytochrome c, putative |
*
Shewanella putrefaciens CN-32 Site: position = -328 score = 4.27753 sequence = TAATGTGATCTTATTCGTTATT Site: position = -132 score = 4.2976 sequence = TAATGTGCTCTAGCTCTGATTT Gene: Sputcn32_3364: cytochrome c, putative |
*
Shewanella sp W3-18-1 Site: position = -132 score = 4.2976 sequence = TAATGTGCTCTAGCTCTGATTT Site: position = -328 score = 4.27753 sequence = TAATGTGATCTTATTCGTTATT Gene: Sputw3181_0577: cytochrome c, putative |
*
Shewanella sp ANA-3 Site: position = -328 score = 3.75838 sequence = GAATGTGATCTGTCTCGGCATT Gene: Shewana3_0489: cytochrome c, putative |
*
Shewanella sp MR-4 Site: position = -133 score = 4.38707 sequence = TAATGTGCTCTAGCTCAGGTTT Site: position = -328 score = 3.75838 sequence = GAATGTGATCTGTCTCGGCATT Gene: Shewmr4_0488: cytochrome c, putative |
*
Shewanella sp MR-7 Site: position = -328 score = 3.75838 sequence = GAATGTGATCTGTCTCGGCATT Site: position = -133 score = 4.38707 sequence = TAATGTGCTCTAGCTCAGGTTT Gene: Shewmr7_3542: cytochrome c, putative |
|
|
|
|
Gene: Shew_0348: cytochrome c, putative |
*2
Shewanella pealeana ATCC 700345 Site: position = -286 score = 3.8544 sequence = TTTTGCGATTTAAAAAACGTAA Site: position = -264 score = 3.89318 sequence = AGTTGTGATTTTTATATCTAAA Gene: Spea_0503: cytochrome c, putative Site: position = -341 score = 4.18356 sequence = TTTTGTGACCTCTCTATCCTTT Gene: Spea_0479: cytochrome c, putative |
*2
Shewanella halifaxensis HAW-EB4 Site: position = -284 score = 3.76526 sequence = TTTTGCGATTCAAAAAACGTTA Site: position = -159 score = 4.07393 sequence = AAGTGTGCTGTAGCGCAGATTT Site: position = -262 score = 3.89318 sequence = AGTTGTGATTTTTATATCTAAA Gene: Shal_0567: cytochrome c, putative Site: position = -340 score = 4.28106 sequence = TTTTGTGACCTCTCTAGCCTTT Gene: Shal_0551: cytochrome c, putative |
*
Shewanella piezotolerans WP3 Site: position = -246 score = 4.08547 sequence = TTATGTGCTCTAGCGCATGTTT Gene: swp_4657: cytochrome c, putative |
*2
Shewanella sediminis HAW-EB3 Site: position = -331 score = 4.31033 sequence = TTTTGTGACCCCGTTAGCCTTT Gene: Ssed_0482: cytochrome c, putative Site: position = -324 score = 3.95365 sequence = TATTGTGACCCACTCAAGATTT Site: position = -233 score = 3.69992 sequence = TTTTTTGAAATGTTTAACCTAC Site: position = -158 score = 4.2268 sequence = AAGTGTGCTTTGAAGCAAATTT Gene: Ssed_0493: cytochrome c, putative |
*2
Shewanella woodyi ATCC 51908 Site: position = -87 score = 3.87631 sequence = AATTGTTAAGTTGTTCAGCTAA Site: position = -342 score = 4.18356 sequence = TTTTGTGACCTCTCTATCCTTT Gene: Swoo_4477: cytochrome c, putative Site: position = -160 score = 4.00025 sequence = AAGTGTGCTTTAGCGCAGATTT Gene: Swoo_4456: cytochrome c, putative |
cytochrome c, putative |
| CRON 158. | |||||||||||||||||
| SO3406 |
*
Shewanella oneidensis MR-1 Site: position = -298 score = 3.84979 sequence = ATTTGTGCACAGCATCAACAAA Gene: SO3406: FIG024006: iron uptake protein |
*
Shewanella putrefaciens CN-32 Site: position = -315 score = 4.45237 sequence = AATTGTGACTTACCCCTCATTA Gene: Sputcn32_2727: FIG024006: iron uptake protein |
*
Shewanella sp W3-18-1 Site: position = -315 score = 4.45237 sequence = AATTGTGACTTACCCCTCATTA Gene: Sputw3181_1285: FIG024006: iron uptake protein |
*
Shewanella sp ANA-3 Site: position = -278 score = 4.76886 sequence = ATTTGTGACAAATTGCACATTA Site: position = -205 score = 4.10416 sequence = ATTCGTTAGGGATCTCACAGAT Gene: Shewana3_1149: FIG024006: iron uptake protein |
*
Shewanella sp MR-4 Site: position = -278 score = 4.76886 sequence = ATTTGTGACAAATTGCACATTA Site: position = -205 score = 4.10416 sequence = ATTCGTTAGGGATCTCACAGAT Gene: Shewmr4_1148: FIG024006: iron uptake protein |
*
Shewanella sp MR-7 Site: position = -278 score = 4.76886 sequence = ATTTGTGACAAATTGCACATTA Site: position = -205 score = 4.06428 sequence = ATTCGTTAGGGAACTCACAGAT Gene: Shewmr7_1219: FIG024006: iron uptake protein |
2
Shewanella baltica OS155 Gene: Sbal_1237: FIG024006: iron uptake protein Gene: Sbal_0110: FIG024006: iron uptake protein |
Gene: Sden_2355: FIG024006: iron uptake protein |
|
Gene: Sama_3409: FIG024006: iron uptake protein |
Gene: Shew_1240: FIG024006: iron uptake protein |
*
Shewanella pealeana ATCC 700345 Site: position = -248 score = 3.82328 sequence = TATTTTGATGTTTACCTCGCAT Gene: Spea_1223: FIG024006: iron uptake protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -301 score = 3.97847 sequence = TAGCTTGATTTTTATCACTCTT Site: position = -140 score = 4.21233 sequence = ATTTGAGAGCTATATCGCAGTT Gene: Shal_1257: FIG024006: iron uptake protein |
Gene: swp_3413: FIG024006: iron uptake protein |
Gene: Ssed_1345: FIG024006: iron uptake protein |
*
Shewanella woodyi ATCC 51908 Site: position = -141 score = 4.13024 sequence = ATATGAGATGCAGCTCTCATCT Gene: Swoo_3307: FIG024006: iron uptake protein |
FIG024006: iron uptake protein |
| SO3407 |
Gene: SO3407: FIG138928: iron-regulated membrane protein |
Gene: Sputcn32_2728: FIG138928: iron-regulated membrane protein |
Gene: Sputw3181_1284: FIG138928: iron-regulated membrane protein |
Gene: Shewana3_1148: FIG138928: iron-regulated membrane protein |
Gene: Shewmr4_1147: FIG138928: iron-regulated membrane protein |
Gene: Shewmr7_1218: FIG138928: iron-regulated membrane protein |
2
Shewanella baltica OS155 Gene: Sbal_1236: FIG138928: iron-regulated membrane protein Gene: Sbal_0109: FIG138928: iron-regulated membrane protein |
Gene: Sden_2356: FIG138928: iron-regulated membrane protein |
|
Gene: Sama_3410: FIG138928: iron-regulated membrane protein |
Gene: Shew_1239: FIG138928: iron-regulated membrane protein |
Gene: Spea_1222: FIG138928: iron-regulated membrane protein |
Gene: Shal_1256: FIG138928: iron-regulated membrane protein |
Gene: swp_3414: FIG138928: iron-regulated membrane protein |
Gene: Ssed_1344: FIG138928: iron-regulated membrane protein |
Gene: Swoo_3308: FIG138928: iron-regulated membrane protein |
FIG138928: iron-regulated membrane protein |
| SO3408 |
Gene: SO3408: FIG016502: iron uptake protein |
Gene: Sputcn32_2729: FIG016502: iron uptake protein |
Gene: Sputw3181_1283: FIG016502: iron uptake protein |
Gene: Shewana3_1147: FIG016502: iron uptake protein |
Gene: Shewmr4_1146: FIG016502: iron uptake protein |
Gene: Shewmr7_1217: FIG016502: iron uptake protein |
2
Shewanella baltica OS155 Gene: Sbal_1235: FIG016502: iron uptake protein Gene: Sbal_0108: FIG016502: iron uptake protein |
Gene: Sden_2357: FIG016502: iron uptake protein |
|
Gene: Sama_3411: FIG016502: iron uptake protein |
Gene: Shew_1238: FIG016502: iron uptake protein |
Gene: Spea_1221: FIG016502: iron uptake protein |
Gene: Shal_1255: FIG016502: iron uptake protein |
Gene: swp_3415: FIG016502: iron uptake protein |
Gene: Ssed_1343: FIG016502: iron uptake protein |
Gene: Swoo_3309: FIG016502: iron uptake protein |
FIG016502: iron uptake protein |
| CRON 159. | |||||||||||||||||
| Sden_3210 |
|
|
|
|
|
|
|
*
Shewanella denitrificans OS217 Site: position = -122 score = 4.295 sequence = AAGCGTGAACAGCATCACGTAA Gene: Sden_3210: hypothetical protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -160 score = 4.2595 sequence = ATAAGTGATCTAGTACTCACTT Site: position = -99 score = 4.17247 sequence = AAACATGATCTGGTTCAAATCA Gene: Sfri_3316: hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -165 score = 3.88916 sequence = TAGAGTGATCCTCTGCAAAGAA Site: position = -104 score = 4.79864 sequence = AATTATGATGCAATTCAAATAA Gene: Sama_3031: hypothetical protein |
*
Shewanella loihica PV-4 Site: position = -99 score = 4.07908 sequence = AACTATGACATTGTTCAAAAAA Gene: Shew_0560: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -105 score = 4.26365 sequence = AAGTTTGACTGCGTTCAAATAA Gene: Spea_3546: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -165 score = 3.77498 sequence = TTACGTGATCGAGCGCTAGTTT Site: position = -104 score = 4.30718 sequence = AAGTTTGACAGTGTTCAAATAT Gene: Shal_3640: hypothetical protein |
Gene: swp_0782: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -164 score = 3.84569 sequence = AAGTGTGATCTGACGCCGATTT Site: position = -103 score = 3.88583 sequence = AACTTTGAACTTGTTCAAGTAT Gene: Ssed_0791: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -44 score = 4.46639 sequence = AAGTTTGAGCTTGTTCAAATAT Gene: Swoo_4177: hypothetical protein |
hypothetical protein |
| CRON 160. | |||||||||||||||||
| ydhD |
*
Shewanella oneidensis MR-1 Site: position = -157 score = 4.47294 sequence = ATTTGTGATGTGAATCATTGTT Gene: SO2880: Probable monothiol glutaredoxin ydhD |
*
Shewanella putrefaciens CN-32 Site: position = -156 score = 4.47294 sequence = ATTTGTGATGTGAATCATTGTT Gene: Sputcn32_1688: Probable monothiol glutaredoxin ydhD |
*
Shewanella sp W3-18-1 Site: position = -156 score = 4.47294 sequence = ATTTGTGATGTGAATCATTGTT Gene: Sputw3181_2337: Probable monothiol glutaredoxin ydhD |
*
Shewanella sp ANA-3 Site: position = -157 score = 4.47294 sequence = ATTTGTGATGTGAATCATTGTT Gene: Shewana3_1640: Probable monothiol glutaredoxin ydhD |
*
Shewanella sp MR-4 Site: position = -157 score = 4.47294 sequence = ATTTGTGATGTGAATCATTGTT Gene: Shewmr4_1573: Probable monothiol glutaredoxin ydhD |
*
Shewanella sp MR-7 Site: position = -157 score = 4.47294 sequence = ATTTGTGATGTGAATCATTGTT Gene: Shewmr7_1648: Probable monothiol glutaredoxin ydhD |
*
Shewanella baltica OS155 Site: position = -156 score = 4.47294 sequence = ATTTGTGATGTGAATCATTGTT Gene: Sbal_1783: Probable monothiol glutaredoxin ydhD |
*
Shewanella denitrificans OS217 Site: position = -137 score = 4.50688 sequence = TTTTGTGATGTGCATCATTGTT Gene: Sden_1640: Probable monothiol glutaredoxin ydhD |
*
Shewanella frigidimarina NCIMB 400 Site: position = -155 score = 4.47952 sequence = TTTTGTGATGTGAATCATTGTT Gene: Sfri_1748: Probable monothiol glutaredoxin ydhD |
*
Shewanella amazonensis SB2B Site: position = -173 score = 4.18215 sequence = ATCTGTGATGTGAATCATTCTT Gene: Sama_1919: Probable monothiol glutaredoxin ydhD |
*
Shewanella loihica PV-4 Site: position = -164 score = 4.22504 sequence = AGTTGTGATGTGAATCATTGTT Gene: Shew_1835: Probable monothiol glutaredoxin ydhD |
*
Shewanella pealeana ATCC 700345 Site: position = -154 score = 3.62647 sequence = ACTTGTGAAGTGTATCATTGTT Gene: Spea_1964: Probable monothiol glutaredoxin ydhD |
*
Shewanella halifaxensis HAW-EB4 Site: position = -154 score = 3.85831 sequence = AGTTGTGAAGTGTATCATTGTT Gene: Shal_2335: Probable monothiol glutaredoxin ydhD |
*
Shewanella piezotolerans WP3 Site: position = -153 score = 3.62647 sequence = ACTTGTGAAGTGTATCATTGTT Gene: swp_2753: Probable monothiol glutaredoxin ydhD |
Gene: Ssed_2444: Probable monothiol glutaredoxin ydhD |
Gene: Swoo_2160: Probable monothiol glutaredoxin ydhD |
Probable monothiol glutaredoxin ydhD |
| CRON 161. | |||||||||||||||||
| ppc |
Gene: SO0274: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
Gene: Sputcn32_3718: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
Gene: Sputw3181_3861: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
*
Shewanella sp ANA-3 Site: position = -233 score = 3.69573 sequence = AATATTGCGTTAGCTCGCATTT Site: position = -189 score = 3.71015 sequence = TATCGCGATTAGTTGCATATAA Gene: Shewana3_3906: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
*
Shewanella sp MR-4 Site: position = -228 score = 3.69573 sequence = AATATTGCGTTAGCTCGCATTT Site: position = -184 score = 4.26965 sequence = TATCGTGATTAGTTGCATATAA Gene: Shewmr4_3710: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
*
Shewanella sp MR-7 Site: position = -184 score = 4.26965 sequence = TATCGTGATTAGTTGCATATAA Site: position = -228 score = 3.69573 sequence = AATATTGCGTTAGCTCGCATTT Gene: Shewmr7_0235: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
Gene: Sbal_4125: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
Gene: Sden_0248: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
Gene: Sfri_0189: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
Gene: Sama_0254: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
*
Shewanella loihica PV-4 Site: position = -107 score = 4.32804 sequence = CAAGGTGATATAGAACACATAA Gene: Shew_0200: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
Gene: Spea_0225: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -106 score = 4.97713 sequence = AAAAGTGATATAGAGCACATTA Gene: Shal_4095: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
*
Shewanella piezotolerans WP3 Site: position = -106 score = 4.36224 sequence = TAAAGTGAGGTAGAGCACATTC Gene: swp_2053: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
*
Shewanella sediminis HAW-EB3 Site: position = -111 score = 3.94637 sequence = CCGAGTGATGTAGAGCACATAA Gene: Ssed_4278: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
*
Shewanella woodyi ATCC 51908 Site: position = -111 score = 4.6535 sequence = AGAAGTGATGTAGAACACATAA Gene: Swoo_0327: phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
phosphoenolpyruvate carboxylase (EC 4.1.1.31) |
| yceB |
Gene: SO0273: uncharacterized lipoprotein YceB precursor |
Gene: Sputcn32_3719: uncharacterized lipoprotein YceB precursor |
Gene: Sputw3181_3862: uncharacterized lipoprotein YceB precursor |
Gene: Shewana3_3907: uncharacterized lipoprotein YceB precursor |
Gene: Shewmr4_3711: uncharacterized lipoprotein YceB precursor |
Gene: Shewmr7_0234: uncharacterized lipoprotein YceB precursor |
Gene: Sbal_4126: uncharacterized lipoprotein YceB precursor |
Gene: Sden_0247: uncharacterized lipoprotein YceB precursor |
Gene: Sfri_0188: uncharacterized lipoprotein YceB precursor |
Gene: Sama_0253: uncharacterized lipoprotein YceB precursor |
Gene: Shew_0199: uncharacterized lipoprotein YceB precursor |
Gene: Spea_0224: uncharacterized lipoprotein YceB precursor |
Gene: Shal_4096: uncharacterized lipoprotein YceB precursor |
Gene: swp_2052: uncharacterized lipoprotein YceB precursor |
Gene: Ssed_4279: uncharacterized lipoprotein YceB precursor |
Gene: Swoo_0326: uncharacterized lipoprotein YceB precursor |
uncharacterized lipoprotein YceB precursor |
| CRON 162. | |||||||||||||||||
| Sbal_0179 |
|
*
Shewanella putrefaciens CN-32 Site: position = -90 score = 4.19063 sequence = ACTTGGGATTAGTTTCACATTA Gene: Sputcn32_0311: transcriptional regulator, LysR family |
*
Shewanella sp W3-18-1 Site: position = -90 score = 4.19063 sequence = ACTTGGGATTAGTTTCACATTA Gene: Sputw3181_3897: transcriptional regulator, LysR family |
*
Shewanella sp ANA-3 Site: position = -287 score = 3.8486 sequence = AGTTAAGATACAGAGCACATTA Site: position = -92 score = 4.10349 sequence = ACTTGAGACTGGTTTCACATTA Gene: Shewana3_3964: transcriptional regulator, LysR family |
*
Shewanella sp MR-4 Site: position = -92 score = 4.10349 sequence = ACTTGAGACTGGTTTCACATTA Site: position = -287 score = 3.74836 sequence = AGTTAAGATACAGAACACATTA Gene: Shewmr4_3766: transcriptional regulator, LysR family |
*
Shewanella sp MR-7 Site: position = -287 score = 3.8486 sequence = AGTTAAGATACAGAGCACATTA Site: position = -92 score = 4.01529 sequence = ACTTGAGACTAGTTTCACATTA Gene: Shewmr7_3839: transcriptional regulator, LysR family |
*
Shewanella baltica OS155 Site: position = -173 score = 4.02817 sequence = CAAATTTATCTTTATCACATTT Site: position = -89 score = 4.74408 sequence = AGTTGAGATATGTTTCACATTA Gene: Sbal_0179: transcriptional regulator, LysR family |
|
|
|
|
|
|
|
|
|
transcriptional regulator, LysR family |
| menD |
Gene: SO4573: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
Gene: Sputcn32_0310: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
Gene: Sputw3181_3898: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
Gene: Shewana3_3965: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
Gene: Shewmr4_3767: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
Gene: Shewmr7_3840: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
Gene: Sbal_0178: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
|
Gene: Sfri_0282: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
Gene: Sama_3460: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
Gene: Shew_3599: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
*
Shewanella pealeana ATCC 700345 Site: position = -149 score = 3.98705 sequence = TTTTGCTACCCTTATCACATAC Gene: Spea_3971: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -177 score = 5.01631 sequence = TTTTGTTATACCAATCACATAT Gene: Shal_0297: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
Gene: swp_4792: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
*
Shewanella sediminis HAW-EB3 Site: position = -302 score = 4.40098 sequence = TAAAGTGATCTACAACTCAAAT Gene: Ssed_0226: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
Gene: Swoo_0209: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) |
| SO4574 |
Gene: SO4574: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Sputcn32_0309: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Sputw3181_3899: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Shewana3_3966: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Shewmr4_3768: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Shewmr7_3841: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Sbal_0177: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Sden_1108: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Sfri_0281: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Sama_3461: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Shew_3600: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Spea_3972: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Shal_0296: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: swp_4793: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Ssed_0225: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
Gene: Swoo_0208: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) |
| menC |
Gene: SO4575: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
Gene: Sputcn32_0308: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
Gene: Sputw3181_3900: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
Gene: Shewana3_3967: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
Gene: Shewmr4_3769: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
Gene: Shewmr7_3842: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
Gene: Sbal_0176: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
|
Gene: Sfri_0280: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
Gene: Sama_3462: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
Gene: Shew_3601: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
Gene: Spea_3973: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
Gene: Shal_0295: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
Gene: swp_4795: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
Gene: Ssed_0224: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
Gene: Swoo_0207: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
O-succinylbenzoate-CoA synthase (EC 4.2.1.-) |
| SO4576 |
Gene: SO4576: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
Gene: Sputcn32_0307: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
Gene: Sputw3181_3901: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
Gene: Shewana3_3968: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
Gene: Shewmr4_3770: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
Gene: Shewmr7_3843: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
Gene: Sbal_0175: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
|
Gene: Sfri_0279: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
Gene: Sama_3463: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
Gene: Shew_3602: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
Gene: Spea_3974: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
Gene: Shal_0294: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
Gene: swp_4796: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
Gene: Ssed_0223: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
Gene: Swoo_0206: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26) |
| SO4567 |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -74 score = 4.30708 sequence = ATATTTGATTCATCTCATATAC Gene: swp_4791: transcriptional regulator, AsnC family |
|
|
transcriptional regulator, AsnC family |
| CRON 163. | |||||||||||||||||
| Sbal_2136 |
|
*
Shewanella putrefaciens CN-32 Site: position = -48 score = 4.74308 sequence = GTTTGTTATCTATATCACATAA Gene: Sputcn32_3863: putative OMR family iron-siderophore receptor precursor |
*
Shewanella sp W3-18-1 Site: position = -48 score = 4.54553 sequence = GTTTGTTATCTATATCACACAA Gene: Sputw3181_0090: putative OMR family iron-siderophore receptor precursor |
*
Shewanella sp ANA-3 Site: position = -117 score = 3.72236 sequence = TTATTTGATACGACTTAAGAAT Site: position = -90 score = 5.12533 sequence = ATTTGTTATATTTATCACATAA Gene: Shewana3_0952: putative OMR family iron-siderophore receptor precursor |
*
Shewanella sp MR-4 Site: position = -84 score = 4.8687 sequence = ATTTGTTACATTTATCACATAA Gene: Shewmr4_0950: putative OMR family iron-siderophore receptor precursor |
*
Shewanella sp MR-7 Site: position = -84 score = 4.8687 sequence = ATTTGTTACATTTATCACATAA Gene: Shewmr7_0988: putative OMR family iron-siderophore receptor precursor |
*
Shewanella baltica OS155 Site: position = -169 score = 3.70311 sequence = TGCTGTGAGCTTTCTCTTAAAT Site: position = -89 score = 4.51547 sequence = ATATGTTATCCGAATCACTAAA Gene: Sbal_2136: putative OMR family iron-siderophore receptor precursor |
|
|
|
|
|
|
|
|
|
putative OMR family iron-siderophore receptor precursor |
| CRON 164. | |||||||||||||||||
| SO4519 |
*
Shewanella oneidensis MR-1 Site: position = -214 score = 4.11805 sequence = TTTTGTTAAGCAGATCATGTTT Gene: SO4519: sodium-dependent transporter |
*
Shewanella putrefaciens CN-32 Site: position = -224 score = 4.11805 sequence = TTTTGTTAAGCAGATCATGTTT Gene: Sputcn32_3507: sodium-dependent transporter |
*
Shewanella sp W3-18-1 Site: position = -278 score = 4.11805 sequence = TTTTGTTAAGCAGATCATGTTT Gene: Sputw3181_0399: sodium-dependent transporter |
*
Shewanella sp ANA-3 Site: position = -236 score = 4.11805 sequence = TTTTGTTAAGCAGATCATGTTT Gene: Shewana3_3925: sodium-dependent transporter |
*
Shewanella sp MR-4 Site: position = -236 score = 4.11805 sequence = TTTTGTTAAGCAGATCATGTTT Gene: Shewmr4_3729: sodium-dependent transporter |
*
Shewanella sp MR-7 Site: position = -236 score = 4.11805 sequence = TTTTGTTAAGCAGATCATGTTT Gene: Shewmr7_3800: sodium-dependent transporter |
*
Shewanella baltica OS155 Site: position = -228 score = 4.11805 sequence = TTTTGTTAAGCAGATCATGTTT Gene: Sbal_0220: sodium-dependent transporter |
|
|
|
|
|
|
|
|
|
sodium-dependent transporter |
| CRON 165. | |||||||||||||||||
| atoB |
Gene: SO1677: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
Gene: Sputcn32_1397: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
Gene: Sputw3181_2704: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
Gene: Shewana3_2771: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
Gene: Shewmr4_2597: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
Gene: Shewmr7_2664: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
Gene: Sbal_1495: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
Gene: Sden_1943: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
Gene: Sfri_1338: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
*
Shewanella amazonensis SB2B Site: position = -67 score = 4.10177 sequence = AACCGCGACCGCCATCACATTT Gene: Sama_1375: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
*
Shewanella loihica PV-4 Site: position = -75 score = 4.18355 sequence = TTATTTGAACATGATCACGCTT Gene: Shew_1667: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
*
Shewanella pealeana ATCC 700345 Site: position = -138 score = 4.52681 sequence = AATATTGAGCAAGATCACATTT Gene: Spea_2783: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -138 score = 4.15147 sequence = AATGTTGAGCAAGATCACACTT Gene: Shal_2878: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
*
Shewanella piezotolerans WP3 Site: position = -175 score = 4.43722 sequence = AATGTTGAGCGAGATCACATTT Gene: swp_3387: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
*
Shewanella sediminis HAW-EB3 Site: position = -92 score = 4.26425 sequence = TTAATTGAGCAAGATCACACTT Gene: Ssed_1473: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
Gene: Swoo_3202: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) |
| mmsA |
Gene: SO1678: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Sputcn32_1398: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Sputw3181_2703: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Shewana3_2770: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Shewmr4_2596: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Shewmr7_2663: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Sbal_1496: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Sden_1942: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Sfri_1339: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Sama_1376: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Shew_1668: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Spea_2782: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Shal_2877: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: swp_3386: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Ssed_1474: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Gene: Swoo_3201: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
| SO1679 |
Gene: SO1679: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Sputcn32_1399: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Sputw3181_2702: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Shewana3_2769: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Shewmr4_2595: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Shewmr7_2662: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Sbal_1497: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Sden_1941: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Sfri_1340: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Sama_1377: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Shew_1669: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Spea_2781: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Shal_2876: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: swp_3385: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Ssed_1475: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
Gene: Swoo_3200: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) |
| SO1680 |
Gene: SO1680: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Sputcn32_1400: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Sputw3181_2701: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Shewana3_2768: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Shewmr4_2594: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Shewmr7_2661: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Sbal_1498: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Sden_1940: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Sfri_1341: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Sama_1378: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Shew_1670: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Spea_2780: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Shal_2875: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: swp_3384: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Ssed_1476: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
Gene: Swoo_3199: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) |
| SO1681 |
Gene: SO1681: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Sputcn32_1401: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Sputw3181_2700: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Shewana3_2767: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Shewmr4_2593: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Shewmr7_2660: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Sbal_1499: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Sden_1939: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Sfri_1342: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Sama_1379: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Shew_1671: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Spea_2779: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Shal_2874: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: swp_3383: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Ssed_1477: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
Gene: Swoo_3198: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) |
| mmsB |
Gene: SO1682: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Sputcn32_1402: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Sputw3181_2699: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Shewana3_2766: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Shewmr4_2592: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Shewmr7_2659: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Sbal_1500: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Sden_1938: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Sfri_1343: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Sama_1380: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Shew_1672: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Spea_2778: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Shal_2873: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: swp_3382: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Ssed_1478: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
Gene: Swoo_3197: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) |
| fabG |
Gene: SO1683: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: Sputcn32_1403: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: Sputw3181_2698: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: Shewana3_2765: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: Shewmr4_2591: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: Shewmr7_2658: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: Sbal_1501: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: Sden_1937: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: Sfri_1344: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: Sama_1381: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: Shew_1673: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
2
Shewanella pealeana ATCC 700345 Gene: Spea_2776: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) Gene: Spea_2777: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: Shal_2872: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: swp_3381: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: Ssed_1479: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
Gene: Swoo_3196: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35) |
| CRON 166. | |||||||||||||||||
| cdd |
*
Shewanella oneidensis MR-1 Site: position = -82 score = 4.12615 sequence = AAACGCGAACTAACTCGCATTT Gene: SO2791: cytidine deaminase (EC 3.5.4.5) |
*
Shewanella putrefaciens CN-32 Site: position = -131 score = 3.81577 sequence = TATGGTGAAATCGGTCAAATAC Site: position = -82 score = 4.1802 sequence = AAACGCGAGCTAACTCGCATTT Gene: Sputcn32_1568: cytidine deaminase (EC 3.5.4.5) |
*
Shewanella sp W3-18-1 Site: position = -131 score = 3.81577 sequence = TATGGTGAAATCGGTCAAATAC Site: position = -82 score = 4.1802 sequence = AAACGCGAGCTAACTCGCATTT Gene: Sputw3181_2531: cytidine deaminase (EC 3.5.4.5) |
*
Shewanella sp ANA-3 Site: position = -82 score = 4.12615 sequence = AAACGCGAACTAACTCGCATTT Gene: Shewana3_2573: cytidine deaminase (EC 3.5.4.5) |
*
Shewanella sp MR-4 Site: position = -82 score = 4.12615 sequence = AAACGCGAACTAACTCGCATTT Gene: Shewmr4_2411: cytidine deaminase (EC 3.5.4.5) |
*
Shewanella sp MR-7 Site: position = -82 score = 4.12615 sequence = AAACGCGAACTAACTCGCATTT Gene: Shewmr7_2481: cytidine deaminase (EC 3.5.4.5) |
*
Shewanella baltica OS155 Site: position = -157 score = 3.848 sequence = ATTCGTGAATAGACTCACTCTA Site: position = -82 score = 4.1802 sequence = AAACGCGAGCTAACTCGCATTT Gene: Sbal_1694: cytidine deaminase (EC 3.5.4.5) |
Gene: Sden_2288: cytidine deaminase (EC 3.5.4.5) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -44 score = 3.76489 sequence = AAATTTTATTTTTATCCAATTT Gene: Sfri_1637: cytidine deaminase (EC 3.5.4.5) |
*
Shewanella amazonensis SB2B Site: position = -82 score = 3.98623 sequence = AAATGGGATTAGACTCCCATTA Gene: Sama_1974: cytidine deaminase (EC 3.5.4.5) |
Gene: Shew_1610: cytidine deaminase (EC 3.5.4.5) |
Gene: Spea_2488: cytidine deaminase (EC 3.5.4.5) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -81 score = 3.92777 sequence = AACTGAGATCTTCATCTCATTC Gene: Shal_1783: cytidine deaminase (EC 3.5.4.5) |
*
Shewanella piezotolerans WP3 Site: position = -82 score = 4.08089 sequence = AAGTGCGATCTCTGTCGCATTC Gene: swp_3037: cytidine deaminase (EC 3.5.4.5) |
*
Shewanella sediminis HAW-EB3 Site: position = -82 score = 3.8988 sequence = AAATGGGAGCTGGATCTCATCA Gene: Ssed_2618: cytidine deaminase (EC 3.5.4.5) |
*
Shewanella woodyi ATCC 51908 Site: position = -82 score = 3.88552 sequence = AAATGGGAGAAAGATCCCATTA Gene: Swoo_2048: cytidine deaminase (EC 3.5.4.5) |
cytidine deaminase (EC 3.5.4.5) |
| CRON 167. | |||||||||||||||||
| prlC |
*
Shewanella oneidensis MR-1 Site: position = -136 score = 4.23916 sequence = AATTGAGAACTGGCTCACTTTT Gene: SO4699: Oligopeptidase A (EC 3.4.24.70) |
*
Shewanella putrefaciens CN-32 Site: position = -178 score = 4.32378 sequence = AATTGAGAACTAGTTCACTTTT Gene: Sputcn32_0087: Oligopeptidase A (EC 3.4.24.70) |
*
Shewanella sp W3-18-1 Site: position = -178 score = 4.32378 sequence = AATTGAGAACTAGTTCACTTTT Gene: Sputw3181_3978: Oligopeptidase A (EC 3.4.24.70) |
*
Shewanella sp ANA-3 Site: position = -136 score = 4.60178 sequence = AATTGTGAACTGGTTCGCTTTT Gene: Shewana3_4051: Oligopeptidase A (EC 3.4.24.70) |
*
Shewanella sp MR-4 Site: position = -136 score = 4.32792 sequence = AATTGTGAACTGAGTCGCTTTT Gene: Shewmr4_3842: Oligopeptidase A (EC 3.4.24.70) |
*
Shewanella sp MR-7 Site: position = -136 score = 4.32792 sequence = AATTGTGAACTGAGTCGCTTTT Gene: Shewmr7_3935: Oligopeptidase A (EC 3.4.24.70) |
*
Shewanella baltica OS155 Site: position = -136 score = 4.25546 sequence = AAATGCGAACGAGTTCACTTTT Gene: Sbal_0124: Oligopeptidase A (EC 3.4.24.70) |
Gene: Sden_3595: Oligopeptidase A (EC 3.4.24.70) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -226 score = 4.03722 sequence = AATTGGGATCTTAGTCACTCTA Gene: Sfri_3874: Oligopeptidase A (EC 3.4.24.70) |
Gene: Sama_3546: Oligopeptidase A (EC 3.4.24.70) |
*
Shewanella loihica PV-4 Site: position = -247 score = 3.80884 sequence = ATTTGCGATCCGCTTGGCAATA Gene: Shew_3657: Oligopeptidase A (EC 3.4.24.70) |
*
Shewanella pealeana ATCC 700345 Site: position = -143 score = 3.86078 sequence = AAACTTGATTAAGATCGCGGAT Gene: Spea_4065: Oligopeptidase A (EC 3.4.24.70) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -192 score = 4.36311 sequence = ATTTGCGACGTGGTTTACAATA Site: position = -142 score = 4.16573 sequence = AAATTTGATCTAGATCCTAGAT Gene: Shal_0193: Oligopeptidase A (EC 3.4.24.70) |
*
Shewanella piezotolerans WP3 Site: position = -311 score = 3.74401 sequence = ATTTGCGAGGCGCTTTGCAATA Site: position = -261 score = 3.64442 sequence = AAAATTGACTTTAGTCAAAGAT Gene: swp_4926: Oligopeptidase A (EC 3.4.24.70) |
*
Shewanella sediminis HAW-EB3 Site: position = -210 score = 4.12812 sequence = ATTTGAGAAGTAATTCTCAATA Gene: Ssed_0145: Oligopeptidase A (EC 3.4.24.70) |
*
Shewanella woodyi ATCC 51908 Site: position = -172 score = 4.2313 sequence = TTTTTTGAGCTGGGTCAAAGTA Gene: Swoo_0124: Oligopeptidase A (EC 3.4.24.70) |
Oligopeptidase A (EC 3.4.24.70) |
| CRON 168. | |||||||||||||||||
| SO0572 |
*
Shewanella oneidensis MR-1 Site: position = -102 score = 4.35929 sequence = TATTTTGACTCAAGTCAAAATT Gene: SO0572: enoyl-CoA hydratase (EC 4.2.1.17) |
*
Shewanella putrefaciens CN-32 Site: position = -102 score = 4.32011 sequence = TATTTTGACTAAGGTCAAAATT Gene: Sputcn32_3304: enoyl-CoA hydratase (EC 4.2.1.17) |
*
Shewanella sp W3-18-1 Site: position = -102 score = 4.32011 sequence = TATTTTGACTAAGGTCAAAATT Gene: Sputw3181_0637: enoyl-CoA hydratase (EC 4.2.1.17) |
*
Shewanella sp ANA-3 Site: position = -102 score = 4.39917 sequence = TATTTTGACTCATGTCAAAAAT Gene: Shewana3_0572: enoyl-CoA hydratase (EC 4.2.1.17) |
*
Shewanella sp MR-4 Site: position = -102 score = 4.47285 sequence = TATTTTGACGCATGTCAAAATT Gene: Shewmr4_0573: enoyl-CoA hydratase (EC 4.2.1.17) |
*
Shewanella sp MR-7 Site: position = -102 score = 4.47285 sequence = TATTTTGACGCATGTCAAAATT Gene: Shewmr7_3457: enoyl-CoA hydratase (EC 4.2.1.17) |
*
Shewanella baltica OS155 Site: position = -102 score = 4.33082 sequence = TATTTTGACTCAAGTCAAAAAA Gene: Sbal_0533: enoyl-CoA hydratase (EC 4.2.1.17) |
*
Shewanella denitrificans OS217 Site: position = -100 score = 3.67337 sequence = ATTTTTGACTAGGGTCAATATT Gene: Sden_0534: enoyl-CoA hydratase (EC 4.2.1.17) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -237 score = 4.15851 sequence = CATTGTGATCAATGTCATATCA Gene: Sfri_3510: enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Sama_3135: enoyl-CoA hydratase (EC 4.2.1.17) |
*
Shewanella loihica PV-4 Site: position = -124 score = 4.27745 sequence = TATTTTGACGCCAGTCAAAAAA Gene: Shew_0454: enoyl-CoA hydratase (EC 4.2.1.17) |
*
Shewanella pealeana ATCC 700345 Site: position = -110 score = 3.6815 sequence = AAAAATGACCAATGTCATAATT Gene: Spea_3709: enoyl-CoA hydratase (EC 4.2.1.17) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -110 score = 3.87708 sequence = TAAAATGATGAGTGTCATAATT Gene: Shal_3794: enoyl-CoA hydratase (EC 4.2.1.17) |
*
Shewanella piezotolerans WP3 Site: position = -110 score = 3.64939 sequence = TTTATTGACGATAGTCAAAAAA Gene: swp_0563: enoyl-CoA hydratase (EC 4.2.1.17) |
*
Shewanella sediminis HAW-EB3 Site: position = -108 score = 4.13204 sequence = TTTTTTGACTGAAGTCAAACTT Gene: Ssed_0623: enoyl-CoA hydratase (EC 4.2.1.17) |
|
enoyl-CoA hydratase (EC 4.2.1.17) |
| CRON 169. | |||||||||||||||||
| SO1278 |
*
Shewanella oneidensis MR-1 Site: position = -57 score = 4.13666 sequence = TAAAATGAACTAGATCAAAATA Site: position = -189 score = 3.97126 sequence = TAATGGGAGCGTCATCACACTC Site: position = -297 score = 4.36307 sequence = CATTGTGAGTTGAGTCATATTT Gene: SO1278: methyl-accepting chemotaxis protein |
Gene: Sputcn32_1103: methyl-accepting chemotaxis protein |
Gene: Sputw3181_3061: methyl-accepting chemotaxis protein |
*
Shewanella sp ANA-3 Site: position = -217 score = 4.11314 sequence = TTTCGCGATAAATATCAAACTT Site: position = -60 score = 4.13008 sequence = AAAAATGAACTAGATCAAAATA Gene: Shewana3_3088: methyl-accepting chemotaxis protein |
*
Shewanella sp MR-4 Site: position = -249 score = 3.7259 sequence = TATTGTGAGTTAGGTCATGTCG Site: position = -60 score = 4.13008 sequence = AAAAATGAACTAGATCAAAATA Gene: Shewmr4_2909: methyl-accepting chemotaxis protein |
*
Shewanella sp MR-7 Site: position = -249 score = 3.7259 sequence = TATTGTGAGTTAGGTCATGTCG Site: position = -60 score = 4.13008 sequence = AAAAATGAACTAGATCAAAATA Gene: Shewmr7_2991: methyl-accepting chemotaxis protein |
|
Gene: Sden_0911: methyl-accepting chemotaxis protein |
Gene: Sfri_3002: methyl-accepting chemotaxis protein |
Gene: Sama_2635: methyl-accepting chemotaxis protein |
Gene: Shew_2301: methyl-accepting chemotaxis protein |
|
|
|
Gene: Ssed_1066: methyl-accepting chemotaxis protein |
|
methyl-accepting chemotaxis protein |
| CRON 170. | |||||||||||||||||
| SO0355 |
*
Shewanella oneidensis MR-1 Site: position = -84 score = 4.43193 sequence = TTATTTGCGCTACATCACAAAA Gene: SO0355: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella putrefaciens CN-32 Site: position = -84 score = 3.77566 sequence = CTATTTGCGCAGCATCACAAAA Site: position = -45 score = 3.94591 sequence = TAAAGTGATGGGGTAAAAATAA Gene: Sputcn32_3634: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella sp W3-18-1 Site: position = -45 score = 3.94591 sequence = TAAAGTGATGGGGTAAAAATAA Site: position = -84 score = 3.77566 sequence = CTATTTGCGCAGCATCACAAAA Gene: Sputw3181_3774: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Shewana3_3814: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Shewmr4_3617: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Shewmr7_0326: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella baltica OS155 Site: position = -73 score = 3.84693 sequence = CTATTTGCGCGGGCTCACAAAA Gene: Sbal_0351: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Sden_3437: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -51 score = 4.33198 sequence = TTGTGTTACCTAGCACACATAT Gene: Sfri_0361: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Sama_0261: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Shew_3502: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella pealeana ATCC 700345 Site: position = -124 score = 4.31365 sequence = AAGTTTGTCTTAGATCACATTT Gene: Spea_3882: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -124 score = 4.31365 sequence = AAGTTTGTCTTAGATCACATTT Gene: Shal_0387: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella piezotolerans WP3 Site: position = -127 score = 3.89754 sequence = AAAGTTGTCATAGATCACATTT Gene: swp_0315: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
*
Shewanella sediminis HAW-EB3 Site: position = -110 score = 3.92086 sequence = GAATTTGTCATAGATCACATTT Gene: Ssed_0331: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
Gene: Swoo_4587: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
| SO0354 |
Gene: SO0354: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
Gene: Sputcn32_3635: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
Gene: Sputw3181_3775: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
Gene: Shewana3_3815: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
Gene: Shewmr4_3618: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
Gene: Shewmr7_0325: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
Gene: Sbal_0350: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
Gene: Sden_3438: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
Gene: Sfri_0360: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
|
Gene: Shew_3503: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
Gene: Spea_3883: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
Gene: Shal_0386: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
Gene: swp_0314: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
Gene: Ssed_0330: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
Gene: Swoo_4588: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
inner membrane protein YrbG, predicted calcium/sodium:proton antiporter |
| CRON 171. | |||||||||||||||||
| fadE |
|
|
|
|
|
|
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -49 score = 4.852 sequence = TTTTGTGACGTAATGCACACTA Gene: Shew_3003: acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella pealeana ATCC 700345 Site: position = -68 score = 3.91603 sequence = AAATTTGATCTATGCCTCGTTT Gene: Spea_1234: acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -67 score = 4.37385 sequence = AAGTTTGATCTACAGCTCATTT Gene: Shal_1266: acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Shewanella piezotolerans WP3 Site: position = -67 score = 4.356 sequence = AAATTTGATCTGCCGCTCAATT Gene: swp_3422: acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
|
Gene: Swoo_1504: acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
| CRON 172. | |||||||||||||||||
| SO0296 |
Gene: SO0296: integral membrane domain protein |
Gene: Sputcn32_3696: integral membrane domain protein |
Gene: Sputw3181_3838: integral membrane domain protein |
Gene: Shewana3_3884: integral membrane domain protein |
Gene: Shewmr4_3688: integral membrane domain protein |
Gene: Shewmr7_0257: integral membrane domain protein |
Gene: Sbal_4103: integral membrane domain protein |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -7 score = 4.14632 sequence = AAGTGTAATGAAATCCACAATA Gene: Sfri_0385: integral membrane domain protein |
Gene: Sama_3358: integral membrane domain protein |
Gene: Shew_0223: integral membrane domain protein |
*
Shewanella pealeana ATCC 700345 Site: position = -118 score = 4.34967 sequence = ATAGGTGATCTTTATCATAGTA Gene: Spea_0248: integral membrane domain protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -133 score = 4.34967 sequence = ATAGGTGATCTTTATCATAGTA Gene: Shal_4072: integral membrane domain protein |
*
Shewanella piezotolerans WP3 Site: position = -120 score = 4.33988 sequence = ATGAGTGATCTTGTTCATAGTA Gene: swp_2077: integral membrane domain protein |
Gene: Ssed_4255: integral membrane domain protein |
|
integral membrane domain protein |
| CRON 173. | |||||||||||||||||
| SO1415 |
*
Shewanella oneidensis MR-1 Site: position = -135 score = 3.82355 sequence = GTATTTGAAGTAACTCACAAAG Site: position = -94 score = 3.97475 sequence = AGGTGTGACCTTTATCCCGATT Gene: SO1415: transcriptional regulator, TetR family |
|
|
|
*
Shewanella sp MR-4 Site: position = -241 score = 3.76302 sequence = ATTCGTGAGTTATCTCGTGAAT Site: position = -94 score = 4.04999 sequence = TGATGTGAGCTTAATCCCGATT Gene: Shewmr4_0298: transcriptional regulator, TetR family |
|
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -137 score = 4.4192 sequence = TTGTTTGACGTAATTCACAAAG Gene: Shew_0277: transcriptional regulator, TetR family |
*
Shewanella pealeana ATCC 700345 Site: position = -138 score = 4.52342 sequence = TTATATGACGTAATTCACAAAG Site: position = -247 score = 4.0954 sequence = ATTCGTGAGTCAGCTCTCGAAT Gene: Spea_0326: transcriptional regulator, TetR family |
*
Shewanella halifaxensis HAW-EB4 Site: position = -247 score = 4.16907 sequence = ATTCGTGAGGCAGCTCTCGAAT Site: position = -138 score = 4.27265 sequence = TTGTATGACGTAACTCACAAAG Gene: Shal_3965: transcriptional regulator, TetR family |
|
*2
Shewanella sediminis HAW-EB3 Site: position = -259 score = 3.87842 sequence = ATTCGTGAAGCAGATCTCGAAG Site: position = -136 score = 4.05481 sequence = TTACATGAGGTAACTCACAAAG Gene: Ssed_4183: transcriptional regulator, TetR family Site: position = -95 score = 4.18455 sequence = TTTTGTGGTGTACCTCAAGAAA Gene: Ssed_4177: transcriptional regulator, TetR family |
|
transcriptional regulator, TetR family |
| CRON 174. | |||||||||||||||||
| sdhC |
Gene: SO1927: Succinate dehydrogenase cytochrome b-556 subunit |
*
Shewanella putrefaciens CN-32 Site: position = -66 score = 3.78713 sequence = TGCCGTGATTTATCTCCCAGTT Gene: Sputcn32_2273: Succinate dehydrogenase cytochrome b-556 subunit |
*
Shewanella sp W3-18-1 Site: position = -66 score = 3.78713 sequence = TGCCGTGATTTATCTCCCAGTT Gene: Sputw3181_1735: Succinate dehydrogenase cytochrome b-556 subunit |
Gene: Shewana3_1706: Succinate dehydrogenase cytochrome b-556 subunit |
Gene: Shewmr4_1631: Succinate dehydrogenase cytochrome b-556 subunit |
Gene: Shewmr7_1706: Succinate dehydrogenase cytochrome b-556 subunit |
*
Shewanella baltica OS155 Site: position = -66 score = 3.78702 sequence = TGCCGTGATTCACATCCCAGTT Gene: Sbal_2519: Succinate dehydrogenase cytochrome b-556 subunit |
*
Shewanella denitrificans OS217 Site: position = -186 score = 3.83004 sequence = AAGGGCGACAAACATCACAATT Site: position = -274 score = 3.71915 sequence = TGGATTGATGCAAATTACAAAA Gene: Sden_2187: Succinate dehydrogenase cytochrome b-556 subunit |
Gene: Sfri_2347: Succinate dehydrogenase cytochrome b-556 subunit |
*
Shewanella amazonensis SB2B Site: position = -80 score = 3.67117 sequence = TTTTGTGACGACTGTCGCCGTG Gene: Sama_1423: Succinate dehydrogenase cytochrome b-556 subunit |
Gene: Shew_1651: Succinate dehydrogenase cytochrome b-556 subunit |
*
Shewanella pealeana ATCC 700345 Site: position = -86 score = 4.38802 sequence = AACCGTGATCTGGATCACTGAT Gene: Spea_1784: Succinate dehydrogenase cytochrome b-556 subunit |
*
Shewanella halifaxensis HAW-EB4 Site: position = -86 score = 4.86045 sequence = ATCTGTGATCTGGATCACCGAT Gene: Shal_2493: Succinate dehydrogenase cytochrome b-556 subunit |
*
Shewanella piezotolerans WP3 Site: position = -20 score = 4.63605 sequence = AACTGTGACCTAGTTCACGGAT Gene: swp_2955: Succinate dehydrogenase cytochrome b-556 subunit |
*
Shewanella sediminis HAW-EB3 Site: position = -86 score = 4.19352 sequence = GATCGTGACCTGTGTCACAGTT Gene: Ssed_2818: Succinate dehydrogenase cytochrome b-556 subunit |
*
Shewanella woodyi ATCC 51908 Site: position = -87 score = 4.81834 sequence = ATTTGTGATCTAAATCACGCCT Gene: Swoo_1833: Succinate dehydrogenase cytochrome b-556 subunit |
Succinate dehydrogenase cytochrome b-556 subunit |
| SO1927.1 |
Gene: SO1927.1: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Sputcn32_2272: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Sputw3181_1736: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Shewana3_1707: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Shewmr4_1632: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Shewmr7_1707: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Sbal_2518: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Sden_2186: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Sfri_2346: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Sama_1424: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Shew_1652: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Spea_1785: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Shal_2492: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: swp_2953: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Ssed_2817: Succinate dehydrogenase hydrophobic membrane anchor protein |
Gene: Swoo_1834: Succinate dehydrogenase hydrophobic membrane anchor protein |
Succinate dehydrogenase hydrophobic membrane anchor protein |
| sdhA |
Gene: SO1928: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Sputcn32_2271: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Sputw3181_1737: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shewana3_1708: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shewmr4_1633: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shewmr7_1708: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Sbal_2517: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Sden_2185: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Sfri_2345: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Sama_1425: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shew_1653: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Spea_1786: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shal_2491: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: swp_2952: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Ssed_2816: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Swoo_1835: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
| sdhB |
Gene: SO1929: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Sputcn32_2270: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Sputw3181_1738: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shewana3_1709: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shewmr4_1634: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shewmr7_1709: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Sbal_2516: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Sden_2184: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Sfri_2344: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Sama_1426: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shew_1654: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Spea_1787: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shal_2490: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: swp_2950: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Ssed_2815: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Swoo_1836: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
| sucA |
Gene: SO1930: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: Sputcn32_2269: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: Sputw3181_1739: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: Shewana3_1710: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: Shewmr4_1635: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: Shewmr7_1710: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: Sbal_2515: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: Sden_2183: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -19 score = 3.6868 sequence = AAGTTTGAAAGGAATAACAATG Site: position = -74 score = 4.07765 sequence = ACGTGTGATGTAACTTACGTTA Gene: Sfri_2343: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: Sama_1427: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: Shew_1655: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: Spea_1788: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: Shal_2489: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: swp_2949: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: Ssed_2814: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
Gene: Swoo_1837: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) |
| sucB |
Gene: SO1931: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Sputcn32_2268: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Sputw3181_1740: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Shewana3_1711: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Shewmr4_1636: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Shewmr7_1711: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Sbal_2514: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Sden_2182: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Sfri_2342: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Sama_1428: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Shew_1656: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Spea_1789: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Shal_2488: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: swp_2948: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Ssed_2813: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
Gene: Swoo_1838: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
| sucC |
Gene: SO1932: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Sputcn32_2267: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Sputw3181_1741: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Shewana3_1712: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Shewmr4_1637: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Shewmr7_1712: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Sbal_2513: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Sden_2181: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Sfri_2341: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Sama_1429: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Shew_1657: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Spea_1790: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Shal_2487: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: swp_2947: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Ssed_2812: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
Gene: Swoo_1839: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) |
| sucD |
Gene: SO1933: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Sputcn32_2266: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Sputw3181_1742: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Shewana3_1713: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Shewmr4_1638: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Shewmr7_1713: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Sbal_2512: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Sden_2180: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Sfri_2340: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Sama_1430: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Shew_1658: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Spea_1791: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Shal_2486: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: swp_2946: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Ssed_2811: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
Gene: Swoo_1840: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) |
| CRON 175. | |||||||||||||||||
| SO2637 |
Gene: SO2637: hypothetical protein |
Gene: Sputcn32_2237: hypothetical protein |
Gene: Sputw3181_1772: hypothetical protein |
Gene: Shewana3_1743: hypothetical protein |
Gene: Shewmr4_1599: hypothetical protein |
Gene: Shewmr7_1674: hypothetical protein |
Gene: Sbal_2482: hypothetical protein |
Gene: Sden_1824: hypothetical protein |
Gene: Sfri_2264: hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -139 score = 4.00755 sequence = ATTTGTGATCACTGTGGCAATT Gene: Sama_2066: hypothetical protein |
*
Shewanella loihica PV-4 Site: position = -132 score = 4.22114 sequence = AATTGTGATCGGCGTGGCAATT Gene: Shew_1556: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -138 score = 4.34915 sequence = ATTTGTGATTTGTCTGGCAATT Gene: Spea_2542: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -140 score = 4.08386 sequence = ATTTGTGAACTATCTGGCAATT Gene: Shal_1712: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -143 score = 4.28576 sequence = ATTTGTGATCCATGTGGCAATT Gene: swp_1858: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -136 score = 4.37326 sequence = AATTGTGATCTGCGTGGCAATT Gene: Ssed_1878: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -136 score = 4.38577 sequence = AATTGTGATCTGTGTGGCAATT Gene: Swoo_2709: hypothetical protein |
hypothetical protein |
| CRON 176. | |||||||||||||||||
| SO3395 |
*
Shewanella oneidensis MR-1 Site: position = -257 score = 4.14724 sequence = AGATGTGATCGGTTGCGCGAAT Gene: SO3395: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -259 score = 3.70819 sequence = AAACGTGATCAGTTACCCGTAA Gene: Sputcn32_2722: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -259 score = 3.70819 sequence = AAACGTGATCAGTTACCCGTAA Gene: Sputw3181_1290: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -261 score = 4.16867 sequence = AGTTGTGATCTTTGGCGCGTAT Gene: Shewana3_1157: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -261 score = 4.16867 sequence = AGTTGTGATCTTTGGCGCGTAT Gene: Shewmr4_1156: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -260 score = 4.15394 sequence = ACTTGTGATCTTTAGCGCGTAT Gene: Shewmr7_1227: hypothetical protein |
Gene: Sbal_1247: hypothetical protein |
Gene: Sden_1228: hypothetical protein |
Gene: Sfri_1087: hypothetical protein |
Gene: Sama_2409: hypothetical protein |
|
|
|
|
|
|
hypothetical protein |
| CRON 177. | |||||||||||||||||
| bfd |
Gene: SO0583: bacterioferritin-associated ferredoxin |
*
Shewanella putrefaciens CN-32 Site: position = -125 score = 4.00529 sequence = AAATGTGCGCAGAGTAACAAAT Gene: Sputcn32_3295: bacterioferritin-associated ferredoxin |
*
Shewanella sp W3-18-1 Site: position = -125 score = 4.00529 sequence = AAATGTGCGCAGAGTAACAAAT Gene: Sputw3181_0646: bacterioferritin-associated ferredoxin |
*
Shewanella sp ANA-3 Site: position = -113 score = 4.11412 sequence = AAATGTGCGATGAGTAACAAAA Gene: Shewana3_0581: bacterioferritin-associated ferredoxin |
*
Shewanella sp MR-4 Site: position = -113 score = 4.11412 sequence = AAATGTGCGATGAGTAACAAAA Gene: Shewmr4_0582: bacterioferritin-associated ferredoxin |
*
Shewanella sp MR-7 Site: position = -113 score = 4.11412 sequence = AAATGTGCGATGAGTAACAAAA Gene: Shewmr7_3448: bacterioferritin-associated ferredoxin |
*
Shewanella baltica OS155 Site: position = -113 score = 3.87979 sequence = AAACGTGCGCCATGTAACAAAA Gene: Sbal_0542: bacterioferritin-associated ferredoxin |
Gene: Sden_3217: bacterioferritin-associated ferredoxin |
*
Shewanella frigidimarina NCIMB 400 Site: position = -275 score = 3.94663 sequence = TAATCTGATCCGGCTAACACCT Site: position = -253 score = 3.82151 sequence = AATATTAACCGCTTTCACAAAT Gene: Sfri_3324: bacterioferritin-associated ferredoxin |
*
Shewanella amazonensis SB2B Site: position = -99 score = 4.14281 sequence = AAGTGAGAAATAGCTCACCTAT Gene: Sama_3040: bacterioferritin-associated ferredoxin |
|
*
Shewanella pealeana ATCC 700345 Site: position = -98 score = 3.91933 sequence = TTAGGCGATCCGACTAACAATT Gene: Spea_3555: bacterioferritin-associated ferredoxin |
Gene: Shal_3649: bacterioferritin-associated ferredoxin |
Gene: swp_0771: bacterioferritin-associated ferredoxin |
|
|
bacterioferritin-associated ferredoxin |
| CRON 178. | |||||||||||||||||
| pilZ |
|
|
|
|
|
|
|
|
|
|
Gene: Shew_3582: type IV pilus assembly PilZ |
*
Shewanella pealeana ATCC 700345 Site: position = -129 score = 5.24449 sequence = AATTGTGATGAAAATCAAATTA Gene: Spea_3949: type IV pilus assembly PilZ |
*
Shewanella halifaxensis HAW-EB4 Site: position = -195 score = 4.29555 sequence = ATATTTGCTAGACATCACATTG Site: position = -141 score = 4.95713 sequence = ATTCGTGATGGAAATCAAATTA Gene: Shal_0318: type IV pilus assembly PilZ |
*
Shewanella piezotolerans WP3 Site: position = -217 score = 4.37999 sequence = ATTCGTGCTGAAAATCAAATTT Gene: swp_4772: type IV pilus assembly PilZ |
Gene: Ssed_0260: type IV pilus assembly PilZ |
Gene: Swoo_2266: type IV pilus assembly PilZ |
type IV pilus assembly PilZ |
| CRON 179. | |||||||||||||||||
| SO1482 |
Gene: SO1482: tonB-dependent receptor, putative |
Gene: Sputcn32_1237: tonB-dependent receptor, putative |
Gene: Sputw3181_2867: tonB-dependent receptor, putative |
Gene: Shewana3_2944: tonB-dependent receptor, putative |
Gene: Shewmr4_2768: tonB-dependent receptor, putative |
Gene: Shewmr7_2846: tonB-dependent receptor, putative |
Gene: Sbal_1315: tonB-dependent receptor, putative |
Gene: Sden_1445: tonB-dependent receptor, putative |
*
Shewanella frigidimarina NCIMB 400 Site: position = -90 score = 3.95447 sequence = TTTTTTGCCACATATAACAAAA Gene: Sfri_2440: tonB-dependent receptor, putative |
|
Gene: Shew_2690: tonB-dependent receptor, putative |
*
Shewanella pealeana ATCC 700345 Site: position = -193 score = 5.19026 sequence = TTTTGTGATCTTCGTCACCTAT Gene: Spea_2930: tonB-dependent receptor, putative |
*
Shewanella halifaxensis HAW-EB4 Site: position = -193 score = 5.19944 sequence = ATTTGTGACGTTGATCACCTAT Gene: Shal_3021: tonB-dependent receptor, putative |
*
Shewanella piezotolerans WP3 Site: position = -184 score = 4.37772 sequence = AACTGTGATCTCTATCACCGAC Gene: swp_3568: tonB-dependent receptor, putative |
Gene: Ssed_3242: tonB-dependent receptor, putative |
Gene: Swoo_3375: tonB-dependent receptor, putative |
tonB-dependent receptor, putative |
| CRON 180. | |||||||||||||||||
| Spea_3654 |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -101 score = 4.8692 sequence = ATTTGTGATCTTGATTGCAAAT Gene: Spea_3654: histidinol-phosphate aminotransferase (EC 2.6.1.9) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -101 score = 4.29336 sequence = AAGTGTGATCTTGGCTACAAAT Gene: Shal_3744: histidinol-phosphate aminotransferase (EC 2.6.1.9) |
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -98 score = 4.21942 sequence = TTATGTGAACAACAGCTCAAAA Gene: Swoo_4751: histidinol-phosphate aminotransferase (EC 2.6.1.9) |
histidinol-phosphate aminotransferase (EC 2.6.1.9) |
| CRON 181. | |||||||||||||||||
| Swoo_4104 |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -261 score = 4.61942 sequence = ATATGGGAGTTGTATCACATTT Gene: Spea_4071: choline-glycine betaine transporter |
*
Shewanella halifaxensis HAW-EB4 Site: position = -261 score = 4.75386 sequence = ATGTGAGATTTGCATCACAATT Gene: Shal_0189: choline-glycine betaine transporter |
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -268 score = 4.18425 sequence = TAATCAGACGTGCATCACATTT Gene: Swoo_4104: choline-glycine betaine transporter |
choline-glycine betaine transporter |
| CRON 182. | |||||||||||||||||
| SO2586 |
*
Shewanella oneidensis MR-1 Site: position = -177 score = 4.07914 sequence = GTTAGTGATAGCGATCACAAAC Gene: SO2586: inactive homolog of metal-dependent proteases, putative molecular chaperone |
*
Shewanella putrefaciens CN-32 Site: position = -269 score = 4.72632 sequence = TTAAGTGACTTATATCACATTG Gene: Sputcn32_1756: inactive homolog of metal-dependent proteases, putative molecular chaperone |
*
Shewanella sp W3-18-1 Site: position = -269 score = 4.72632 sequence = TTAAGTGACTTATATCACATTG Gene: Sputw3181_2269: inactive homolog of metal-dependent proteases, putative molecular chaperone |
*
Shewanella sp ANA-3 Site: position = -176 score = 4.15281 sequence = GTTAGTGATGGCGATCACAAAC Gene: Shewana3_2391: inactive homolog of metal-dependent proteases, putative molecular chaperone |
*
Shewanella sp MR-4 Site: position = -177 score = 4.15281 sequence = GTTAGTGATGGCGATCACAAAC Gene: Shewmr4_2182: inactive homolog of metal-dependent proteases, putative molecular chaperone |
*
Shewanella sp MR-7 Site: position = -178 score = 4.15281 sequence = GTTAGTGATGGCGATCACAAAC Gene: Shewmr7_2259: inactive homolog of metal-dependent proteases, putative molecular chaperone |
*
Shewanella baltica OS155 Site: position = -205 score = 4.28645 sequence = ATCATTGACTTAGATCACATAA Gene: Sbal_1859: inactive homolog of metal-dependent proteases, putative molecular chaperone |
Gene: Sden_1620: inactive homolog of metal-dependent proteases, putative molecular chaperone |
Gene: Sfri_1728: inactive homolog of metal-dependent proteases, putative molecular chaperone |
Gene: Sama_1939: inactive homolog of metal-dependent proteases, putative molecular chaperone |
Gene: Shew_2193: inactive homolog of metal-dependent proteases, putative molecular chaperone |
Gene: Spea_2453: inactive homolog of metal-dependent proteases, putative molecular chaperone |
Gene: Shal_1827: inactive homolog of metal-dependent proteases, putative molecular chaperone |
Gene: swp_2284: inactive homolog of metal-dependent proteases, putative molecular chaperone |
Gene: Ssed_2528: inactive homolog of metal-dependent proteases, putative molecular chaperone |
Gene: Swoo_2105: inactive homolog of metal-dependent proteases, putative molecular chaperone |
inactive homolog of metal-dependent proteases, putative molecular chaperone |
| SO2585 |
Gene: SO2585: hypothetical protein |
Gene: Sputcn32_1757: hypothetical protein |
Gene: Sputw3181_2268: hypothetical protein |
Gene: Shewana3_2390: hypothetical protein |
Gene: Shewmr4_2181: hypothetical protein |
Gene: Shewmr7_2258: hypothetical protein |
Gene: Sbal_1860: hypothetical protein |
Gene: Sden_1621: hypothetical protein |
Gene: Sfri_1729: hypothetical protein |
Gene: Sama_1938: hypothetical protein |
Gene: Shew_2192: hypothetical protein |
Gene: Spea_2452: hypothetical protein |
Gene: Shal_1828: hypothetical protein |
Gene: swp_2285: hypothetical protein |
Gene: Ssed_2527: hypothetical protein |
Gene: Swoo_2106: hypothetical protein |
hypothetical protein |
| SO2584 |
Gene: SO2584: Tlr1621 protein |
Gene: Sputcn32_1758: Tlr1621 protein |
Gene: Sputw3181_2267: Tlr1621 protein |
Gene: Shewana3_2389: Tlr1621 protein |
Gene: Shewmr4_2180: Tlr1621 protein |
Gene: Shewmr7_2257: Tlr1621 protein |
Gene: Sbal_1861: Tlr1621 protein |
Gene: Sden_1622: Tlr1621 protein |
Gene: Sfri_1730: Tlr1621 protein |
Gene: Sama_1937: Tlr1621 protein |
Gene: Shew_2191: Tlr1621 protein |
Gene: Spea_2451: Tlr1621 protein |
Gene: Shal_1829: Tlr1621 protein |
Gene: swp_2286: Tlr1621 protein |
Gene: Ssed_2526: Tlr1621 protein |
Gene: Swoo_2107: Tlr1621 protein |
Tlr1621 protein |
| CRON 183. | |||||||||||||||||
| SO3588 |
Gene: SO3588: gpr1/fun34/yaaH family protein |
*
Shewanella putrefaciens CN-32 Site: position = -312 score = 4.11986 sequence = AATTTTGAACCAATGCAAATAT Site: position = -44 score = 4.31151 sequence = TATTTTGATTTTAATCAATTTA Gene: Sputcn32_1014: gpr1/fun34/yaaH family protein |
*
Shewanella sp W3-18-1 Site: position = -44 score = 4.31151 sequence = TATTTTGATTTTAATCAATTTA Site: position = -312 score = 4.11986 sequence = AATTTTGAACCAATGCAAATAT Gene: Sputw3181_3151: gpr1/fun34/yaaH family protein |
*
Shewanella sp ANA-3 Site: position = -117 score = 4.17388 sequence = TATTTTGATTGTGATCTCTTTA Gene: Shewana3_3180: gpr1/fun34/yaaH family protein |
*
Shewanella sp MR-4 Site: position = -292 score = 3.79367 sequence = AAGTTTGAACCTTAGCAAAATT Gene: Shewmr4_3002: gpr1/fun34/yaaH family protein |
*
Shewanella sp MR-7 Site: position = -292 score = 3.79367 sequence = AAGTTTGAACCTTAGCAAAATT Gene: Shewmr7_3083: gpr1/fun34/yaaH family protein |
Gene: Sbal_1006: gpr1/fun34/yaaH family protein |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -313 score = 3.79207 sequence = TTTTGAGACTTATCACACCAAT Gene: Sfri_3630: gpr1/fun34/yaaH family protein |
Gene: Sama_0695: gpr1/fun34/yaaH family protein |
*
Shewanella loihica PV-4 Site: position = -97 score = 4.3868 sequence = TATTGTGATGCCCTTAAGACTT Gene: Shew_0904: gpr1/fun34/yaaH family protein |
*
Shewanella pealeana ATCC 700345 Site: position = -246 score = 3.79655 sequence = TGGCGTGACGTGTGTCACTCTT Gene: Spea_0890: gpr1/fun34/yaaH family protein |
Gene: Shal_0942: gpr1/fun34/yaaH family protein |
Gene: swp_0897: gpr1/fun34/yaaH family protein |
Gene: Ssed_0999: gpr1/fun34/yaaH family protein |
*
Shewanella woodyi ATCC 51908 Site: position = -309 score = 3.88454 sequence = TTGTGTGATAAGGGTCTTGTTT Site: position = -206 score = 3.861 sequence = TTATGTGATGAATGATTCATTT Gene: Swoo_1050: gpr1/fun34/yaaH family protein |
gpr1/fun34/yaaH family protein |
| CRON 184. | |||||||||||||||||
| Shewana3_3924 |
|
|
|
*
Shewanella sp ANA-3 Site: position = -304 score = 4.72392 sequence = TTTTGCGATCTGCCTCACAATC Gene: Shewana3_3924: methyl-accepting chemotaxis protein |
*
Shewanella sp MR-4 Site: position = -304 score = 4.63478 sequence = TTTTGCGATCCGCCTCACAATC Gene: Shewmr4_3728: methyl-accepting chemotaxis protein |
*
Shewanella sp MR-7 Site: position = -304 score = 4.63478 sequence = TTTTGCGATCCGCCTCACAATC Gene: Shewmr7_3799: methyl-accepting chemotaxis protein |
|
|
|
|
|
|
|
|
|
|
methyl-accepting chemotaxis protein |
| CRON 185. | |||||||||||||||||
| SO1603 |
Gene: SO1603: putative transcriptional regulator, inferred for PFA pathway |
Gene: Sputcn32_1327: putative transcriptional regulator, inferred for PFA pathway |
Gene: Sputw3181_2776: putative transcriptional regulator, inferred for PFA pathway |
Gene: Shewana3_2839: putative transcriptional regulator, inferred for PFA pathway |
Gene: Shewmr4_2665: putative transcriptional regulator, inferred for PFA pathway |
Gene: Shewmr7_2732: putative transcriptional regulator, inferred for PFA pathway |
Gene: Sbal_1426: putative transcriptional regulator, inferred for PFA pathway |
Gene: Sden_2626: putative transcriptional regulator, inferred for PFA pathway |
Gene: Sfri_1222: putative transcriptional regulator, inferred for PFA pathway |
Gene: Sama_1116: putative transcriptional regulator, inferred for PFA pathway |
Gene: Shew_2664: putative transcriptional regulator, inferred for PFA pathway |
*
Shewanella pealeana ATCC 700345 Site: position = -269 score = 3.94269 sequence = AAGCAAGATTTAGATCACACTT Gene: Spea_2906: putative transcriptional regulator, inferred for PFA pathway |
*
Shewanella halifaxensis HAW-EB4 Site: position = -265 score = 4.18363 sequence = ATGTTTGAGCTAGATCACTCTT Gene: Shal_3007: putative transcriptional regulator, inferred for PFA pathway |
*
Shewanella piezotolerans WP3 Site: position = -268 score = 4.51561 sequence = ATATTAGATCTAAATCACACTT Site: position = -238 score = 3.86477 sequence = TAACGTTAGTTACCACACAAAA Gene: swp_3549: putative transcriptional regulator, inferred for PFA pathway |
*
Shewanella sediminis HAW-EB3 Site: position = -267 score = 4.64751 sequence = TTATTTGACCTGGATCACGCTT Gene: Ssed_3201: putative transcriptional regulator, inferred for PFA pathway |
*
Shewanella woodyi ATCC 51908 Site: position = -228 score = 4.00694 sequence = AAATGAAACATCTATCACACAT Gene: Swoo_1424: putative transcriptional regulator, inferred for PFA pathway |
putative transcriptional regulator, inferred for PFA pathway |
| SO1602 |
Gene: SO1602: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Sputcn32_1326: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Sputw3181_2777: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Shewana3_2840: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Shewmr4_2666: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Shewmr7_2733: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Sbal_1425: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Sden_2627: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Sfri_1221: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Sama_1115: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Shew_2665: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Spea_2907: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Shal_3008: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: swp_3550: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Ssed_3202: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
Gene: Swoo_1423: omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
omega-3 polyunsaturated fatty acid synthase subunit, PfaA |
| Sputcn32_1325 |
|
Gene: Sputcn32_1325: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: Sputw3181_2778: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: Shewana3_2841: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: Shewmr4_2667: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: Shewmr7_2734: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: Sbal_1424: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: Sden_2628: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: Sfri_1220: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: Sama_1114: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: Shew_2666: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: Spea_2908: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: Shal_3009: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: swp_3551: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: Ssed_3203: omega-3 polyunsaturated fatty acid synthase PfaB |
Gene: Swoo_1422: omega-3 polyunsaturated fatty acid synthase PfaB |
omega-3 polyunsaturated fatty acid synthase PfaB |
| SO1599 |
Gene: SO1599: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Sputcn32_1324: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Sputw3181_2779: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Shewana3_2842: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Shewmr4_2668: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Shewmr7_2735: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Sbal_1423: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Sden_2629: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Sfri_1219: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Sama_1113: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Shew_2667: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Spea_2909: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Shal_3010: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: swp_3553: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Ssed_3204: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
Gene: Swoo_1421: omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
omega-3 polyunsaturated fatty acid synthase subunit, PfaC |
| SO1597 |
Gene: SO1597: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Sputcn32_1323: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Sputw3181_2780: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Shewana3_2843: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Shewmr4_2669: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Shewmr7_2736: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Sbal_1422: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Sden_2630: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Sfri_1218: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Sama_1112: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Shew_2668: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Spea_2910: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Shal_3011: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: swp_3554: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Ssed_3205: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
Gene: Swoo_1420: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway |
| CRON 186. | |||||||||||||||||
| chaA |
*
Shewanella oneidensis MR-1 Site: position = -118 score = 4.64998 sequence = AAAAGTGATCAAGCTCAAACAT Gene: SO1001: calcium/proton antiporter |
Gene: Sputcn32_0910: calcium/proton antiporter |
Gene: Sputw3181_3262: calcium/proton antiporter |
*
Shewanella sp ANA-3 Site: position = -118 score = 4.31885 sequence = AAAAGCGATCTCGCTCAAAAAT Gene: Shewana3_3290: calcium/proton antiporter |
|
|
*
Shewanella baltica OS155 Site: position = -104 score = 4.16141 sequence = TACAGCGATCTAGCTCAAATAT Gene: Sbal_3384: calcium/proton antiporter |
|
|
|
|
|
|
|
|
|
calcium/proton antiporter |
| CRON 187. | |||||||||||||||||
| kefA |
|
*
Shewanella putrefaciens CN-32 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Sputcn32_0539: mechanosensitive ion channel |
*
Shewanella sp W3-18-1 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Sputw3181_3633: mechanosensitive ion channel |
*
Shewanella sp ANA-3 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Shewana3_3684: mechanosensitive ion channel |
*
Shewanella sp MR-4 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Shewmr4_3509: mechanosensitive ion channel |
*
Shewanella sp MR-7 Site: position = -94 score = 4.27992 sequence = TTACATGATACGCTTCACAATG Gene: Shewmr7_0443: mechanosensitive ion channel |
*
Shewanella baltica OS155 Site: position = -95 score = 4.50296 sequence = TTACATGATACGCTTCACACAT Gene: Sbal_3856: mechanosensitive ion channel |
|
Gene: Sfri_3406: mechanosensitive ion channel |
Gene: Sama_0408: mechanosensitive ion channel |
*
Shewanella loihica PV-4 Site: position = -144 score = 4.10197 sequence = TTGCTTGATATGCTTCACGCTA Gene: Shew_3394: mechanosensitive ion channel |
*
Shewanella pealeana ATCC 700345 Site: position = -138 score = 4.08475 sequence = AAGCTTGATCCTCTTCACGCTA Gene: Spea_0457: mechanosensitive ion channel |
*
Shewanella halifaxensis HAW-EB4 Site: position = -137 score = 3.96946 sequence = AAGCATGATCCCCTTCACGCTA Gene: Shal_0532: mechanosensitive ion channel |
Gene: swp_4706: mechanosensitive ion channel |
*
Shewanella sediminis HAW-EB3 Site: position = -154 score = 4.16207 sequence = ATTCATGATCCACTTCACCTAG Gene: Ssed_0457: mechanosensitive ion channel |
*
Shewanella woodyi ATCC 51908 Site: position = -127 score = 3.85254 sequence = ATTCATGATCCTCTTCACGCAG Gene: Swoo_4512: mechanosensitive ion channel |
mechanosensitive ion channel |
| CRON 188. | |||||||||||||||||
| Sama_2599 |
|
|
|
|
*
Shewanella sp MR-4 Site: position = -86 score = 4.60595 sequence = TGCTTTGATTTACATCACAATT Gene: Shewmr4_1948: putative lipoprotein |
*
Shewanella sp MR-7 Site: position = -86 score = 4.60595 sequence = TGCTTTGATTTACATCACAATT Gene: Shewmr7_2028: putative lipoprotein |
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -77 score = 4.0375 sequence = TTTGTTGATGTTGATCAAATTC Gene: Sfri_3610: putative lipoprotein |
*
Shewanella amazonensis SB2B Site: position = -87 score = 4.19856 sequence = CTGCTTGATGAGGATCACAATT Gene: Sama_2599: putative lipoprotein |
*
Shewanella loihica PV-4 Site: position = -117 score = 3.73395 sequence = AAGCGTTAGCCCACTCACAAAG Gene: Shew_3086: putative lipoprotein |
|
|
|
Gene: Ssed_2168: putative lipoprotein |
|
putative lipoprotein |
| CRON 189. | |||||||||||||||||
| hemB-1 |
*
Shewanella oneidensis MR-1 Site: position = -197 score = 4.00015 sequence = GTTTGTGATCGCTATCACTAAC Gene: SO2587: porphobilinogen synthase (EC 4.2.1.24) |
*
Shewanella putrefaciens CN-32 Site: position = -144 score = 4.59728 sequence = CAATGTGATATAAGTCACTTAA Gene: Sputcn32_1755: porphobilinogen synthase (EC 4.2.1.24) |
*
Shewanella sp W3-18-1 Site: position = -144 score = 4.59728 sequence = CAATGTGATATAAGTCACTTAA Gene: Sputw3181_2270: porphobilinogen synthase (EC 4.2.1.24) |
*
Shewanella sp ANA-3 Site: position = -222 score = 3.98764 sequence = GTTTGTGATCGCCATCACTAAC Gene: Shewana3_2392: porphobilinogen synthase (EC 4.2.1.24) |
*
Shewanella sp MR-4 Site: position = -217 score = 3.98764 sequence = GTTTGTGATCGCCATCACTAAC Gene: Shewmr4_2183: porphobilinogen synthase (EC 4.2.1.24) |
*
Shewanella sp MR-7 Site: position = -193 score = 3.98764 sequence = GTTTGTGATCGCCATCACTAAC Gene: Shewmr7_2260: porphobilinogen synthase (EC 4.2.1.24) |
*
Shewanella baltica OS155 Site: position = -168 score = 4.40512 sequence = TTATGTGATCTAAGTCAATGAT Gene: Sbal_1858: porphobilinogen synthase (EC 4.2.1.24) |
Gene: Sden_0303: porphobilinogen synthase (EC 4.2.1.24) |
|
|
|
|
|
|
|
|
porphobilinogen synthase (EC 4.2.1.24) |
| CRON 190. | |||||||||||||||||
| purT |
*
Shewanella oneidensis MR-1 Site: position = -161 score = 3.83034 sequence = TAGCTTGATCAAAAACACAGTT Gene: SO3613: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
*
Shewanella putrefaciens CN-32 Site: position = -119 score = 3.83034 sequence = TAGCTTGATCAAAAACACAGTT Gene: Sputcn32_1001: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
*
Shewanella sp W3-18-1 Site: position = -119 score = 3.83034 sequence = TAGCTTGATCAAAAACACAGTT Gene: Sputw3181_3164: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
*
Shewanella sp ANA-3 Site: position = -121 score = 3.91854 sequence = TAGCTTGATCGAAAACACAGTT Gene: Shewana3_3197: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
*
Shewanella sp MR-4 Site: position = -121 score = 3.91854 sequence = TAGCTTGATCGAAAACACAGTT Gene: Shewmr4_3020: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
*
Shewanella sp MR-7 Site: position = -121 score = 3.91854 sequence = TAGCTTGATCGAAAACACAGTT Gene: Shewmr7_3101: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
Gene: Sbal_0989: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
|
Gene: Sfri_3070: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
Gene: Sama_2807: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
|
*
Shewanella pealeana ATCC 700345 Site: position = -176 score = 4.37777 sequence = AAGAGTGATCTCGCCCACACTT Gene: Spea_0871: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -169 score = 4.45412 sequence = AGTAGTGATCTCGTGCACACAT Gene: Shal_0924: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
*
Shewanella piezotolerans WP3 Site: position = -147 score = 4.06757 sequence = CAGCGTGATCTGCCGCACGTTT Gene: swp_4077: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
*
Shewanella sediminis HAW-EB3 Site: position = -160 score = 4.58841 sequence = TAAAGTGATCCACTACACACTT Gene: Ssed_0973: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
|
phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-) |
| CRON 191. | |||||||||||||||||
| SO3541 |
Gene: SO3541: sodium:alanine symporter family protein |
Gene: Sputcn32_1052: sodium:alanine symporter family protein |
Gene: Sputw3181_3113: sodium:alanine symporter family protein |
Gene: Shewana3_3144: sodium:alanine symporter family protein |
Gene: Shewmr4_2964: sodium:alanine symporter family protein |
Gene: Shewmr7_3046: sodium:alanine symporter family protein |
*
Shewanella baltica OS155 Site: position = -220 score = 3.86294 sequence = AAACGCGAGCTTGATCACATGA Gene: Sbal_1047: sodium:alanine symporter family protein |
*
Shewanella denitrificans OS217 Site: position = -140 score = 4.57 sequence = TAATGTGAACTGGATCACTAAG Gene: Sden_2730: sodium:alanine symporter family protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -306 score = 4.23116 sequence = AAGTGTGATGGATATCACTTGT Gene: Sfri_2897: sodium:alanine symporter family protein |
Gene: Sama_0916: sodium:alanine symporter family protein |
*
Shewanella loihica PV-4 Site: position = -210 score = 4.41975 sequence = AACTGTGATCTGTATCACATGG Gene: Shew_1092: sodium:alanine symporter family protein |
*
Shewanella pealeana ATCC 700345 Site: position = -207 score = 4.09818 sequence = AACTGTGATCTATATCGCTCAG Gene: Spea_1077: sodium:alanine symporter family protein |
Gene: Shal_1125: sodium:alanine symporter family protein |
*
Shewanella piezotolerans WP3 Site: position = -210 score = 4.52918 sequence = ATGTGTGATCTGTATCACTCAG Gene: swp_3737: sodium:alanine symporter family protein |
*
Shewanella sediminis HAW-EB3 Site: position = -214 score = 4.19013 sequence = AACTGTGATCTGCGTCACATGG Gene: Ssed_1187: sodium:alanine symporter family protein |
*
Shewanella woodyi ATCC 51908 Site: position = -215 score = 4.18982 sequence = AAGTGTGATCGTGATCACGCGA Gene: Swoo_1283: sodium:alanine symporter family protein |
sodium:alanine symporter family protein |
| CRON 192. | |||||||||||||||||
| mtrF |
Gene: SO1659: decaheme cytochrome c MtrF |
*
Shewanella putrefaciens CN-32 Site: position = -201 score = 4.54314 sequence = ATTTGCAATATTCATCACATTT Gene: Sputcn32_1380: decaheme cytochrome c MtrF |
*
Shewanella sp W3-18-1 Site: position = -201 score = 4.54314 sequence = ATTTGCAATATTCATCACATTT Gene: Sputw3181_2721: decaheme cytochrome c MtrF |
*
Shewanella sp ANA-3 Site: position = -201 score = 3.91075 sequence = ATCTGCGAGATACCTCATATAT Gene: Shewana3_2787: decaheme cytochrome c MtrF |
*
Shewanella sp MR-4 Site: position = -202 score = 4.01513 sequence = ATTTGTTACCCACCTCTTATTT Gene: Shewmr4_2613: decaheme cytochrome c MtrF |
*
Shewanella sp MR-7 Site: position = -202 score = 4.01513 sequence = ATTTGTTACCCACCTCTTATTT Gene: Shewmr7_2680: decaheme cytochrome c MtrF |
*
Shewanella baltica OS155 Site: position = -202 score = 4.11236 sequence = AATTGTGATGCTCATCATGGCT Gene: Sbal_1478: decaheme cytochrome c MtrF |
|
Gene: Sfri_0913: decaheme cytochrome c MtrF |
Gene: Sama_2228: decaheme cytochrome c MtrF |
Gene: Shew_0918: decaheme cytochrome c MtrF |
|
|
Gene: swp_0896: decaheme cytochrome c MtrF |
Gene: Ssed_0998: decaheme cytochrome c MtrF |
|
decaheme cytochrome c MtrF |
| CRON 193. | |||||||||||||||||
| etfB |
Gene: SO3145: electron transfer flavoprotein, beta subunit |
Gene: Sputcn32_2511: electron transfer flavoprotein, beta subunit |
Gene: Sputw3181_1497: electron transfer flavoprotein, beta subunit |
Gene: Shewana3_1405: electron transfer flavoprotein, beta subunit |
Gene: Shewmr4_1352: electron transfer flavoprotein, beta subunit |
Gene: Shewmr7_1417: electron transfer flavoprotein, beta subunit |
Gene: Sbal_2847: electron transfer flavoprotein, beta subunit |
*
Shewanella denitrificans OS217 Site: position = -175 score = 4.42031 sequence = TCATATGATTTTCATCACACTT Gene: Sden_2539: electron transfer flavoprotein, beta subunit |
*
Shewanella frigidimarina NCIMB 400 Site: position = -153 score = 4.23402 sequence = TAGTTTGATTGCCACCACAATA Gene: Sfri_2748: electron transfer flavoprotein, beta subunit |
Gene: Sama_1169: electron transfer flavoprotein, beta subunit |
Gene: Shew_2584: electron transfer flavoprotein, beta subunit |
*
Shewanella pealeana ATCC 700345 Site: position = -283 score = 4.09097 sequence = TATTTGGATAAGGATCAAATAT Gene: Spea_2855: electron transfer flavoprotein, beta subunit |
Gene: Shal_2945: electron transfer flavoprotein, beta subunit |
*
Shewanella piezotolerans WP3 Site: position = -276 score = 3.72591 sequence = TATTTCAATAAGGATCAAATAT Gene: swp_3472: electron transfer flavoprotein, beta subunit |
Gene: Ssed_1445: electron transfer flavoprotein, beta subunit |
*
Shewanella woodyi ATCC 51908 Site: position = -214 score = 4.52068 sequence = ATTTGTGAATGTACTCATATAT Gene: Swoo_3236: electron transfer flavoprotein, beta subunit |
electron transfer flavoprotein, beta subunit |
| etfA |
Gene: SO3144: electron transfer flavoprotein, alpha subunit |
Gene: Sputcn32_2510: electron transfer flavoprotein, alpha subunit |
Gene: Sputw3181_1498: electron transfer flavoprotein, alpha subunit |
Gene: Shewana3_1406: electron transfer flavoprotein, alpha subunit |
Gene: Shewmr4_1353: electron transfer flavoprotein, alpha subunit |
Gene: Shewmr7_1418: electron transfer flavoprotein, alpha subunit |
Gene: Sbal_2846: electron transfer flavoprotein, alpha subunit |
Gene: Sden_2538: electron transfer flavoprotein, alpha subunit |
Gene: Sfri_2747: electron transfer flavoprotein, alpha subunit |
Gene: Sama_1170: electron transfer flavoprotein, alpha subunit |
Gene: Shew_2583: electron transfer flavoprotein, alpha subunit |
Gene: Spea_2854: electron transfer flavoprotein, alpha subunit |
Gene: Shal_2944: electron transfer flavoprotein, alpha subunit |
Gene: swp_3471: electron transfer flavoprotein, alpha subunit |
Gene: Ssed_1446: electron transfer flavoprotein, alpha subunit |
Gene: Swoo_3235: electron transfer flavoprotein, alpha subunit |
electron transfer flavoprotein, alpha subunit |
| CRON 194. | |||||||||||||||||
| Shewana3_2910 |
|
|
|
*
Shewanella sp ANA-3 Site: position = -280 score = 4.25612 sequence = TTATTAGATGGTCATCACACTT Gene: Shewana3_2910: putative membrane protein |
*
Shewanella sp MR-4 Site: position = -271 score = 4.52178 sequence = TAATGTTAGCCCCCTCACACTT Gene: Shewmr4_2741: putative membrane protein |
*
Shewanella sp MR-7 Site: position = -271 score = 4.53684 sequence = TAATGTTAGCCTCCTCACACTT Gene: Shewmr7_2819: putative membrane protein |
|
|
|
|
|
|
|
|
|
|
putative membrane protein |
| CRON 195. | |||||||||||||||||
| swp_4302 |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -183 score = 4.3681 sequence = AAGCGTGATTGACCACACAAAA Gene: Spea_2293: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -182 score = 4.50678 sequence = AATCGTGATAAACCACACAAAA Gene: Shal_2000: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -180 score = 4.30035 sequence = TTTAGTGATAGAGCACACAGAA Gene: swp_4302: hypothetical protein |
Gene: Ssed_1766: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -185 score = 4.0051 sequence = TTCAGTGATGTAGAACTCAAAA Gene: Swoo_2973: hypothetical protein |
hypothetical protein |
| CRON 196. | |||||||||||||||||
| Sama_3096 |
|
|
|
|
|
|
|
|
|
*
Shewanella amazonensis SB2B Site: position = -197 score = 3.96238 sequence = TAATGGTATTAATATCAAATAT Site: position = -40 score = 3.70402 sequence = AGTCGTTATACTGGCCACAAAA Gene: Sama_3096: Outer membrane lipoprotein omp16 precursor |
|
|
|
|
|
|
Outer membrane lipoprotein omp16 precursor |
| SO3967 |
Gene: SO3967: Molybdenum-binding periplasmic protein |
Gene: Sputcn32_0709: Molybdenum-binding periplasmic protein |
Gene: Sputw3181_3464: Molybdenum-binding periplasmic protein |
*
Shewanella sp ANA-3 Site: position = -125 score = 4.18317 sequence = TTAAGTGATCTTGGCCACAATC Gene: Shewana3_0666: Molybdenum-binding periplasmic protein |
*
Shewanella sp MR-4 Site: position = -125 score = 4.18317 sequence = TTAAGTGATCTTGGCCACAATC Gene: Shewmr4_0667: Molybdenum-binding periplasmic protein |
*
Shewanella sp MR-7 Site: position = -125 score = 4.52577 sequence = TTAAGTGATCTTGGCCACAATA Gene: Shewmr7_3355: Molybdenum-binding periplasmic protein |
*
Shewanella baltica OS155 Site: position = -136 score = 4.00709 sequence = TTGGGTGATCTGCACCACAATC Gene: Sbal_3674: Molybdenum-binding periplasmic protein |
|
|
Gene: Sama_3095: Molybdenum-binding periplasmic protein |
Gene: Shew_2687: Molybdenum-binding periplasmic protein |
Gene: Spea_3623: Molybdenum-binding periplasmic protein |
Gene: Shal_3711: Molybdenum-binding periplasmic protein |
Gene: swp_0671: Molybdenum-binding periplasmic protein |
|
*
Shewanella woodyi ATCC 51908 Site: position = -91 score = 3.80721 sequence = AAGTGTTATAAACATCATTTTA Gene: Swoo_4247: Molybdenum-binding periplasmic protein |
Molybdenum-binding periplasmic protein |
| CRON 197. | |||||||||||||||||
| Sfri_1504 |
|
|
|
|
|
|
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -250 score = 3.96654 sequence = TTACATGATATAGCGCACATCT Site: position = -144 score = 3.85269 sequence = TAATTTGAGATTGTTTATAAAT Gene: Sfri_1504: cytochrome c3 |
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -155 score = 4.47598 sequence = TAATTTGATGGAGCGCACGTTT Gene: Spea_1806: cytochrome c3 |
*
Shewanella halifaxensis HAW-EB4 Site: position = -156 score = 4.5031 sequence = TAATTTGACTGAGCGCACATTT Gene: Shal_2472: cytochrome c3 |
*
Shewanella piezotolerans WP3 Site: position = -184 score = 4.27152 sequence = TAGTTTGATGGAGCGCACGTTT Gene: swp_2923: cytochrome c3 |
|
|
cytochrome c3 |
| CRON 198. | |||||||||||||||||
| swp_4060 |
|
Gene: Sputcn32_3045: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
Gene: Sputw3181_0900: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
*
Shewanella sp ANA-3 Site: position = -204 score = 3.96746 sequence = AAACTTGCATCAGCTCACATAA Gene: Shewana3_0861: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
*
Shewanella sp MR-4 Site: position = -203 score = 3.93689 sequence = AAACTTGCGTCACCTCACATAA Gene: Shewmr4_3074: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
*
Shewanella sp MR-7 Site: position = -204 score = 3.96746 sequence = AAACTTGCATCAGCTCACATAA Gene: Shewmr7_0898: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
Gene: Sbal_3410: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
Gene: Sden_0955: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
*
Shewanella frigidimarina NCIMB 400 Site: position = -251 score = 4.47727 sequence = ATATTTGACCATGTTCAAATAT Gene: Sfri_3189: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
Gene: Sama_2893: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
*
Shewanella loihica PV-4 Site: position = -217 score = 3.99682 sequence = AATAGTGATGAGGTTAATATAG Gene: Shew_0671: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
*2
Shewanella pealeana ATCC 700345 Site: position = -283 score = 4.07042 sequence = TTATGTGCCATGCAACACATTG Gene: Spea_0661: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A Gene: Spea_2290: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
*2
Shewanella halifaxensis HAW-EB4 Site: position = -157 score = 4.31283 sequence = TAATGTGATTTTCAGAATAATT Gene: Shal_2004: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A Site: position = -147 score = 3.86346 sequence = AAATATGAGCTTGTTCCAAATT Gene: Shal_3535: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
*
Shewanella piezotolerans WP3 Site: position = -318 score = 4.32212 sequence = TGAGGTGATGCATATCATAAAA Gene: swp_4060: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
Gene: Ssed_0681: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
Gene: Swoo_0786: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A |
| CRON 199. | |||||||||||||||||
| Spea_3717 |
|
Gene: Sputcn32_3312: hypothetical protein |
Gene: Sputw3181_0629: hypothetical protein |
Gene: Shewana3_0564: hypothetical protein |
Gene: Shewmr4_0565: hypothetical protein |
Gene: Shewmr7_3465: hypothetical protein |
Gene: Sbal_0525: hypothetical protein |
Gene: Sden_0526: hypothetical protein |
Gene: Sfri_3518: hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -38 score = 4.51135 sequence = AAACTTGAGCCGCTTCACAAAT Gene: Sama_3143: hypothetical protein |
Gene: Shew_0446: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -117 score = 4.68675 sequence = TTAGGTGATCTGCTTCACAAAC Gene: Spea_3717: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -117 score = 4.67336 sequence = TTAGGTGATCTGCCTCACAAAG Gene: Shal_3802: hypothetical protein |
|
Gene: Ssed_0615: hypothetical protein |
Gene: Swoo_4335: hypothetical protein |
hypothetical protein |
| omp_Zn |
Gene: SO0564: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Sputcn32_3311: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Sputw3181_0630: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Shewana3_0565: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Shewmr4_0566: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Shewmr7_3464: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Sbal_0526: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Sden_0527: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Sfri_3517: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Sama_3142: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Shew_0447: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Spea_3716: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Shal_3801: zinc-regulated TonB-dependent outer membrane receptor |
Gene: swp_0555: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Ssed_0616: zinc-regulated TonB-dependent outer membrane receptor |
Gene: Swoo_4334: zinc-regulated TonB-dependent outer membrane receptor |
zinc-regulated TonB-dependent outer membrane receptor |
| znuA |
Gene: SO0565: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Sputcn32_3310: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Sputw3181_0631: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Shewana3_0566: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Shewmr4_0567: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Shewmr7_3463: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Sbal_0527: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Sden_0528: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Sfri_3516: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Sama_3141: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Shew_0448: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Spea_3715: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Shal_3800: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: swp_0556: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Ssed_0617: zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Swoo_4333: zinc ABC transporter, periplasmic-binding protein ZnuA |
zinc ABC transporter, periplasmic-binding protein ZnuA |
| znuB |
Gene: SO0566: zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Sputcn32_3309: zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Sputw3181_0632: zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Shewana3_0567: zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Shewmr4_0568: zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Shewmr7_3462: zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Sbal_0528: zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Sden_0529: zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Sfri_3515: zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Sama_3140: zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Shew_0449: zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Spea_3714: zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Shal_3799: zinc ABC transporter, inner membrane permease protein ZnuB |
|
Gene: Ssed_0618: zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Swoo_4332: zinc ABC transporter, inner membrane permease protein ZnuB |
zinc ABC transporter, inner membrane permease protein ZnuB |
| CRON 200. | |||||||||||||||||
| psrA |
Gene: SO4062: polysulfide reductase, subunit A |
|
|
*
Shewanella sp ANA-3 Site: position = -278 score = 3.78911 sequence = TCTATTGATCCTATTCACGAAT Gene: Shewana3_3619: polysulfide reductase, subunit A |
*
Shewanella sp MR-4 Site: position = -273 score = 3.98035 sequence = CTTATTGATCTTATTCACGATT Gene: Shewmr4_3444: polysulfide reductase, subunit A |
*
Shewanella sp MR-7 Site: position = -273 score = 3.98035 sequence = CTTATTGATCTTATTCACGATT Gene: Shewmr7_0507: polysulfide reductase, subunit A |
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -181 score = 3.83561 sequence = AACCGTGACATCAATCAAATCA Gene: Sfri_1999: polysulfide reductase, subunit A |
Gene: Sama_3177: polysulfide reductase, subunit A |
Gene: Shew_0608: polysulfide reductase, subunit A |
*
Shewanella pealeana ATCC 700345 Site: position = -182 score = 4.42046 sequence = AACTGTGAATTGCCTCACAAAC Gene: Spea_3039: polysulfide reductase, subunit A |
*
Shewanella halifaxensis HAW-EB4 Site: position = -183 score = 4.46678 sequence = AACTGTGAATTGCTTCACAAAC Gene: Shal_3127: polysulfide reductase, subunit A |
*
Shewanella piezotolerans WP3 Site: position = -191 score = 4.37518 sequence = AACTGTGAAACAACTCACAAAG Gene: swp_1238: polysulfide reductase, subunit A |
*
Shewanella sediminis HAW-EB3 Site: position = -228 score = 3.92998 sequence = ACATTAGATAAATATCACATTT Gene: Ssed_4047: polysulfide reductase, subunit A |
|
polysulfide reductase, subunit A |
| psrB |
Gene: SO4061: polysulfide reductase, subunit B |
|
|
Gene: Shewana3_3618: polysulfide reductase, subunit B |
Gene: Shewmr4_3443: polysulfide reductase, subunit B |
Gene: Shewmr7_0508: polysulfide reductase, subunit B |
|
|
Gene: Sfri_2000: polysulfide reductase, subunit B |
Gene: Sama_3176: polysulfide reductase, subunit B |
Gene: Shew_0607: polysulfide reductase, subunit B |
Gene: Spea_3038: polysulfide reductase, subunit B |
Gene: Shal_3126: polysulfide reductase, subunit B |
Gene: swp_1239: polysulfide reductase, subunit B |
Gene: Ssed_4046: polysulfide reductase, subunit B |
|
polysulfide reductase, subunit B |
| psrC |
Gene: SO4060: polysulfide reductase, subunit C |
|
|
Gene: Shewana3_3617: polysulfide reductase, subunit C |
Gene: Shewmr4_3442: polysulfide reductase, subunit C |
Gene: Shewmr7_0509: polysulfide reductase, subunit C |
|
|
Gene: Sfri_2001: polysulfide reductase, subunit C |
Gene: Sama_3175: polysulfide reductase, subunit C |
Gene: Shew_0606: polysulfide reductase, subunit C |
Gene: Spea_3037: polysulfide reductase, subunit C |
Gene: Shal_3125: polysulfide reductase, subunit C |
Gene: swp_1240: polysulfide reductase, subunit C |
Gene: Ssed_4045: polysulfide reductase, subunit C |
|
polysulfide reductase, subunit C |
| CRON 201. | |||||||||||||||||
| Sputcn32_1188 |
|
*
Shewanella putrefaciens CN-32 Site: position = -111 score = 4.41571 sequence = AAATGTGACGCAGGTTAAAAAT Gene: Sputcn32_1188: iron-sulfur cluster-binding protein |
*
Shewanella sp W3-18-1 Site: position = -111 score = 4.41571 sequence = AAATGTGACGCAGGTTAAAAAT Gene: Sputw3181_2976: iron-sulfur cluster-binding protein |
|
|
|
Gene: Sbal_3097: iron-sulfur cluster-binding protein |
|
|
|
|
Gene: Spea_0260: iron-sulfur cluster-binding protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -287 score = 4.42346 sequence = TATTGTGACAAGACTCAACTTA Site: position = -110 score = 4.0278 sequence = AATTGTGACCACAATCAATTTG Gene: Shal_0693: iron-sulfur cluster-binding protein |
|
Gene: Ssed_2569: iron-sulfur cluster-binding protein |
|
iron-sulfur cluster-binding protein |
| Sputcn32_1189 |
|
Gene: Sputcn32_1189: hypothetical protein |
Gene: Sputw3181_2975: hypothetical protein |
|
|
|
Gene: Sbal_3096: hypothetical protein |
|
|
|
|
Gene: Spea_0261: hypothetical protein |
Gene: Shal_0692: hypothetical protein |
|
Gene: Ssed_2568: hypothetical protein |
|
hypothetical protein |
| CRON 202. | |||||||||||||||||
| Sfri_4035 |
|
|
|
|
|
|
Gene: Sbal_2014: Conserved hypothetical signal peptide protein |
*
Shewanella denitrificans OS217 Site: position = -116 score = 3.96622 sequence = TTCTTTGATGTTAATCAAGCAT Gene: Sden_0638: Conserved hypothetical signal peptide protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -131 score = 3.84905 sequence = ATATGTGACATACGCATCATAA Gene: Sfri_4035: Conserved hypothetical signal peptide protein |
*
Shewanella amazonensis SB2B Site: position = -108 score = 3.77897 sequence = TTTGTTGATCTGGATCATTAAT Gene: Sama_0589: Conserved hypothetical signal peptide protein |
*
Shewanella loihica PV-4 Site: position = -108 score = 4.21499 sequence = TTTGTTGATCTTAATCAAAAAA Gene: Shew_3120: Conserved hypothetical signal peptide protein |
*
Shewanella pealeana ATCC 700345 Site: position = -106 score = 4.42608 sequence = ATTATTGATCTTTATCAAAAAA Gene: Spea_0712: Conserved hypothetical signal peptide protein |
|
*
Shewanella piezotolerans WP3 Site: position = -104 score = 4.08681 sequence = AACCTTGATCTTAATCATAATT Gene: swp_4367: Conserved hypothetical signal peptide protein |
*
Shewanella sediminis HAW-EB3 Site: position = -107 score = 4.16573 sequence = TTTGTTGATCCTTATCAAAAAA Gene: Ssed_3889: Conserved hypothetical signal peptide protein |
*
Shewanella woodyi ATCC 51908 Site: position = -106 score = 3.8724 sequence = TTTGTTGATCTTAATCAAAAAC Gene: Swoo_3788: Conserved hypothetical signal peptide protein |
Conserved hypothetical signal peptide protein |
| Sfri_4034 |
|
|
|
|
|
|
Gene: Sbal_2015: FMN-binding domain-containing protein |
Gene: Sden_0639: FMN-binding domain-containing protein |
Gene: Sfri_4034: FMN-binding domain-containing protein |
Gene: Sama_0588: FMN-binding domain-containing protein |
Gene: Shew_3121: FMN-binding domain-containing protein |
Gene: Spea_0711: FMN-binding domain-containing protein |
|
Gene: swp_4368: FMN-binding domain-containing protein |
Gene: Ssed_3890: FMN-binding domain-containing protein |
Gene: Swoo_3789: FMN-binding domain-containing protein |
FMN-binding domain-containing protein |
| Sfri_4033 |
|
|
|
|
|
|
Gene: Sbal_2016: PepSY-associated TM helix domain-containing protein |
Gene: Sden_0640: PepSY-associated TM helix domain-containing protein |
Gene: Sfri_4033: PepSY-associated TM helix domain-containing protein |
Gene: Sama_0587: PepSY-associated TM helix domain-containing protein |
Gene: Shew_3122: PepSY-associated TM helix domain-containing protein |
Gene: Spea_0710: PepSY-associated TM helix domain-containing protein |
|
Gene: swp_4369: PepSY-associated TM helix domain-containing protein |
Gene: Ssed_3891: PepSY-associated TM helix domain-containing protein |
Gene: Swoo_3790: PepSY-associated TM helix domain-containing protein |
PepSY-associated TM helix domain-containing protein |
| CRON 203. | |||||||||||||||||
| swp_4930 |
|
|
|
|
|
|
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -114 score = 3.93614 sequence = TATTGTGACATATAGATAATAT Gene: Sfri_2509: transcriptional regulator, LysR family |
Gene: Sama_3539: transcriptional regulator, LysR family |
Gene: Shew_2670: transcriptional regulator, LysR family |
*
Shewanella pealeana ATCC 700345 Site: position = -80 score = 3.78718 sequence = TATTGTGGCCATAGTTACATTT Gene: Spea_4030: transcriptional regulator, LysR family |
*
Shewanella halifaxensis HAW-EB4 Site: position = -81 score = 4.25494 sequence = TATTGTGCTCACAGTTACATTT Gene: Shal_0228: transcriptional regulator, LysR family |
*
Shewanella piezotolerans WP3 Site: position = -80 score = 4.25409 sequence = TAATGTGCCCCAAGTTACATTT Gene: swp_4930: transcriptional regulator, LysR family |
*
Shewanella sediminis HAW-EB3 Site: position = -77 score = 4.3977 sequence = TATTGTGCGCCTGATTACATAT Gene: Ssed_3221: transcriptional regulator, LysR family |
|
transcriptional regulator, LysR family |
| CRON 204. | |||||||||||||||||
| SO0737 |
|
*
Shewanella putrefaciens CN-32 Site: position = -144 score = 4.38275 sequence = TAATGTGCGACACAGCACATAA Gene: Sputcn32_0692: outer membrane receptor proteins, mostly Fe transport |
*
Shewanella sp W3-18-1 Site: position = -144 score = 4.38275 sequence = TAATGTGCGACACAGCACATAA Gene: Sputw3181_3478: outer membrane receptor proteins, mostly Fe transport |
|
|
|
|
|
|
|
|
|
|
|
|
|
outer membrane receptor proteins, mostly Fe transport |
| CRON 205. | |||||||||||||||||
| SO1787 |
*
Shewanella oneidensis MR-1 Site: position = -149 score = 4.20552 sequence = AACTGAGATCCTGATCACACAG Gene: SO1787: probable membrane protein YPO2362 |
*
Shewanella putrefaciens CN-32 Site: position = -154 score = 3.9837 sequence = AACTGAGATCGGGATCACATGA Gene: Sputcn32_1483: probable membrane protein YPO2362 |
*
Shewanella sp W3-18-1 Site: position = -154 score = 3.9837 sequence = AACTGAGATCGGGATCACATGA Gene: Sputw3181_2618: probable membrane protein YPO2362 |
*
Shewanella sp ANA-3 Site: position = -151 score = 4.40307 sequence = AACTGAGATCCTGATCACATAG Gene: Shewana3_2668: probable membrane protein YPO2362 |
*
Shewanella sp MR-4 Site: position = -151 score = 3.736 sequence = AACTGAGATCCTGATCACACCG Gene: Shewmr4_2502: probable membrane protein YPO2362 |
*
Shewanella sp MR-7 Site: position = -151 score = 3.736 sequence = AACTGAGATCCTGATCACACCG Gene: Shewmr7_2570: probable membrane protein YPO2362 |
*
Shewanella baltica OS155 Site: position = -156 score = 4.20552 sequence = AACTGAGATCCTGATCACACAG Gene: Sbal_1597: probable membrane protein YPO2362 |
Gene: Sden_2412: probable membrane protein YPO2362 |
Gene: Sfri_2614: probable membrane protein YPO2362 |
Gene: Sama_1217: probable membrane protein YPO2362 |
Gene: Shew_2515: probable membrane protein YPO2362 |
Gene: Spea_2688: probable membrane protein YPO2362 |
Gene: Shal_2774: probable membrane protein YPO2362 |
Gene: swp_3268: probable membrane protein YPO2362 |
Gene: Ssed_1534: probable membrane protein YPO2362 |
Gene: Swoo_3120: probable membrane protein YPO2362 |
probable membrane protein YPO2362 |
| CRON 206. | |||||||||||||||||
| SO4131 |
*
Shewanella oneidensis MR-1 Site: position = -199 score = 4.11234 sequence = TTATGTGATTTTCACAACAACA Site: position = -157 score = 3.82537 sequence = AATTGTAAATTTTTGCATATAT Gene: SO4131: nucleoside-binding outer membrane protein |
*
Shewanella putrefaciens CN-32 Site: position = -198 score = 4.19696 sequence = TTATGTGATTTTGACAACAACA Site: position = -157 score = 4.35553 sequence = AAATGTGAATTTTTGCATATAT Gene: Sputcn32_0544: nucleoside-binding outer membrane protein |
*
Shewanella sp W3-18-1 Site: position = -157 score = 4.35553 sequence = AAATGTGAATTTTTGCATATAT Site: position = -198 score = 4.19696 sequence = TTATGTGATTTTGACAACAACA Gene: Sputw3181_3628: nucleoside-binding outer membrane protein |
*
Shewanella sp ANA-3 Site: position = -157 score = 3.82537 sequence = AATTGTAAATTTTTGCATATAT Site: position = -199 score = 4.11234 sequence = TTATGTGATTTTCACAACAACA Gene: Shewana3_3679: nucleoside-binding outer membrane protein |
*
Shewanella sp MR-4 Site: position = -157 score = 3.82537 sequence = AATTGTAAATTTTTGCATATAT Site: position = -199 score = 4.11234 sequence = TTATGTGATTTTCACAACAACA Gene: Shewmr4_3504: nucleoside-binding outer membrane protein |
*
Shewanella sp MR-7 Site: position = -199 score = 4.11234 sequence = TTATGTGATTTTCACAACAACA Site: position = -157 score = 3.82537 sequence = AATTGTAAATTTTTGCATATAT Gene: Shewmr7_0448: nucleoside-binding outer membrane protein |
*
Shewanella baltica OS155 Site: position = -198 score = 4.19696 sequence = TTATGTGATTTTGACAACAACA Site: position = -157 score = 3.80295 sequence = AAATGTAAATTTTTGCATATAT Gene: Sbal_3851: nucleoside-binding outer membrane protein |
*
Shewanella denitrificans OS217 Site: position = -165 score = 3.8416 sequence = ATATGTCAACAATTTCATATTT Gene: Sden_3073: nucleoside-binding outer membrane protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -287 score = 3.69979 sequence = CATAGTGATATTCGTTAAAATT Site: position = -243 score = 3.72005 sequence = CTTTATGCGTTGCATCACACTA Gene: Sfri_3402: nucleoside-binding outer membrane protein |
Gene: Sama_0413: nucleoside-binding outer membrane protein |
*
Shewanella loihica PV-4 Site: position = -217 score = 3.91557 sequence = AAATGTGACACAGGCAACAAAC Gene: Shew_3389: nucleoside-binding outer membrane protein |
Gene: Spea_0461: nucleoside-binding outer membrane protein |
2
Shewanella halifaxensis HAW-EB4 Gene: Shal_0661: nucleoside-binding outer membrane protein Gene: Shal_0536: nucleoside-binding outer membrane protein |
Gene: swp_4701: nucleoside-binding outer membrane protein |
Gene: Ssed_0462: nucleoside-binding outer membrane protein |
Gene: Swoo_4508: nucleoside-binding outer membrane protein |
nucleoside-binding outer membrane protein |
| CRON 207. | |||||||||||||||||
| modE |
|
|
|
Gene: Shewana3_2656: molybdate-binding domain of ModE |
Gene: Shewmr4_2490: molybdate-binding domain of ModE |
Gene: Shewmr7_2558: molybdate-binding domain of ModE |
Gene: Sbal_1609: molybdate-binding domain of ModE |
|
|
|
Gene: Shew_3338: molybdate-binding domain of ModE |
*
Shewanella pealeana ATCC 700345 Site: position = -102 score = 3.97105 sequence = AAATGTGACTCAACCCAAGATA Site: position = -143 score = 4.3886 sequence = AAACATGATCCAGTTCACAACA Gene: Spea_3636: molybdate-binding domain of ModE |
*
Shewanella halifaxensis HAW-EB4 Site: position = -102 score = 4.2629 sequence = AAATGCGACCTAATTCAAGTAA Gene: Shal_3720: molybdate-binding domain of ModE |
*
Shewanella piezotolerans WP3 Site: position = -105 score = 4.12858 sequence = TTCTGCGACTTACTTCAAATAA Gene: swp_0644: molybdate-binding domain of ModE |
Gene: Ssed_1546: molybdate-binding domain of ModE |
Gene: Swoo_3108: molybdate-binding domain of ModE |
molybdate-binding domain of ModE |
| CRON 208. | |||||||||||||||||
| Sbal_3098 |
|
*
Shewanella putrefaciens CN-32 Site: position = -260 score = 4.36402 sequence = ATTTTTAACCTGCGTCACATTT Gene: Sputcn32_1187: 83 kDa decaheme outer membrane cytochrome c |
*
Shewanella sp W3-18-1 Site: position = -260 score = 4.36402 sequence = ATTTTTAACCTGCGTCACATTT Gene: Sputw3181_2977: 83 kDa decaheme outer membrane cytochrome c |
|
|
|
*
Shewanella baltica OS155 Site: position = -154 score = 4.17378 sequence = AATAATGATTTAATTCAAACTA Gene: Sbal_3098: 83 kDa decaheme outer membrane cytochrome c |
|
|
|
|
|
|
|
|
|
83 kDa decaheme outer membrane cytochrome c |
| CRON 209. | |||||||||||||||||
| SO4240 |
Gene: SO4240: tetratricopeptide domain protein precursor |
*
Shewanella putrefaciens CN-32 Site: position = -176 score = 4.21269 sequence = ATTAGTGATCGTTCCCACAGAA Gene: Sputcn32_0470: tetratricopeptide domain protein precursor |
*
Shewanella sp W3-18-1 Site: position = -175 score = 4.19763 sequence = ATTAGTGATCGCTCCCACAGAA Gene: Sputw3181_0373: tetratricopeptide domain protein precursor |
Gene: Shewana3_3762: tetratricopeptide domain protein precursor |
Gene: Shewmr4_3589: tetratricopeptide domain protein precursor |
Gene: Shewmr7_0367: tetratricopeptide domain protein precursor |
*
Shewanella baltica OS155 Site: position = -176 score = 4.34856 sequence = ATAAGTGATCGATTCCACAGAA Gene: Sbal_0385: tetratricopeptide domain protein precursor |
Gene: Sden_0333: tetratricopeptide domain protein precursor |
Gene: Sfri_3821: tetratricopeptide domain protein precursor |
Gene: Sama_0334: tetratricopeptide domain protein precursor |
|
Gene: Spea_3829: tetratricopeptide domain protein precursor |
Gene: Shal_0437: tetratricopeptide domain protein precursor |
Gene: swp_2212: tetratricopeptide domain protein precursor |
Gene: Ssed_0392: tetratricopeptide domain protein precursor |
Gene: Swoo_4551: tetratricopeptide domain protein precursor |
tetratricopeptide domain protein precursor |
| CRON 210. | |||||||||||||||||
| Sputcn32_2347 |
|
*
Shewanella putrefaciens CN-32 Site: position = -191 score = 4.3393 sequence = AATTGCAACCTTGCTCACAATT Gene: Sputcn32_2347: methyl-accepting chemotaxis sensory transducer |
*
Shewanella sp W3-18-1 Site: position = -191 score = 4.3393 sequence = AATTGCAACCTTGCTCACAATT Gene: Sputw3181_1661: methyl-accepting chemotaxis sensory transducer |
*
Shewanella sp ANA-3 Site: position = -223 score = 4.18785 sequence = TTGAGTGAAAGTCGTCACATAA Gene: Shewana3_2521: methyl-accepting chemotaxis sensory transducer |
|
|
|
|
|
|
|
|
|
|
|
|
methyl-accepting chemotaxis sensory transducer |
| CRON 211. | |||||||||||||||||
| SO3699.1 |
*
Shewanella oneidensis MR-1 Site: position = -183 score = 3.99057 sequence = AAGTGTTACACCTATCCCATAT Gene: SO3699.1: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -183 score = 3.9818 sequence = AAGTGTTACGCCTATCCCAAAT Gene: Sputcn32_2996: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -185 score = 3.9818 sequence = AAGTGTTACGCCTATCCCAAAT Gene: Sputw3181_0951: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -176 score = 4.2687 sequence = AAATGTTACGCCTATCCCATAT Gene: Shewana3_3266: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -166 score = 4.32088 sequence = AAGTGTTATGCCTATCCCATAT Gene: Shewmr4_0857: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -166 score = 4.2687 sequence = AAATGTTACGCCTATCCCATAT Gene: Shewmr7_3165: hypothetical protein |
|
|
|
Gene: Sama_2958: hypothetical protein |
|
|
|
|
|
|
hypothetical protein |
| CRON 212. | |||||||||||||||||
| SO0919 |
Gene: SO0919: Serine transporter, putative |
Gene: Sputcn32_0861: Serine transporter, putative |
Gene: Sputw3181_3314: Serine transporter, putative |
*
Shewanella sp ANA-3 Site: position = -307 score = 3.85107 sequence = TTAATTGAAGCTGGTCGCATTT Gene: Shewana3_3365: Serine transporter, putative |
Gene: Shewmr4_0761: Serine transporter, putative |
|
*
Shewanella baltica OS155 Site: position = -280 score = 4.14671 sequence = TTTTGTGATCTAGATCCAATCC Site: position = -139 score = 3.99878 sequence = ATCAGCGATCTAGATCTCAATA Gene: Sbal_0765: Serine transporter, putative |
|
*2
Shewanella frigidimarina NCIMB 400 Site: position = -146 score = 4.11923 sequence = ATAGTTGATTCAGAACACATTA Gene: Sfri_0688: Serine transporter, putative Gene: Sfri_2127: Serine transporter, putative |
Gene: Sama_2772: Serine transporter, putative |
*
Shewanella loihica PV-4 Site: position = -188 score = 3.91725 sequence = AAGTTAGATTCGGCTCACAAAG Gene: Shew_0739: Serine transporter, putative |
*
Shewanella pealeana ATCC 700345 Site: position = -161 score = 4.19959 sequence = TTAAGAGATCTAGCTCTCAATT Gene: Spea_0771: Serine transporter, putative |
*
Shewanella halifaxensis HAW-EB4 Site: position = -160 score = 4.30581 sequence = TTAAGCGATCTAGCTCTCAATT Gene: Shal_0823: Serine transporter, putative |
*
Shewanella piezotolerans WP3 Site: position = -161 score = 3.98996 sequence = ATAAGCGATATAGCTCCCAATA Gene: swp_4263: Serine transporter, putative |
Gene: Ssed_0858: Serine transporter, putative |
*
Shewanella woodyi ATCC 51908 Site: position = -196 score = 4.18401 sequence = AACTGAGAGGTGGATCACATTG Gene: Swoo_0863: Serine transporter, putative |
Serine transporter, putative |
| Sfri_0687 |
|
|
|
|
|
|
|
|
Gene: Sfri_0687: L-serine dehydratase (EC 4.3.1.17) |
Gene: Sama_2771: L-serine dehydratase (EC 4.3.1.17) |
Gene: Shew_0740: L-serine dehydratase (EC 4.3.1.17) |
Gene: Spea_0772: L-serine dehydratase (EC 4.3.1.17) |
Gene: Shal_0824: L-serine dehydratase (EC 4.3.1.17) |
Gene: swp_4262: L-serine dehydratase (EC 4.3.1.17) |
Gene: Ssed_0859: L-serine dehydratase (EC 4.3.1.17) |
Gene: Swoo_0864: L-serine dehydratase (EC 4.3.1.17) |
L-serine dehydratase (EC 4.3.1.17) |
| CRON 213. | |||||||||||||||||
| SO4003 |
*
Shewanella oneidensis MR-1 Site: position = -165 score = 3.71882 sequence = TAAGGTGAGACTGCGCAAAATA Gene: SO4003: response regulator |
|
|
*
Shewanella sp ANA-3 Site: position = -159 score = 4.1256 sequence = TTTTATGATGATTTTCATATTG Gene: Shewana3_0479: response regulator |
*
Shewanella sp MR-4 Site: position = -159 score = 4.29223 sequence = TTTTATGATATTTTTCATATTG Gene: Shewmr4_0481: response regulator |
*
Shewanella sp MR-7 Site: position = -159 score = 4.20309 sequence = TTTTATGATACTTTTCATATTG Gene: Shewmr7_3549: response regulator |
|
|
|
|
|
|
|
|
|
|
response regulator |
| CRON 214. | |||||||||||||||||
| shew_3181 |
|
*
Shewanella putrefaciens CN-32 Site: position = -216 score = 4.21415 sequence = TTTTGTGAAGCACTGCAAAGAT Gene: Sputcn32_3387: twin-arginine translocation pathway signal precursor |
*
Shewanella sp W3-18-1 Site: position = -216 score = 4.21415 sequence = TTTTGTGAAGCACTGCAAAGAT Gene: Sputw3181_0556: twin-arginine translocation pathway signal precursor |
|
|
Gene: Shewmr7_2787: twin-arginine translocation pathway signal precursor |
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -198 score = 3.96967 sequence = ATATGTCATACATTTAACGTAT Gene: Sfri_3694: twin-arginine translocation pathway signal precursor |
|
*
Shewanella loihica PV-4 Site: position = -207 score = 4.26939 sequence = TTTTGTGAAGCACAGCAAAGAT Gene: Shew_3181: twin-arginine translocation pathway signal precursor |
|
|
|
|
|
twin-arginine translocation pathway signal precursor |
| shew_3182 |
|
Gene: Sputcn32_3388: tetraheme cytochrome c |
Gene: Sputw3181_0555: tetraheme cytochrome c |
|
|
Gene: Shewmr7_2786: tetraheme cytochrome c |
|
|
Gene: Sfri_3693: tetraheme cytochrome c |
|
Gene: Shew_3182: tetraheme cytochrome c |
|
|
|
|
|
tetraheme cytochrome c |
| CRON 215. | |||||||||||||||||
| putP |
2
Shewanella oneidensis MR-1 Gene: SO3097.4: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter Gene: SO3097.3: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
*
Shewanella putrefaciens CN-32 Site: position = -30 score = 3.81836 sequence = TAATGGGTTCTTGCTCAAACAT Site: position = -60 score = 4.15779 sequence = AGGTTAGATTTTGATCACATTT Gene: Sputcn32_2469: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
*
Shewanella sp W3-18-1 Site: position = -60 score = 4.40569 sequence = ATGTTAGATTTTGATCACATTT Site: position = -30 score = 3.81836 sequence = TAATGGGTTCTTGCTCAAACAT Gene: Sputw3181_1539: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
*
Shewanella sp ANA-3 Site: position = -73 score = 3.81836 sequence = TAATGGGTTCTTGCTCAAACAT Gene: Shewana3_1451: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
*
Shewanella sp MR-4 Site: position = -73 score = 3.81836 sequence = TAATGGGTTCTTGCTCAAACAT Gene: Shewmr4_1398: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
*
Shewanella sp MR-7 Site: position = -73 score = 3.81836 sequence = TAATGGGTTCTTGCTCAAACAT Gene: Shewmr7_1463: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
*
Shewanella baltica OS155 Site: position = -102 score = 3.84826 sequence = AGGTTAGATTTTAATCACACTT Gene: Sbal_2770: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
Gene: Sden_1520: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
*
Shewanella frigidimarina NCIMB 400 Site: position = -64 score = 4.47414 sequence = AAGTGTGAACTAGATCGAACTT Gene: Sfri_2686: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
*
Shewanella amazonensis SB2B Site: position = -77 score = 3.83859 sequence = AATTGGGATCCGACCCAAACTT Gene: Sama_2177: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
Gene: Shew_2435: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
*
Shewanella pealeana ATCC 700345 Site: position = -104 score = 3.8117 sequence = TGGTTAGATCTTCATCACATTC Gene: Spea_2608: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
*
Shewanella halifaxensis HAW-EB4 Site: position = -74 score = 3.74284 sequence = ATTTGAGCCTTGGCTCATAAAT Gene: Shal_2680: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
*
Shewanella piezotolerans WP3 Site: position = -72 score = 3.68628 sequence = ATTATTGAGCTATAGCTCAAAT Site: position = -70 score = 4.27348 sequence = TATTGAGCTATAGCTCAAATAT Gene: swp_3151: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
*
Shewanella sediminis HAW-EB3 Site: position = -72 score = 3.88919 sequence = TATTGAGCTTCCTATCAAACAT Gene: Ssed_1619: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
*
Shewanella woodyi ATCC 51908 Site: position = -86 score = 4.39237 sequence = GTATATGACCCAGTTCACATTT Gene: Swoo_3036: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter |
| CRON 216. | |||||||||||||||||
| Spea_1673 |
|
*
Shewanella putrefaciens CN-32 Site: position = -298 score = 3.82544 sequence = AGTTGTTAAGTGCCTCCCAAAT Gene: Sputcn32_2377: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -298 score = 3.82544 sequence = AGTTGTTAAGTGCCTCCCAAAT Gene: Sputw3181_1632: hypothetical protein |
|
|
|
|
Gene: Sden_2405: hypothetical protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -298 score = 4.12601 sequence = ACTTGTTATCCAGCTCTCACTT Gene: Sfri_2472: hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -278 score = 3.93547 sequence = CTATGTTAGCTGTGTCGCAAAT Gene: Sama_1499: hypothetical protein |
*
Shewanella loihica PV-4 Site: position = -301 score = 3.95528 sequence = AGATGTTAACTAGCTCCCAAAT Gene: Shew_2389: hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -311 score = 4.21873 sequence = AGTTGTTAACTGGATCTCAAAT Gene: Spea_1673: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -312 score = 4.21873 sequence = AGTTGTTAACTGGATCTCAAAT Gene: Shal_2591: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -311 score = 3.99911 sequence = AGTTGTTAAGTCGCTCTCAATT Gene: swp_1953: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -311 score = 3.91006 sequence = AGTTGTTAAGTGGCTCCCAATT Gene: Ssed_1709: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -310 score = 4.21873 sequence = AGTTGTTAACTGGATCTCAAAT Gene: Swoo_2882: hypothetical protein |
hypothetical protein |
| CRON 217. | |||||||||||||||||
| scrA |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -143 score = 4.15402 sequence = AAGTGTGGTGATAATCACGTTA Gene: Spea_3648: aminotransferase class V |
*
Shewanella halifaxensis HAW-EB4 Site: position = -144 score = 4.21382 sequence = AAATGTGGCGAAAATCACGTTA Gene: Shal_3735: aminotransferase class V |
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -154 score = 4.20628 sequence = AACTGTGTTATTCATCACGATT Gene: Swoo_4279: aminotransferase class V |
aminotransferase class V |
| CRON 218. | |||||||||||||||||
| phhA |
*
Shewanella oneidensis MR-1 Site: position = -75 score = 4.49174 sequence = AACTGTGAGGGAGTTAACAAAA Gene: SO1666: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella putrefaciens CN-32 Site: position = -75 score = 4.66081 sequence = AAGTGTGAGGGAGTTAACAAAA Gene: Sputcn32_1386: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella sp W3-18-1 Site: position = -75 score = 4.66081 sequence = AAGTGTGAGGGAGTTAACAAAA Gene: Sputw3181_2715: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella sp ANA-3 Site: position = -75 score = 4.49174 sequence = AACTGTGAGGGAGTTAACAAAA Gene: Shewana3_2781: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella sp MR-4 Site: position = -75 score = 4.49174 sequence = AACTGTGAGGGAGTTAACAAAA Gene: Shewmr4_2607: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella sp MR-7 Site: position = -75 score = 4.49174 sequence = AACTGTGAGGGAGTTAACAAAA Gene: Shewmr7_2674: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella baltica OS155 Site: position = -75 score = 4.68928 sequence = AAGTGTGAGGGAGTTAACAAAT Gene: Sbal_1484: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella denitrificans OS217 Site: position = -61 score = 4.09945 sequence = AATTGTGCGCCATGGCACACTA Gene: Sden_2595: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -74 score = 4.49174 sequence = AACTGTGAGGGAGTTAACAAAA Gene: Sfri_1328: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella amazonensis SB2B Site: position = -76 score = 4.60185 sequence = AAACGTGAGGCAGTTAACAAAA Gene: Sama_2222: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella loihica PV-4 Site: position = -40 score = 4.65109 sequence = AAGTGTGATCCTGTTAACAAAC Gene: Shew_1435: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella pealeana ATCC 700345 Site: position = -126 score = 4.8638 sequence = AACTGTGATCGGGTTAACAATT Gene: Spea_1448: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -86 score = 4.69937 sequence = AACCGTGATCTAGTTAACAAAA Gene: Shal_1531: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella piezotolerans WP3 Site: position = -76 score = 4.98744 sequence = AACTGTGATCTGGTTAACAAAA Gene: swp_1650: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella sediminis HAW-EB3 Site: position = -75 score = 4.8443 sequence = AACTGTGATGGAGTTAACAAAA Gene: Ssed_2930: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
*
Shewanella woodyi ATCC 51908 Site: position = -74 score = 4.72056 sequence = AAGTGTGAAGTGGTTAACAAAA Gene: Swoo_1715: Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
Phenylalanine-4-hydroxylase (EC 1.14.16.1) |
| phhB |
Gene: SO1667: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Sputcn32_1387: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Sputw3181_2714: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Shewana3_2780: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Shewmr4_2606: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Shewmr7_2673: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Sbal_1485: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Sden_2594: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Sfri_1329: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Sama_2221: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Shew_1436: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Spea_1449: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Shal_1532: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: swp_1651: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Ssed_2929: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Gene: Swoo_1716: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
| CRON 219. | |||||||||||||||||
| ompW |
*
Shewanella oneidensis MR-1 Site: position = -161 score = 4.44852 sequence = TAGCGTGATTTGGATCTCAATG Site: position = -110 score = 4.43661 sequence = AATTTTGATTTGGATCAATAAT Gene: SO1673: outer membrane protein W precursor |
*
Shewanella putrefaciens CN-32 Site: position = -211 score = 4.17307 sequence = ATAAATGCTGCGTATCACATAA Site: position = -158 score = 3.9843 sequence = TTTCGTGATTAGGATCTCAAGT Gene: Sputcn32_1392: outer membrane protein W precursor |
*
Shewanella sp W3-18-1 Site: position = -211 score = 4.17307 sequence = ATAAATGCTGCGTATCACATAA Gene: Sputw3181_2709: outer membrane protein W precursor |
*
Shewanella sp ANA-3 Site: position = -107 score = 3.77208 sequence = AATCTTGATTTGGATCAATAAG Gene: Shewana3_2775: outer membrane protein W precursor |
Gene: Shewmr4_2601: outer membrane protein W precursor |
Gene: Shewmr7_2668: outer membrane protein W precursor |
*
Shewanella baltica OS155 Site: position = -158 score = 3.97688 sequence = TTTCGTGATTCAGCTCCCATGT Gene: Sbal_1490: outer membrane protein W precursor |
*
Shewanella denitrificans OS217 Site: position = -157 score = 4.19298 sequence = TTTTGTGAATTAGATCAAGACT Gene: Sden_2589: outer membrane protein W precursor |
*
Shewanella frigidimarina NCIMB 400 Site: position = -232 score = 3.94946 sequence = TCGCTTGATCAACCTCACAAAA Site: position = -170 score = 3.86016 sequence = TTTTGTGATCCAAATCAACAGC Gene: Sfri_1334: outer membrane protein W precursor |
*
Shewanella amazonensis SB2B Site: position = -56 score = 4.00292 sequence = AATTGTTACGGACGTAACAGAA Gene: Sama_1371: outer membrane protein W precursor |
|
*
Shewanella pealeana ATCC 700345 Site: position = -159 score = 4.35784 sequence = TATTGTGATCTAGATCCTTTTA Gene: Spea_2787: outer membrane protein W precursor |
*
Shewanella halifaxensis HAW-EB4 Site: position = -161 score = 5.07813 sequence = AAATGTGATCTTCATCGCCTTT Site: position = -111 score = 4.7546 sequence = ATTTTTGATTCAGGTCAAATTT Gene: Shal_2887: outer membrane protein W precursor |
*
Shewanella piezotolerans WP3 Site: position = -214 score = 3.95896 sequence = TTGCGTGTTGTATGTCACCAAA Site: position = -161 score = 4.37755 sequence = AAATGTGATCGCGATCACTGCT Gene: swp_3395: outer membrane protein W precursor |
*
Shewanella sediminis HAW-EB3 Site: position = -108 score = 3.69368 sequence = TTAATTGATCTGGATCAATAAG Site: position = -158 score = 4.47541 sequence = TTTTGTGAGCTTGGTCATGTAT Gene: Ssed_1469: outer membrane protein W precursor |
*
Shewanella woodyi ATCC 51908 Site: position = -211 score = 4.28408 sequence = AATTATGACGTCGCTCACTAAA Site: position = -108 score = 3.92277 sequence = TTTATTGATTTGGATCAATAAA Site: position = -158 score = 4.48767 sequence = AAGTGTGAGTTCGATCAAGTAT Gene: Swoo_3207: outer membrane protein W precursor |
outer membrane protein W precursor |
| CRON 220. | |||||||||||||||||
| SO2535 |
*
Shewanella oneidensis MR-1 Site: position = -194 score = 4.43469 sequence = TTTGTTGATTGCGATCACAATT Gene: SO2535: Predicted glutamine amidotransferase |
*
Shewanella putrefaciens CN-32 Site: position = -193 score = 4.68615 sequence = TTTATTGATGGCGATCACAATT Gene: Sputcn32_1792: Predicted glutamine amidotransferase |
*
Shewanella sp W3-18-1 Site: position = -193 score = 4.68615 sequence = TTTATTGATGGCGATCACAATT Gene: Sputw3181_2233: Predicted glutamine amidotransferase |
*
Shewanella sp ANA-3 Site: position = -133 score = 4.43469 sequence = TTTGTTGATTGCGATCACAATT Gene: Shewana3_2322: Predicted glutamine amidotransferase |
*
Shewanella sp MR-4 Site: position = -193 score = 4.43469 sequence = TTTGTTGATTGCGATCACAATT Gene: Shewmr4_2145: Predicted glutamine amidotransferase |
*
Shewanella sp MR-7 Site: position = -193 score = 4.43469 sequence = TTTGTTGATTGCGATCACAATT Gene: Shewmr7_2222: Predicted glutamine amidotransferase |
*
Shewanella baltica OS155 Site: position = -193 score = 4.43469 sequence = TTTGTTGATTGCGATCACAATT Gene: Sbal_2305: Predicted glutamine amidotransferase |
*
Shewanella denitrificans OS217 Site: position = -204 score = 3.65769 sequence = TATGATGATCCTATTCACAAGT Gene: Sden_1765: Predicted glutamine amidotransferase |
*
Shewanella frigidimarina NCIMB 400 Site: position = -203 score = 3.92556 sequence = ATTATTGATCTCATTCACAAGA Gene: Sfri_1870: Predicted glutamine amidotransferase |
*
Shewanella amazonensis SB2B Site: position = -195 score = 3.90681 sequence = ATAAGCGATCCTGATCACAAGT Gene: Sama_1869: Predicted glutamine amidotransferase |
*
Shewanella loihica PV-4 Site: position = -191 score = 4.59385 sequence = TTATATGACCATAATCACAATT Gene: Shew_2107: Predicted glutamine amidotransferase |
*
Shewanella pealeana ATCC 700345 Site: position = -196 score = 4.3773 sequence = TTTTGAGTTCTATCTCACAATT Gene: Spea_2392: Predicted glutamine amidotransferase |
*
Shewanella halifaxensis HAW-EB4 Site: position = -199 score = 4.19299 sequence = TTTTGAGGTTTATCTCACAATT Gene: Shal_1891: Predicted glutamine amidotransferase |
Gene: swp_2313: Predicted glutamine amidotransferase |
*
Shewanella sediminis HAW-EB3 Site: position = -191 score = 4.53036 sequence = TTTATTGATCATAATCACAATT Gene: Ssed_2000: Predicted glutamine amidotransferase |
*
Shewanella woodyi ATCC 51908 Site: position = -190 score = 4.8196 sequence = TATATTGATCGATATCACAATT Gene: Swoo_2603: Predicted glutamine amidotransferase |
Predicted glutamine amidotransferase |
| CRON 221. | |||||||||||||||||
| hmgR |
*
Shewanella oneidensis MR-1 Site: position = -148 score = 4.41729 sequence = TACTGTGATCTTCTTATCAATT Gene: SO1965: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella putrefaciens CN-32 Site: position = -148 score = 4.82625 sequence = TTATGTGATCTTGTTATCAATT Gene: Sputcn32_1672: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella sp W3-18-1 Site: position = -148 score = 4.82625 sequence = TTATGTGATCTTGTTATCAATT Gene: Sputw3181_2353: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella sp ANA-3 Site: position = -92 score = 3.89869 sequence = ATCTGTTATCTCAATCTAAAAA Site: position = -148 score = 4.58635 sequence = TAGTGTGATCTTCTTATCAATT Gene: Shewana3_2480: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella sp MR-4 Site: position = -148 score = 4.58635 sequence = TAGTGTGATCTTCTTATCAATT Site: position = -92 score = 3.89869 sequence = ATCTGTTATCTCAATCTAAAAA Gene: Shewmr4_2290: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella sp MR-7 Site: position = -148 score = 4.58635 sequence = TAGTGTGATCTTCTTATCAATT Site: position = -92 score = 3.93857 sequence = ATCTGTTATCTCTATCTAAAAA Gene: Shewmr7_2362: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella baltica OS155 Site: position = -148 score = 4.67097 sequence = TAGTGTGATCTTGTTATCAATT Gene: Sbal_2614: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella denitrificans OS217 Site: position = -146 score = 4.28879 sequence = CGTTGTGATCTAGCTATCAATT Gene: Sden_2161: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella frigidimarina NCIMB 400 Site: position = -135 score = 5.09465 sequence = ATATGTGATCTAACTTACAATT Gene: Sfri_2325: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella amazonensis SB2B Site: position = -135 score = 4.73147 sequence = ATATGTGATCTGGGTATCAATT Gene: Sama_1570: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella loihica PV-4 Site: position = -115 score = 5.11129 sequence = TTATGTGATCTAAGTAACAATT Gene: Shew_2153: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella pealeana ATCC 700345 Site: position = -114 score = 4.25516 sequence = TAATGTGATCTAGGTTCAATTT Gene: Spea_1875: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella halifaxensis HAW-EB4 Site: position = -114 score = 4.54851 sequence = TAATGTGATCTAGCTTTAATTT Gene: Shal_2408: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella piezotolerans WP3 Site: position = -115 score = 4.87543 sequence = TAATGTGATCTTGTTATCAATT Gene: swp_2869: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella sediminis HAW-EB3 Site: position = -116 score = 4.46349 sequence = ATTTGTGACATACCTATCAATT Gene: Ssed_2686: Tyrosine degradation transcriptional regulator, LysR family |
*
Shewanella woodyi ATCC 51908 Site: position = -116 score = 4.45334 sequence = ATGTGTGATCTAAGTATCAATT Gene: Swoo_1933: Tyrosine degradation transcriptional regulator, LysR family |
Tyrosine degradation transcriptional regulator, LysR family |
| CRON 222. | |||||||||||||||||
| ccoN |
*
Shewanella oneidensis MR-1 Site: position = -125 score = 4.10342 sequence = AAATGTGAAGGATAACGCATTG Site: position = -173 score = 4.3135 sequence = TTTTTTGACATGGCTCAAGTAT Gene: SO2364: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella putrefaciens CN-32 Site: position = -171 score = 4.23983 sequence = TTTTTTGACATTGCTCAAGTAT Gene: Sputcn32_1959: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella sp W3-18-1 Site: position = -171 score = 4.23983 sequence = TTTTTTGACATTGCTCAAGTAT Gene: Sputw3181_2046: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella sp ANA-3 Site: position = -171 score = 4.3135 sequence = TTTTTTGACATGGCTCAAGTAT Gene: Shewana3_2107: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella sp MR-4 Site: position = -171 score = 4.3135 sequence = TTTTTTGACATGGCTCAAGTAT Gene: Shewmr4_2006: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella sp MR-7 Site: position = -171 score = 4.3135 sequence = TTTTTTGACATGGCTCAAGTAT Gene: Shewmr7_1969: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*2
Shewanella baltica OS155 Site: position = -173 score = 4.49646 sequence = TTTTTTGATATTGCTCAAGTAT Gene: Sbal_4487: Cbb3-type cytochrome c oxidase, subunit I, CcoN Site: position = -173 score = 4.49646 sequence = TTTTTTGATATTGCTCAAGTAT Gene: Sbal_2201: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella denitrificans OS217 Site: position = -182 score = 4.68212 sequence = TTTTTTGATGTAGCTCAAGTAT Gene: Sden_1851: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella frigidimarina NCIMB 400 Site: position = -186 score = 4.35181 sequence = TTTTTTGACTTAGCTCAAGTAT Gene: Sfri_2010: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella amazonensis SB2B Site: position = -180 score = 4.26267 sequence = TTTTTTGACACAGCTCAAGTAT Gene: Sama_1791: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella loihica PV-4 Site: position = -178 score = 4.49646 sequence = TTTTTTGATATTGCTCAAGTAT Gene: Shew_1985: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella pealeana ATCC 700345 Site: position = -219 score = 4.11139 sequence = TACCTTGATCTAGATCAACTTA Site: position = -176 score = 4.60845 sequence = TTTTTTGATATAGCTCAAGTAT Gene: Spea_2214: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella halifaxensis HAW-EB4 Site: position = -221 score = 4.53611 sequence = AGATTTGATCTAGATCAACTTT Site: position = -178 score = 4.60845 sequence = TTTTTTGATATAGCTCAAGTAT Gene: Shal_2197: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella piezotolerans WP3 Site: position = -221 score = 4.30893 sequence = TAGCTTGATCTAGATCAACTTT Site: position = -178 score = 4.35181 sequence = TTTTTTGACATAGCTCAAGTAT Gene: swp_2572: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella sediminis HAW-EB3 Site: position = -177 score = 4.35181 sequence = TTTTTTGACATAGCTCAAGTAT Gene: Ssed_2211: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
*
Shewanella woodyi ATCC 51908 Site: position = -220 score = 4.30893 sequence = TAGCTTGATCTAGATCAACTTT Site: position = -177 score = 4.35181 sequence = TTTTTTGACATAGCTCAAGTAT Gene: Swoo_2425: Cbb3-type cytochrome c oxidase, subunit I, CcoN |
Cbb3-type cytochrome c oxidase, subunit I, CcoN |
| ccoO |
Gene: SO2363: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: Sputcn32_1958: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: Sputw3181_2047: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: Shewana3_2108: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: Shewmr4_2007: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: Shewmr7_1968: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
2
Shewanella baltica OS155 Gene: Sbal_4488: Cbb3-type cytochrome c oxidase, subunit II, CcoO Gene: Sbal_2202: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: Sden_1850: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: Sfri_2011: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: Sama_1792: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: Shew_1986: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: Spea_2215: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: Shal_2198: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: swp_2573: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: Ssed_2212: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Gene: Swoo_2424: Cbb3-type cytochrome c oxidase, subunit II, CcoO |
Cbb3-type cytochrome c oxidase, subunit II, CcoO |
| ccoQ |
Gene: SO2362: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: Sputcn32_1957: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: Sputw3181_2048: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: Shewana3_2109: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: Shewmr4_2008: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: Shewmr7_1967: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
2
Shewanella baltica OS155 Gene: Sbal_4489: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ Gene: Sbal_2203: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: Sden_1849: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: Sfri_2012: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: Sama_1793: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: Shew_1987: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: Spea_2216: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: Shal_2199: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: swp_2574: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: Ssed_2213: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Gene: Swoo_2423: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
Cbb3-type cytochrome c oxidase, subunit IV, CcoQ |
| ccoP |
Gene: SO2361: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: Sputcn32_1956: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: Sputw3181_2049: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: Shewana3_2110: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: Shewmr4_2009: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: Shewmr7_1966: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
2
Shewanella baltica OS155 Gene: Sbal_4490: Cbb3-type cytochrome c oxidase, subunit III, CcoP Gene: Sbal_2204: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: Sden_1848: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: Sfri_2013: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: Sama_1794: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: Shew_1988: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: Spea_2217: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: Shal_2200: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: swp_2575: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: Ssed_2214: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Gene: Swoo_2422: Cbb3-type cytochrome c oxidase, subunit III, CcoP |
Cbb3-type cytochrome c oxidase, subunit III, CcoP |
| CRON 223. | |||||||||||||||||
| SO3553 |
*
Shewanella oneidensis MR-1 Site: position = -70 score = 3.91137 sequence = TTTTGCAACTATGATCACACAA Gene: SO3553: putative sulfate permease |
*
Shewanella putrefaciens CN-32 Site: position = -81 score = 3.95475 sequence = ATTTGCAATCATGATCACACAG Gene: Sputcn32_1042: putative sulfate permease |
*
Shewanella sp W3-18-1 Site: position = -81 score = 3.95475 sequence = ATTTGCAATCATGATCACACAG Gene: Sputw3181_3123: putative sulfate permease |
*
Shewanella sp ANA-3 Site: position = -70 score = 3.91137 sequence = TTTTGCAACTATGATCACACAA Gene: Shewana3_3154: putative sulfate permease |
*
Shewanella sp MR-4 Site: position = -70 score = 4.47087 sequence = TTTTGTAACTATGATCACACAA Gene: Shewmr4_2974: putative sulfate permease |
*
Shewanella sp MR-7 Site: position = -70 score = 4.47087 sequence = TTTTGTAACTATGATCACACAA Gene: Shewmr7_3056: putative sulfate permease |
Gene: Sbal_1037: putative sulfate permease |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -116 score = 4.47739 sequence = TAATGTGATGATAATTATATTA Gene: Sfri_3674: putative sulfate permease |
*
Shewanella amazonensis SB2B Site: position = -82 score = 4.12356 sequence = AAATTTGCCAAAGCTCACACAT Gene: Sama_1067: putative sulfate permease |
Gene: Shew_0497: putative sulfate permease |
|
|
|
*
Shewanella sediminis HAW-EB3 Site: position = -233 score = 4.0599 sequence = GTAAGTGCTACGCATCACATTT Gene: Ssed_1334: putative sulfate permease |
Gene: Swoo_3320: putative sulfate permease |
putative sulfate permease |
| Sama_1066 |
|
|
|
|
|
|
|
|
|
Gene: Sama_1066: hypothetical protein |
|
|
|
|
|
|
hypothetical protein |
| Sama_1065 |
|
|
|
|
|
|
|
|
|
Gene: Sama_1065: L-sorbosone dehydrogenase |
|
|
|
|
|
|
L-sorbosone dehydrogenase |
| purE |
Gene: SO3554: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Sputcn32_1041: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Sputw3181_3124: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Shewana3_3155: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Shewmr4_2975: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Shewmr7_3057: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Sbal_1036: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Sden_1224: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Sfri_1076: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Sama_1064: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
2
Shewanella loihica PV-4 Gene: Shew_1230: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) Gene: Shew_1248: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Spea_1211: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -269 score = 4.35424 sequence = TTGTGGGATCTAGGTAACATTT Gene: Shal_1245: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: swp_1396: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Ssed_1333: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
Gene: Swoo_3321: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) |
| purK |
Gene: SO3555: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Sputcn32_1040: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Sputw3181_3125: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Shewana3_3156: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Shewmr4_2976: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Shewmr7_3058: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Sbal_1035: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Sden_1223: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Sfri_1075: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Sama_1063: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
Gene: Shew_1249: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
|
|
|
|
Gene: Swoo_3322: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) |
| SO3556 |
Gene: SO3556: cyclic nucleotide phosphodiesterase, putative |
Gene: Sputcn32_1039: cyclic nucleotide phosphodiesterase, putative |
Gene: Sputw3181_3126: cyclic nucleotide phosphodiesterase, putative |
Gene: Shewana3_3157: cyclic nucleotide phosphodiesterase, putative |
Gene: Shewmr4_2977: cyclic nucleotide phosphodiesterase, putative |
Gene: Shewmr7_3059: cyclic nucleotide phosphodiesterase, putative |
*
Shewanella baltica OS155 Site: position = -139 score = 3.82035 sequence = TGATATGAAATTGTTCGCAGTT Site: position = -95 score = 4.1309 sequence = TTTCGTTATATACTTAACAGAA Gene: Sbal_1034: cyclic nucleotide phosphodiesterase, putative |
Gene: Sden_1222: cyclic nucleotide phosphodiesterase, putative |
|
Gene: Sama_1062: cyclic nucleotide phosphodiesterase, putative |
Gene: Shew_2953: cyclic nucleotide phosphodiesterase, putative |
|
|
|
|
Gene: Swoo_3724: cyclic nucleotide phosphodiesterase, putative |
cyclic nucleotide phosphodiesterase, putative |
| CRON 224. | |||||||||||||||||
| serA |
*
Shewanella oneidensis MR-1 Site: position = -145 score = 4.66236 sequence = TTATGCGATATTGTTCTCATTT Gene: SO0862: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
*
Shewanella putrefaciens CN-32 Site: position = -142 score = 4.23049 sequence = TTATGCGATATTGTTCTAAATT Gene: Sputcn32_3139: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
*
Shewanella sp W3-18-1 Site: position = -142 score = 4.23049 sequence = TTATGCGATATTGTTCTAAATT Gene: Sputw3181_0804: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
*
Shewanella sp ANA-3 Site: position = -143 score = 3.94187 sequence = TTATGCGATATTGTTCTAATTC Gene: Shewana3_3416: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
*
Shewanella sp MR-4 Site: position = -143 score = 3.94187 sequence = TTATGCGATATTGTTCTAATTC Gene: Shewmr4_0718: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
*
Shewanella sp MR-7 Site: position = -143 score = 3.94187 sequence = TTATGCGATATTGTTCTAATTC Gene: Shewmr7_3304: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
*
Shewanella baltica OS155 Site: position = -142 score = 4.133 sequence = TTATGCGATATTGTTCTTAATT Gene: Sbal_3502: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
Gene: Sden_3097: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
Gene: Sfri_0558: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
*
Shewanella amazonensis SB2B Site: position = -144 score = 4.23972 sequence = TTATGTGATATTGTTCTGGTTT Gene: Sama_2949: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
Gene: Shew_3196: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
Gene: Spea_0631: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
Gene: Shal_0723: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
Gene: swp_4448: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
Gene: Ssed_3947: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
Gene: Swoo_3889: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) |
| SO0861 |
Gene: SO0861: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Sputcn32_3140: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Sputw3181_0803: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Shewana3_3417: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Shewmr4_0717: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Shewmr7_3305: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Sbal_3503: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Sden_2956: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Sfri_0557: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Sama_2950: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Shew_3198: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Spea_0630: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Shal_0722: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: swp_4449: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Ssed_3948: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
Gene: Swoo_3890: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress |
| CRON 225. | |||||||||||||||||
| feoA |
*
Shewanella oneidensis MR-1 Site: position = -153 score = 3.99176 sequence = CATAGAGATTTTTGTCACATAA Gene: SO1783: Ferrous iron transport protein A |
*
Shewanella putrefaciens CN-32 Site: position = -155 score = 4.57035 sequence = CATTGGGATTTTTATCACATAA Gene: Sputcn32_1480: Ferrous iron transport protein A |
*
Shewanella sp W3-18-1 Site: position = -155 score = 4.57035 sequence = CATTGGGATTTTTATCACATAA Gene: Sputw3181_2621: Ferrous iron transport protein A |
*
Shewanella sp ANA-3 Site: position = -276 score = 4.96545 sequence = AAGTGTGATCTTGTTCTCACTT Site: position = -153 score = 4.43454 sequence = CATTGAGATTTTTGTCACATAA Gene: Shewana3_2671: Ferrous iron transport protein A |
*
Shewanella sp MR-4 Site: position = -153 score = 4.43454 sequence = CATTGAGATTTTTGTCACATAA Site: position = -276 score = 4.96545 sequence = AAGTGTGATCTTGTTCTCACTT Gene: Shewmr4_2505: Ferrous iron transport protein A |
*
Shewanella sp MR-7 Site: position = -276 score = 4.96545 sequence = AAGTGTGATCTTGTTCTCACTT Site: position = -153 score = 4.43454 sequence = CATTGAGATTTTTGTCACATAA Gene: Shewmr7_2573: Ferrous iron transport protein A |
*
Shewanella baltica OS155 Site: position = -276 score = 4.952 sequence = AAGCGTGATGTTGATCACGTTT Gene: Sbal_1594: Ferrous iron transport protein A |
*
Shewanella denitrificans OS217 Site: position = -148 score = 3.94023 sequence = ATCTGCGGTATTTATCACATAA Gene: Sden_2415: Ferrous iron transport protein A |
Gene: Sfri_2617: Ferrous iron transport protein A |
*
Shewanella amazonensis SB2B Site: position = -228 score = 3.81731 sequence = AAGTGTGATGAGTGTCACGCCG Gene: Sama_1214: Ferrous iron transport protein A |
*
Shewanella loihica PV-4 Site: position = -245 score = 5.23683 sequence = ATATGTGATCTAGATCACGTTG Site: position = -155 score = 4.19331 sequence = GATTGAGATATCTGTCACATAA Gene: Shew_2518: Ferrous iron transport protein A |
*
Shewanella pealeana ATCC 700345 Site: position = -158 score = 4.15597 sequence = AGTTGAGAGTTTTGTCACATAA Site: position = -247 score = 5.51256 sequence = TTATGTGATGCGTATCACACTT Gene: Spea_2691: Ferrous iron transport protein A |
*
Shewanella halifaxensis HAW-EB4 Site: position = -158 score = 4.72565 sequence = AGTTGAGATATTTATCACATAA Site: position = -279 score = 4.74275 sequence = AAGTGTGATCTGTGTCAAGTTT Gene: Shal_2777: Ferrous iron transport protein A |
*
Shewanella piezotolerans WP3 Site: position = -157 score = 4.15597 sequence = AGTTGAGAGATTTGTCACATAA Site: position = -280 score = 4.61332 sequence = AAGCGTGATCTACGTCACACTG Gene: swp_3271: Ferrous iron transport protein A |
*
Shewanella sediminis HAW-EB3 Site: position = -158 score = 4.25189 sequence = AGTTGAGACTTTTGTCACATAA Site: position = -275 score = 4.86458 sequence = AAGTGTGATCTTGGTCACGCTA Gene: Ssed_1531: Ferrous iron transport protein A |
*
Shewanella woodyi ATCC 51908 Site: position = -157 score = 4.17059 sequence = AGTTGGGACTTTTGTCACATAA Site: position = -272 score = 4.66474 sequence = AATCGTGACTTATATCACTTAA Gene: Swoo_3123: Ferrous iron transport protein A |
Ferrous iron transport protein A |
| feoB |
Gene: SO1784: Ferrous iron transport protein B |
Gene: Sputcn32_1481: Ferrous iron transport protein B |
Gene: Sputw3181_2620: Ferrous iron transport protein B |
Gene: Shewana3_2670: Ferrous iron transport protein B |
Gene: Shewmr4_2504: Ferrous iron transport protein B |
Gene: Shewmr7_2572: Ferrous iron transport protein B |
Gene: Sbal_1595: Ferrous iron transport protein B |
Gene: Sden_2414: Ferrous iron transport protein B |
Gene: Sfri_2616: Ferrous iron transport protein B |
Gene: Sama_1215: Ferrous iron transport protein B |
Gene: Shew_2517: Ferrous iron transport protein B |
Gene: Spea_2690: Ferrous iron transport protein B |
Gene: Shal_2776: Ferrous iron transport protein B |
Gene: swp_3270: Ferrous iron transport protein B |
Gene: Ssed_1532: Ferrous iron transport protein B |
Gene: Swoo_3122: Ferrous iron transport protein B |
Ferrous iron transport protein B |
| CRON 226. | |||||||||||||||||
| SO1064 |
*
Shewanella oneidensis MR-1 Site: position = -56 score = 4.35872 sequence = AACTGTGATTAATTTCACTCTA Gene: SO1064: FOG: WD40 repeat |
*
Shewanella putrefaciens CN-32 Site: position = -57 score = 4.12052 sequence = AATAGTGATTAATCTCACTTTC Gene: Sputcn32_3011: FOG: WD40 repeat |
*
Shewanella sp W3-18-1 Site: position = -57 score = 4.12052 sequence = AATAGTGATTAATCTCACTTTC Gene: Sputw3181_0938: FOG: WD40 repeat |
*
Shewanella sp ANA-3 Site: position = -56 score = 4.31241 sequence = AACTGTGATTAATCTCACTCTA Gene: Shewana3_0902: FOG: WD40 repeat |
*
Shewanella sp MR-4 Site: position = -56 score = 4.31241 sequence = AACTGTGATTAATCTCACTCTA Gene: Shewmr4_3035: FOG: WD40 repeat |
*
Shewanella sp MR-7 Site: position = -56 score = 4.31241 sequence = AACTGTGATTAATCTCACTCTA Gene: Shewmr7_0939: FOG: WD40 repeat |
Gene: Sbal_0888: FOG: WD40 repeat |
Gene: Sden_2910: FOG: WD40 repeat |
Gene: Sfri_3239: FOG: WD40 repeat |
Gene: Sama_0641: FOG: WD40 repeat |
Gene: Shew_0839: FOG: WD40 repeat |
|
|
|
*
Shewanella sediminis HAW-EB3 Site: position = -148 score = 3.78099 sequence = ATACGTTATTCCAATTACATTG Gene: Ssed_0917: FOG: WD40 repeat |
*
Shewanella woodyi ATCC 51908 Site: position = -92 score = 3.75132 sequence = ATATGATATTCCAATTACATTA Gene: Swoo_0967: FOG: WD40 repeat |
FOG: WD40 repeat |
| slyX |
Gene: SO1063: protein SlyX |
Gene: Sputcn32_3012: protein SlyX |
Gene: Sputw3181_0937: protein SlyX |
Gene: Shewana3_0901: protein SlyX |
Gene: Shewmr4_3036: protein SlyX |
Gene: Shewmr7_0938: protein SlyX |
Gene: Sbal_0887: protein SlyX |
Gene: Sden_2911: protein SlyX |
Gene: Sfri_3240: protein SlyX |
Gene: Sama_0640: protein SlyX |
Gene: Shew_0838: protein SlyX |
Gene: Spea_0826: protein SlyX |
Gene: Shal_0880: protein SlyX |
Gene: swp_0876: protein SlyX |
Gene: Ssed_0916: protein SlyX |
Gene: Swoo_0966: protein SlyX |
protein SlyX |
| def-2 |
Gene: SO1062: peptide deformylase (EC 3.5.1.88) |
Gene: Sputcn32_3013: peptide deformylase (EC 3.5.1.88) |
Gene: Sputw3181_0936: peptide deformylase (EC 3.5.1.88) |
Gene: Shewana3_0900: peptide deformylase (EC 3.5.1.88) |
Gene: Shewmr4_3037: peptide deformylase (EC 3.5.1.88) |
Gene: Shewmr7_0937: peptide deformylase (EC 3.5.1.88) |
Gene: Sbal_0886: peptide deformylase (EC 3.5.1.88) |
Gene: Sden_2912: peptide deformylase (EC 3.5.1.88) |
Gene: Sfri_3241: peptide deformylase (EC 3.5.1.88) |
Gene: Sama_0639: peptide deformylase (EC 3.5.1.88) |
|
|
|
|
|
|
peptide deformylase (EC 3.5.1.88) |
| SO1061 |
Gene: SO1061: TPR domain protein |
Gene: Sputcn32_3014: TPR domain protein |
Gene: Sputw3181_0935: TPR domain protein |
Gene: Shewana3_0899: TPR domain protein |
Gene: Shewmr4_3038: TPR domain protein |
Gene: Shewmr7_0936: TPR domain protein |
Gene: Sbal_0885: TPR domain protein |
Gene: Sden_2913: TPR domain protein |
Gene: Sfri_3242: TPR domain protein |
Gene: Sama_0638: TPR domain protein |
Gene: Shew_0837: TPR domain protein |
Gene: Spea_0825: TPR domain protein |
Gene: Shal_0879: TPR domain protein |
Gene: swp_0875: TPR domain protein |
Gene: Ssed_0915: TPR domain protein |
2
Shewanella woodyi ATCC 51908 Gene: Swoo_0965: TPR domain protein Gene: Swoo_3852: TPR domain protein |
TPR domain protein |
| spaP |
Gene: SO1060: Putative lipoprotein |
Gene: Sputcn32_3015: Putative lipoprotein |
Gene: Sputw3181_0934: Putative lipoprotein |
Gene: Shewana3_0898: Putative lipoprotein |
Gene: Shewmr4_3039: Putative lipoprotein |
Gene: Shewmr7_0935: Putative lipoprotein |
Gene: Sbal_0884: Putative lipoprotein |
Gene: Sden_2914: Putative lipoprotein |
Gene: Sfri_3243: Putative lipoprotein |
Gene: Sama_0637: Putative lipoprotein |
Gene: Shew_0836: Putative lipoprotein |
Gene: Spea_0824: Putative lipoprotein |
Gene: Shal_0878: Putative lipoprotein |
Gene: swp_0874: Putative lipoprotein |
Gene: Ssed_0914: Putative lipoprotein |
2
Shewanella woodyi ATCC 51908 Gene: Swoo_3851: Putative lipoprotein Gene: Swoo_0964: Putative lipoprotein |
Putative lipoprotein |
| Shewmr7_0934 |
|
|
|
|
|
Gene: Shewmr7_0934: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| Shewmr4_2117 |
|
|
|
|
|
Gene: Shewmr7_0933: transposase |
|
|
|
|
|
|
|
|
|
|
transposase |
| SO1059 |
Gene: SO1059: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: Sputcn32_3016: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: Sputw3181_0933: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: Shewana3_0897: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: Shewmr4_3040: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: Shewmr7_0932: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: Sbal_0883: membrane alanine aminopeptidase N (EC 3.4.11.2) |
*
Shewanella denitrificans OS217 Site: position = -4 score = 3.7888 sequence = ATTCGTGAACTTGCGCAACATT Gene: Sden_2915: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: Sfri_3244: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: Sama_2917: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: Shew_0835: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: Spea_0823: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: Shal_0877: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: swp_0873: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: Ssed_0913: membrane alanine aminopeptidase N (EC 3.4.11.2) |
Gene: Swoo_0962: membrane alanine aminopeptidase N (EC 3.4.11.2) |
membrane alanine aminopeptidase N (EC 3.4.11.2) |
| CRON 227. | |||||||||||||||||
| SO4700 |
*
Shewanella oneidensis MR-1 Site: position = -154 score = 4.51252 sequence = AAAAGTGAGCCAGTTCTCAATT Gene: SO4700: hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -153 score = 4.54761 sequence = AAAAGTGAACTAGTTCTCAATT Gene: Sputcn32_0086: hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -153 score = 4.54761 sequence = AAAAGTGAACTAGTTCTCAATT Gene: Sputw3181_3979: hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -154 score = 4.34588 sequence = AAAAGCGAACCAGTTCACAATT Gene: Shewana3_4052: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -95 score = 4.39284 sequence = AAAAGCGACTCAGTTCACAATT Gene: Shewmr4_3843: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -95 score = 4.39284 sequence = AAAAGCGACTCAGTTCACAATT Gene: Shewmr7_3936: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -154 score = 4.60051 sequence = AAAAGTGAACTCGTTCGCATTT Gene: Sbal_0123: hypothetical protein |
Gene: Sden_3594: hypothetical protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -148 score = 4.03384 sequence = TAGAGTGACTAAGATCCCAATT Gene: Sfri_3875: hypothetical protein |
Gene: Sama_3545: hypothetical protein |
*
Shewanella loihica PV-4 Site: position = -101 score = 3.58619 sequence = TATTGCCAAGCGGATCGCAAAT Gene: Shew_3658: hypothetical protein |
Gene: Spea_4066: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -105 score = 4.22866 sequence = TATTGTAAACCACGTCGCAAAT Gene: Shal_0192: hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -104 score = 3.71708 sequence = TATTGCAAAGCGCCTCGCAAAT Gene: swp_4927: hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -115 score = 4.16604 sequence = TATTGAGAATTACTTCTCAAAT Gene: Ssed_0144: hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -153 score = 4.26543 sequence = TACTTTGACCCAGCTCAAAAAA Site: position = -78 score = 3.89827 sequence = AAGCGTTATCATTTACACATTA Gene: Swoo_0123: hypothetical protein |
hypothetical protein |
| CRON 228. | |||||||||||||||||
| SO3683 |
Gene: SO3683: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella putrefaciens CN-32 Site: position = -168 score = 4.33922 sequence = AGCCGTGATCTTGCTCAAAAAT Gene: Sputcn32_2982: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella sp W3-18-1 Site: position = -168 score = 4.33922 sequence = AGCCGTGATCTTGCTCAAAAAT Gene: Sputw3181_0965: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
Gene: Shewana3_3251: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
Gene: Shewmr4_0872: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
Gene: Shewmr7_3150: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella baltica OS155 Site: position = -189 score = 4.23621 sequence = AGCCGTGATATTGCTCAAAAAT Gene: Sbal_3332: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
Gene: Sden_0975: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -146 score = 3.94129 sequence = CTTAGTGATCAAAATCAAATCA Gene: Sfri_0937: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella amazonensis SB2B Site: position = -106 score = 4.35271 sequence = ACTCGTGATCCAGATCAAGTTT Gene: Sama_2855: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella loihica PV-4 Site: position = -201 score = 4.22453 sequence = CCACTTGATCCAGATCACATTT Gene: Shew_3103: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella pealeana ATCC 700345 Site: position = -113 score = 4.55434 sequence = GAGTTTGATCTAGCTCACAATT Gene: Spea_3357: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -113 score = 4.40421 sequence = GAATTTGATCTCAGTCACAATT Gene: Shal_3429: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella piezotolerans WP3 Site: position = -113 score = 3.99778 sequence = GAAGTTGATCTTGCTCACAAAA Gene: swp_1052: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
Gene: Ssed_3716: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
Gene: Swoo_4064: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
| SO3684 |
Gene: SO3684: transcriptional regulator, TetR family |
Gene: Sputcn32_2983: transcriptional regulator, TetR family |
Gene: Sputw3181_0964: transcriptional regulator, TetR family |
Gene: Shewana3_3252: transcriptional regulator, TetR family |
Gene: Shewmr4_0871: transcriptional regulator, TetR family |
Gene: Shewmr7_3151: transcriptional regulator, TetR family |
Gene: Sbal_3333: transcriptional regulator, TetR family |
Gene: Sden_0974: transcriptional regulator, TetR family |
Gene: Sfri_0936: transcriptional regulator, TetR family |
Gene: Sama_2856: transcriptional regulator, TetR family |
Gene: Shew_3104: transcriptional regulator, TetR family |
Gene: Spea_3358: transcriptional regulator, TetR family |
Gene: Shal_3430: transcriptional regulator, TetR family |
Gene: swp_1051: transcriptional regulator, TetR family |
Gene: Ssed_3717: transcriptional regulator, TetR family |
Gene: Swoo_4065: transcriptional regulator, TetR family |
transcriptional regulator, TetR family |
| CRON 229. | |||||||||||||||||
| cobA |
Gene: SO3728: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
Gene: Sputcn32_3044: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
Gene: Sputw3181_0901: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
*
Shewanella sp ANA-3 Site: position = -248 score = 4.24385 sequence = TTATGTGAGCTGATGCAAGTTT Gene: Shewana3_0862: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
*
Shewanella sp MR-4 Site: position = -248 score = 4.16821 sequence = TTATGTGAGGTGACGCAAGTTT Gene: Shewmr4_3073: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
*
Shewanella sp MR-7 Site: position = -248 score = 4.24385 sequence = TTATGTGAGCTGATGCAAGTTT Gene: Shewmr7_0899: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
Gene: Sbal_3409: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
Gene: Sden_0958: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -37 score = 4.16543 sequence = ATATTTGAACATGGTCAAATAT Site: position = -7 score = 4.06289 sequence = AAATGTGATGGAGTTAGTATCT Gene: Sfri_3188: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
Gene: Sama_2892: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
Gene: Shew_0672: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
*
Shewanella pealeana ATCC 700345 Site: position = -148 score = 4.08186 sequence = CAATGTGTTGCATGGCACATAA Gene: Spea_0662: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
Gene: Shal_3534: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
*
Shewanella piezotolerans WP3 Site: position = -119 score = 4.33826 sequence = TTTTATGATATGCATCACCTCA Gene: swp_4059: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
Gene: Ssed_3797: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
Gene: Swoo_0787: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
uroporphyrinogen-III methyltransferase (EC 2.1.1.107) |
| cysD |
Gene: SO3727: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
Gene: Sputcn32_3043: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
Gene: Sputw3181_0902: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
Gene: Shewana3_0863: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
Gene: Shewmr4_3072: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
Gene: Shewmr7_0900: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
Gene: Sbal_3408: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
Gene: Sden_0959: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
Gene: Sfri_3187: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
Gene: Sama_2891: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
Gene: Shew_1422: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
Gene: Spea_0663: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
Gene: Shal_3533: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
2
Shewanella piezotolerans WP3 Gene: swp_1588: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) Gene: swp_4058: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
2
Shewanella sediminis HAW-EB3 Gene: Ssed_2988: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) Gene: Ssed_2961: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
*
Shewanella woodyi ATCC 51908 Site: position = -66 score = 4.21089 sequence = TAAAGTGATGAATCTTAAATTT Gene: Swoo_1686: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) |
| cysN |
Gene: SO3726: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
Gene: Sputcn32_3042: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
Gene: Sputw3181_0903: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
Gene: Shewana3_0864: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
Gene: Shewmr4_3071: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
Gene: Shewmr7_0901: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
Gene: Sbal_3407: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
Gene: Sden_0960: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
Gene: Sfri_3186: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
Gene: Sama_2890: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
Gene: Shew_1423: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
Gene: Spea_0664: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
Gene: Shal_3532: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
2
Shewanella piezotolerans WP3 Gene: swp_1589: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) Gene: swp_4057: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
2
Shewanella sediminis HAW-EB3 Gene: Ssed_2960: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) Gene: Ssed_2987: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
Gene: Swoo_1687: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) |
| Shew_1424 |
Gene: SO3725: sulfate permease, Trk-type |
Gene: Sputcn32_3041: sulfate permease, Trk-type |
Gene: Sputw3181_0904: sulfate permease, Trk-type |
Gene: Shewana3_0865: sulfate permease, Trk-type |
Gene: Shewmr4_3070: sulfate permease, Trk-type |
Gene: Shewmr7_0902: sulfate permease, Trk-type |
Gene: Sbal_3406: sulfate permease, Trk-type |
Gene: Sden_0961: sulfate permease, Trk-type |
Gene: Sfri_3185: sulfate permease, Trk-type |
Gene: Sama_2889: sulfate permease, Trk-type |
Gene: Shew_1424: sulfate permease, Trk-type |
Gene: Spea_0665: sulfate permease, Trk-type |
Gene: Shal_3531: sulfate permease, Trk-type |
2
Shewanella piezotolerans WP3 Gene: swp_1591: sulfate permease, Trk-type Gene: swp_4056: sulfate permease, Trk-type |
2
Shewanella sediminis HAW-EB3 Gene: Ssed_2959: sulfate permease, Trk-type Gene: Ssed_2986: sulfate permease, Trk-type |
Gene: Swoo_1688: sulfate permease, Trk-type |
sulfate permease, Trk-type |
| cysC |
Gene: SO3723: adenylylsulfate kinase (EC 2.7.1.25) |
Gene: Sputcn32_3040: adenylylsulfate kinase (EC 2.7.1.25) |
Gene: Sputw3181_0905: adenylylsulfate kinase (EC 2.7.1.25) |
Gene: Shewana3_0866: adenylylsulfate kinase (EC 2.7.1.25) |
Gene: Shewmr4_3069: adenylylsulfate kinase (EC 2.7.1.25) |
Gene: Shewmr7_0903: adenylylsulfate kinase (EC 2.7.1.25) |
Gene: Sbal_3405: adenylylsulfate kinase (EC 2.7.1.25) |
Gene: Sden_0962: adenylylsulfate kinase (EC 2.7.1.25) |
Gene: Sfri_3184: adenylylsulfate kinase (EC 2.7.1.25) |
Gene: Sama_2888: adenylylsulfate kinase (EC 2.7.1.25) |
Gene: Shew_1425: adenylylsulfate kinase (EC 2.7.1.25) |
Gene: Spea_0666: adenylylsulfate kinase (EC 2.7.1.25) |
Gene: Shal_3530: adenylylsulfate kinase (EC 2.7.1.25) |
*2
Shewanella piezotolerans WP3 Site: position = -204 score = 3.94248 sequence = TTTTGTTATGACGGTTGCATTT Gene: swp_1592: adenylylsulfate kinase (EC 2.7.1.25) Gene: swp_4055: adenylylsulfate kinase (EC 2.7.1.25) |
2
Shewanella sediminis HAW-EB3 Gene: Ssed_2985: adenylylsulfate kinase (EC 2.7.1.25) Gene: Ssed_2957: adenylylsulfate kinase (EC 2.7.1.25) |
Gene: Swoo_1689: adenylylsulfate kinase (EC 2.7.1.25) |
adenylylsulfate kinase (EC 2.7.1.25) |
| CRON 230. | |||||||||||||||||
| SO3551 |
|
|
|
|
|
|
|
|
Gene: Sfri_1078: RNA polymerase sigma-70 factor, ECF subfamily |
*
Shewanella amazonensis SB2B Site: position = -192 score = 4.19458 sequence = ATGTGTGAGCTTTGGCAAATTT Gene: Sama_1068: RNA polymerase sigma-70 factor, ECF subfamily |
|
|
|
|
|
|
RNA polymerase sigma-70 factor, ECF subfamily |
| SO3550 |
|
|
|
|
|
|
|
|
Gene: Sfri_1079: hypothetical protein |
Gene: Sama_1069: hypothetical protein |
|
|
|
|
|
|
hypothetical protein |
| SO3412 |
Gene: SO3412: extracellular solute-binding proteins, family 3 protein |
Gene: Sputcn32_2732: extracellular solute-binding proteins, family 3 protein |
Gene: Sputw3181_1280: extracellular solute-binding proteins, family 3 protein |
Gene: Shewana3_1143: extracellular solute-binding proteins, family 3 protein |
Gene: Shewmr4_1142: extracellular solute-binding proteins, family 3 protein |
Gene: Shewmr7_1213: extracellular solute-binding proteins, family 3 protein |
Gene: Sbal_1231: extracellular solute-binding proteins, family 3 protein |
|
|
Gene: Sama_1070: extracellular solute-binding proteins, family 3 protein |
|
|
|
|
|
|
extracellular solute-binding proteins, family 3 protein |
| Shewana3_1142 |
|
|
|
*
Shewanella sp ANA-3 Site: position = -85 score = 4.3711 sequence = GGATGTGAGTTGCTTCACAATT Gene: Shewana3_1142: hypothetical protein |
*
Shewanella sp MR-4 Site: position = -85 score = 5.01795 sequence = AGATGTGACTTGCCTCACAATT Gene: Shewmr4_1141: hypothetical protein |
*
Shewanella sp MR-7 Site: position = -85 score = 4.42071 sequence = GGATGTGACTTGCCTCACAATT Gene: Shewmr7_1212: hypothetical protein |
*
Shewanella baltica OS155 Site: position = -78 score = 5.50059 sequence = AAATGTGATTAAGTTCACAATT Gene: Sbal_1230: hypothetical protein |
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -77 score = 4.38742 sequence = CTGTGCGATCTGTGTCACAATT Gene: Spea_1069: hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -77 score = 3.80397 sequence = CGGTGCGATCTGTATCACTATT Gene: Shal_1117: hypothetical protein |
Gene: swp_3747: hypothetical protein |
|
|
hypothetical protein |
| SO3411 |
Gene: SO3411: tricorn protease homolog (EC 3.4.21.-) |
Gene: Sputcn32_2731: tricorn protease homolog (EC 3.4.21.-) |
Gene: Sputw3181_1281: tricorn protease homolog (EC 3.4.21.-) |
Gene: Shewana3_1144: tricorn protease homolog (EC 3.4.21.-) |
Gene: Shewmr4_1143: tricorn protease homolog (EC 3.4.21.-) |
Gene: Shewmr7_1214: tricorn protease homolog (EC 3.4.21.-) |
Gene: Sbal_1232: tricorn protease homolog (EC 3.4.21.-) |
|
Gene: Sfri_1080: tricorn protease homolog (EC 3.4.21.-) |
Gene: Sama_2415: tricorn protease homolog (EC 3.4.21.-) |
Gene: Shew_1234: tricorn protease homolog (EC 3.4.21.-) |
Gene: Spea_1215: tricorn protease homolog (EC 3.4.21.-) |
Gene: Shal_1249: tricorn protease homolog (EC 3.4.21.-) |
Gene: swp_1400: tricorn protease homolog (EC 3.4.21.-) |
*
Shewanella sediminis HAW-EB3 Site: position = -101 score = 3.97648 sequence = TATTGTGAAATATTTTACTGTT Gene: Ssed_1339: tricorn protease homolog (EC 3.4.21.-) |
Gene: Swoo_3315: tricorn protease homolog (EC 3.4.21.-) |
tricorn protease homolog (EC 3.4.21.-) |
| CRON 231. | |||||||||||||||||
| frdC1 |
*
Shewanella oneidensis MR-1 Site: position = -144 score = 4.03208 sequence = TTTTGTGATCATCTTCTAAGAG Gene: SO0396: Fumarate reductase cytochrome b subunit |
*
Shewanella putrefaciens CN-32 Site: position = -144 score = 4.2724 sequence = TTTTGTGATCTTCTTCTAAGAG Gene: Sputcn32_3441: Fumarate reductase cytochrome b subunit |
*
Shewanella sp W3-18-1 Site: position = -144 score = 4.2724 sequence = TTTTGTGATCTTCTTCTAAGAG Gene: Sputw3181_0498: Fumarate reductase cytochrome b subunit |
*
Shewanella sp ANA-3 Site: position = -144 score = 4.18325 sequence = TTTTGTGATCCTCTTCTAAGAG Gene: Shewana3_0401: Fumarate reductase cytochrome b subunit |
*
Shewanella sp MR-4 Site: position = -144 score = 4.18325 sequence = TTTTGTGATCCTCTTCTAAGAG Gene: Shewmr4_0402: Fumarate reductase cytochrome b subunit |
*
Shewanella sp MR-7 Site: position = -144 score = 4.18325 sequence = TTTTGTGATCCTCTTCTAAGAG Gene: Shewmr7_3623: Fumarate reductase cytochrome b subunit |
*
Shewanella baltica OS155 Site: position = -145 score = 4.2724 sequence = TTTTGTGATCTTCTTCTAAGAG Gene: Sbal_3937: Fumarate reductase cytochrome b subunit |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -103 score = 3.8207 sequence = ATAGGTGAACATTATCACGGTT Site: position = -135 score = 3.84565 sequence = TTGTGTGACCCGCTTCTAACTC Gene: Sfri_0456: Fumarate reductase cytochrome b subunit |
*
Shewanella amazonensis SB2B Site: position = -144 score = 4.08769 sequence = GTTTGTGATCCGCTTCCAATAA Gene: Sama_3222: Fumarate reductase cytochrome b subunit |
Gene: Shew_0332: Fumarate reductase cytochrome b subunit |
*
Shewanella pealeana ATCC 700345 Site: position = -106 score = 3.96574 sequence = AAGGGTGAGTTCCTTCACGAAA Site: position = -138 score = 4.70837 sequence = ATTTGTGATCTTGATCTAATAG Gene: Spea_0392: Fumarate reductase cytochrome b subunit |
|
*
Shewanella piezotolerans WP3 Site: position = -106 score = 3.8013 sequence = TAGGGTGAGCAAAGTCACGATT Gene: swp_0428: Fumarate reductase cytochrome b subunit |
*2
Shewanella sediminis HAW-EB3 Site: position = -126 score = 4.49186 sequence = GTTTGTGATCTGCTTCAAATAG Gene: Ssed_4116: Fumarate reductase cytochrome b subunit Gene: Ssed_4114: Fumarate reductase cytochrome b subunit |
*
Shewanella woodyi ATCC 51908 Site: position = -138 score = 4.77438 sequence = GTTTGTGATGTGGTTCAAAAAA Gene: Swoo_0507: Fumarate reductase cytochrome b subunit |
Fumarate reductase cytochrome b subunit |
| fdrC2 |
*
Shewanella oneidensis MR-1 Site: position = -79 score = 3.93419 sequence = ATTTGTGAGCGATATTAATTTT Gene: SO0397: Fumarate reductase cytochrome b subunit |
*
Shewanella putrefaciens CN-32 Site: position = -67 score = 4.12941 sequence = ATTTGTGAGCGATATTAACTTT Gene: Sputcn32_3440: Fumarate reductase cytochrome b subunit |
*
Shewanella sp W3-18-1 Site: position = -67 score = 4.12941 sequence = ATTTGTGAGCGATATTAACTTT Gene: Sputw3181_0499: Fumarate reductase cytochrome b subunit |
*
Shewanella sp ANA-3 Site: position = -77 score = 3.93419 sequence = ATTTGTGAGCGATATTAATTTT Gene: Shewana3_0402: Fumarate reductase cytochrome b subunit |
*
Shewanella sp MR-4 Site: position = -77 score = 3.93419 sequence = ATTTGTGAGCGATATTAATTTT Gene: Shewmr4_0403: Fumarate reductase cytochrome b subunit |
*
Shewanella sp MR-7 Site: position = -76 score = 3.93419 sequence = ATTTGTGAGCGATATTAATTTT Gene: Shewmr7_3622: Fumarate reductase cytochrome b subunit |
*
Shewanella baltica OS155 Site: position = -105 score = 4.07763 sequence = TCAATTGATCTGGCTCACGTTT Gene: Sbal_3936: Fumarate reductase cytochrome b subunit |
|
|
Gene: Sama_3221: Fumarate reductase cytochrome b subunit |
*
Shewanella loihica PV-4 Site: position = -98 score = 4.43817 sequence = TGTTTTGATCTATCTCACGGTT Gene: Shew_0333: Fumarate reductase cytochrome b subunit |
*
Shewanella pealeana ATCC 700345 Site: position = -94 score = 4.0655 sequence = TTTGTTGATCTATCTCACGGTT Gene: Spea_0393: Fumarate reductase cytochrome b subunit |
*
Shewanella halifaxensis HAW-EB4 Site: position = -94 score = 4.0655 sequence = TTTGTTGATCTATCTCACGGTT Gene: Shal_3898: Fumarate reductase cytochrome b subunit |
*
Shewanella piezotolerans WP3 Site: position = -94 score = 3.87027 sequence = TTTGTTGATCTATCTCACTGTT Gene: swp_0429: Fumarate reductase cytochrome b subunit |
*
Shewanella sediminis HAW-EB3 Site: position = -104 score = 4.38735 sequence = TGTTTTGATCTGCCTCACGGTT Site: position = -74 score = 3.91454 sequence = ATATGTGAGCGACATTATGATT Gene: Ssed_4115: Fumarate reductase cytochrome b subunit |
*
Shewanella woodyi ATCC 51908 Site: position = -109 score = 4.70641 sequence = TGATTTGATCTGTCTCACAGTA Site: position = -79 score = 3.99093 sequence = ATTTGTGAGCGACATTATCTAA Gene: Swoo_0508: Fumarate reductase cytochrome b subunit |
Fumarate reductase cytochrome b subunit |
| frdA |
Gene: SO0398: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Sputcn32_3439: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Sputw3181_0500: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shewana3_0403: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shewmr4_0404: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shewmr7_3621: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Sbal_3935: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
|
Gene: Sfri_0457: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Sama_3220: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shew_0334: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Spea_0394: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
*2
Shewanella halifaxensis HAW-EB4 Site: position = -138 score = 3.92138 sequence = GTTTGTGATCTACGTCTAATAG Site: position = -106 score = 4.24161 sequence = TGTAGTGACACTGATCACGAAA Gene: Shal_3899: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Gene: Shal_3897: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: swp_0430: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
|
Gene: Swoo_0509: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
| frdB |
Gene: SO0399: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Sputcn32_3438: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Sputw3181_0501: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shewana3_0404: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shewmr4_0405: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shewmr7_3620: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Sbal_3934: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
|
Gene: Sfri_0458: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Sama_3219: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shew_0335: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Spea_0395: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shal_3896: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: swp_0431: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Ssed_4113: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Swoo_0510: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
| CRON 232. | |||||||||||||||||
| cadC |
*
Shewanella oneidensis MR-1 Site: position = -246 score = 4.25584 sequence = TAATGTGAGCGAAGGCACGATA Gene: SO0940: transcriptional regulator-related protein |
Gene: Sputcn32_0880: transcriptional regulator-related protein |
Gene: Sputw3181_3293: transcriptional regulator-related protein |
Gene: Shewana3_3343: transcriptional regulator-related protein |
*
Shewanella sp MR-4 Site: position = -246 score = 3.82214 sequence = CAATGTGCATCAACGCACATTA Gene: Shewmr4_0783: transcriptional regulator-related protein |
*
Shewanella sp MR-7 Site: position = -246 score = 3.83432 sequence = CAATGTGTGCCTGCGCACATTA Gene: Shewmr7_3240: transcriptional regulator-related protein |
*
Shewanella baltica OS155 Site: position = -75 score = 3.9787 sequence = TTGGGTTAGCAAGATCACATTA Gene: Sbal_0833: transcriptional regulator-related protein |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -156 score = 4.95067 sequence = TGACGTGATATCGCTCACAAAT Site: position = -234 score = 4.25944 sequence = TTTCATGATGTAAGTCTCATTA Site: position = -334 score = 4.59408 sequence = AAATGTGATTCAAAGCAGATAA Gene: Sfri_3632: transcriptional regulator-related protein |
Gene: Sama_2749: transcriptional regulator-related protein |
*
Shewanella loihica PV-4 Site: position = -234 score = 3.8977 sequence = CGATGTGAAGCTGATCACTCTA Gene: Shew_0760: transcriptional regulator-related protein |
*
Shewanella pealeana ATCC 700345 Site: position = -149 score = 3.83129 sequence = GAGTGTGACTAACGTCTCATTT Site: position = -227 score = 4.21683 sequence = TTTCATGAACGATGTCACATTA Gene: Spea_3438: transcriptional regulator-related protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -227 score = 4.62594 sequence = TTCTGTGACCGATAGCACATTA Site: position = -149 score = 4.38049 sequence = CTGTGTGATTAACCTCTCATTT Gene: Shal_3519: transcriptional regulator-related protein |
*
Shewanella piezotolerans WP3 Site: position = -258 score = 4.25229 sequence = TTTATTGATCTAGATCTAATAA Gene: swp_4010: transcriptional regulator-related protein |
*
Shewanella sediminis HAW-EB3 Site: position = -147 score = 4.6755 sequence = CAGTGTGATTTTGTTCGCAAAA Gene: Ssed_0883: transcriptional regulator-related protein |
*
Shewanella woodyi ATCC 51908 Site: position = -145 score = 4.46661 sequence = CAATGTGATCCTCTTCGCAAAC Site: position = -232 score = 4.15976 sequence = AATGGTGAGCTGGATCATGTTA Gene: Swoo_0885: transcriptional regulator-related protein |
transcriptional regulator-related protein |
| SO0941 |
Gene: SO0941: hypothetical protein |
Gene: Sputcn32_0881: hypothetical protein |
Gene: Sputw3181_3292: hypothetical protein |
Gene: Shewana3_3342: hypothetical protein |
Gene: Shewmr4_0784: hypothetical protein |
Gene: Shewmr7_3239: hypothetical protein |
Gene: Sbal_0834: hypothetical protein |
|
Gene: Sfri_3631: hypothetical protein |
Gene: Sama_2748: hypothetical protein |
Gene: Shew_0761: hypothetical protein |
Gene: Spea_3439: hypothetical protein |
Gene: Shal_3520: hypothetical protein |
Gene: swp_4009: hypothetical protein |
Gene: Ssed_0884: hypothetical protein |
Gene: Swoo_0886: hypothetical protein |
hypothetical protein |
| CRON 233. | |||||||||||||||||
| fdrC |
*
Shewanella oneidensis MR-1 Site: position = -79 score = 3.93419 sequence = ATTTGTGAGCGATATTAATTTT Gene: SO0397: fumarate reductase cytochrome b subunit |
*
Shewanella putrefaciens CN-32 Site: position = -67 score = 4.12941 sequence = ATTTGTGAGCGATATTAACTTT Gene: Sputcn32_3440: fumarate reductase cytochrome b subunit |
*
Shewanella sp W3-18-1 Site: position = -67 score = 4.12941 sequence = ATTTGTGAGCGATATTAACTTT Gene: Sputw3181_0499: fumarate reductase cytochrome b subunit |
*
Shewanella sp ANA-3 Site: position = -77 score = 3.93419 sequence = ATTTGTGAGCGATATTAATTTT Gene: Shewana3_0402: fumarate reductase cytochrome b subunit |
*
Shewanella sp MR-4 Site: position = -77 score = 3.93419 sequence = ATTTGTGAGCGATATTAATTTT Gene: Shewmr4_0403: fumarate reductase cytochrome b subunit |
*
Shewanella sp MR-7 Site: position = -76 score = 3.93419 sequence = ATTTGTGAGCGATATTAATTTT Gene: Shewmr7_3622: fumarate reductase cytochrome b subunit |
*
Shewanella baltica OS155 Site: position = -105 score = 4.07763 sequence = TCAATTGATCTGGCTCACGTTT Gene: Sbal_3936: fumarate reductase cytochrome b subunit |
|
*2
Shewanella frigidimarina NCIMB 400 Site: position = -135 score = 3.84565 sequence = TTGTGTGACCCGCTTCTAACTC Site: position = -103 score = 3.8207 sequence = ATAGGTGAACATTATCACGGTT Gene: Sfri_0456: fumarate reductase cytochrome b subunit Gene: Sfri_0680: fumarate reductase cytochrome b subunit |
Gene: Sama_3221: fumarate reductase cytochrome b subunit |
*
Shewanella loihica PV-4 Site: position = -98 score = 4.43817 sequence = TGTTTTGATCTATCTCACGGTT Gene: Shew_0333: fumarate reductase cytochrome b subunit |
*
Shewanella pealeana ATCC 700345 Site: position = -94 score = 4.0655 sequence = TTTGTTGATCTATCTCACGGTT Gene: Spea_0393: fumarate reductase cytochrome b subunit |
*
Shewanella halifaxensis HAW-EB4 Site: position = -94 score = 4.0655 sequence = TTTGTTGATCTATCTCACGGTT Gene: Shal_3898: fumarate reductase cytochrome b subunit |
*
Shewanella piezotolerans WP3 Site: position = -94 score = 3.87027 sequence = TTTGTTGATCTATCTCACTGTT Gene: swp_0429: fumarate reductase cytochrome b subunit |
*
Shewanella sediminis HAW-EB3 Site: position = -104 score = 4.38735 sequence = TGTTTTGATCTGCCTCACGGTT Site: position = -74 score = 3.91454 sequence = ATATGTGAGCGACATTATGATT Gene: Ssed_4115: fumarate reductase cytochrome b subunit |
*
Shewanella woodyi ATCC 51908 Site: position = -109 score = 4.70641 sequence = TGATTTGATCTGTCTCACAGTA Site: position = -79 score = 3.99093 sequence = ATTTGTGAGCGACATTATCTAA Gene: Swoo_0508: fumarate reductase cytochrome b subunit |
fumarate reductase cytochrome b subunit |
| frdA |
Gene: SO0398: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
*2
Shewanella putrefaciens CN-32 Gene: Sputcn32_3439: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Site: position = -255 score = 3.73825 sequence = TTTTGTGATAACAATTTAAGTT Site: position = -261 score = 3.91948 sequence = TTTTGTTTTTGTGATAACAATT Gene: Sputcn32_0354: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
*2
Shewanella sp W3-18-1 Gene: Sputw3181_0500: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Site: position = -255 score = 3.73825 sequence = TTTTGTGATAACAATTTAAGTT Site: position = -261 score = 3.91948 sequence = TTTTGTTTTTGTGATAACAATT Gene: Sputw3181_0204: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shewana3_0403: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shewmr4_0404: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shewmr7_3621: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Sbal_3935: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
|
2
Shewanella frigidimarina NCIMB 400 Gene: Sfri_0457: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Gene: Sfri_0679: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Sama_3220: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shew_0334: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Spea_0394: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Shal_3897: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: swp_0430: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Ssed_4114: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
Gene: Swoo_0509: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) |
| frdB |
Gene: SO0399: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
2
Shewanella putrefaciens CN-32 Gene: Sputcn32_3438: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) Gene: Sputcn32_0353: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
2
Shewanella sp W3-18-1 Gene: Sputw3181_0203: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) Gene: Sputw3181_0501: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shewana3_0404: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shewmr4_0405: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shewmr7_3620: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Sbal_3934: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
|
2
Shewanella frigidimarina NCIMB 400 Gene: Sfri_0678: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) Gene: Sfri_0458: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Sama_3219: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shew_0335: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Spea_0395: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Shal_3896: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: swp_0431: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Ssed_4113: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
Gene: Swoo_0510: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) |
| CRON 234. | |||||||||||||||||
| cydD |
*
Shewanella oneidensis MR-1 Site: position = -191 score = 4.36443 sequence = TTTATTGATCAGCATCGCATTT Gene: SO3780: Transport ATP-binding protein CydD |
*
Shewanella putrefaciens CN-32 Site: position = -169 score = 4.74203 sequence = TTTTGTGAATCGGTTAACAAAA Gene: Sputcn32_3106: Transport ATP-binding protein CydD |
*
Shewanella sp W3-18-1 Site: position = -169 score = 4.74203 sequence = TTTTGTGAATCGGTTAACAAAA Gene: Sputw3181_0838: Transport ATP-binding protein CydD |
*
Shewanella sp ANA-3 Site: position = -167 score = 4.54454 sequence = TTTTGTGAATAGGCTAACAAAA Site: position = -187 score = 4.44609 sequence = TTTATTGATCTTTATCTCATTT Gene: Shewana3_0812: Transport ATP-binding protein CydD |
*
Shewanella sp MR-4 Site: position = -187 score = 4.44609 sequence = TTTATTGATCTTTATCTCATTT Site: position = -167 score = 4.54454 sequence = TTTTGTGAATAGGCTAACAAAA Gene: Shewmr4_3127: Transport ATP-binding protein CydD |
*
Shewanella sp MR-7 Site: position = -167 score = 4.54454 sequence = TTTTGTGAATAGGCTAACAAAA Site: position = -187 score = 4.44609 sequence = TTTATTGATCTTTATCTCATTT Gene: Shewmr7_0840: Transport ATP-binding protein CydD |
*
Shewanella baltica OS155 Site: position = -170 score = 4.32667 sequence = TTTTGTGAGTCTGCTAGCAAAA Gene: Sbal_3463: Transport ATP-binding protein CydD |
Gene: Sden_0860: Transport ATP-binding protein CydD |
*
Shewanella frigidimarina NCIMB 400 Site: position = -214 score = 4.22584 sequence = TATTGTGTTGCAATTAACAATG Site: position = -104 score = 4.96667 sequence = AAATGTGAATCAGATAACATTT Gene: Sfri_3213: Transport ATP-binding protein CydD |
*
Shewanella amazonensis SB2B Site: position = -137 score = 4.17848 sequence = TTTTTTGATCCAGCGCAAATTC Site: position = -118 score = 4.15489 sequence = TTCTGTGAATCCCCTAACAAAT Gene: Sama_2679: Transport ATP-binding protein CydD |
*
Shewanella loihica PV-4 Site: position = -129 score = 4.51623 sequence = TTTTTTGATCTAGCTCAATTTT Site: position = -110 score = 4.79714 sequence = TTTTGTGAGCCTAATAACAATT Gene: Shew_0613: Transport ATP-binding protein CydD |
*
Shewanella pealeana ATCC 700345 Site: position = -166 score = 4.44164 sequence = TTTTGTGAGTCCGATAGCAAAT Site: position = -185 score = 4.07345 sequence = TTTATTGATCTAGCTCAATTTT Gene: Spea_3494: Transport ATP-binding protein CydD |
*
Shewanella halifaxensis HAW-EB4 Site: position = -233 score = 4.07345 sequence = TTTATTGATCTAGCTCAATTTT Site: position = -214 score = 4.8735 sequence = TTTTGTGAGTCCGATAACATTT Gene: Shal_3589: Transport ATP-binding protein CydD |
Gene: swp_0805: Transport ATP-binding protein CydD |
*
Shewanella sediminis HAW-EB3 Site: position = -120 score = 4.68176 sequence = TTTTGTGAATCCGTTAACAATT Site: position = -139 score = 4.09363 sequence = AAAATTGATCTAGCTCAATTTT Gene: Ssed_3849: Transport ATP-binding protein CydD |
*
Shewanella woodyi ATCC 51908 Site: position = -149 score = 4.07345 sequence = TTTATTGATCTAGCTCAATTTT Site: position = -130 score = 4.69465 sequence = TTTTGTGAATCTCTTAACATTT Gene: Swoo_0710: Transport ATP-binding protein CydD |
Transport ATP-binding protein CydD |
| cydC |
Gene: SO3779: Transport ATP-binding protein CydC |
Gene: Sputcn32_3105: Transport ATP-binding protein CydC |
Gene: Sputw3181_0839: Transport ATP-binding protein CydC |
Gene: Shewana3_0813: Transport ATP-binding protein CydC |
Gene: Shewmr4_3126: Transport ATP-binding protein CydC |
Gene: Shewmr7_0841: Transport ATP-binding protein CydC |
Gene: Sbal_3462: Transport ATP-binding protein CydC |
Gene: Sden_0859: Transport ATP-binding protein CydC |
Gene: Sfri_3212: Transport ATP-binding protein CydC |
Gene: Sama_2678: Transport ATP-binding protein CydC |
Gene: Shew_0614: Transport ATP-binding protein CydC |
Gene: Spea_3493: Transport ATP-binding protein CydC |
Gene: Shal_3588: Transport ATP-binding protein CydC |
Gene: swp_0806: Transport ATP-binding protein CydC |
Gene: Ssed_3848: Transport ATP-binding protein CydC |
Gene: Swoo_0711: Transport ATP-binding protein CydC |
Transport ATP-binding protein CydC |
| cyaB |
Gene: SO3778: adenylate cyclase CyaB, putative |
Gene: Sputcn32_3104: adenylate cyclase CyaB, putative |
Gene: Sputw3181_0840: adenylate cyclase CyaB, putative |
Gene: Shewana3_0814: adenylate cyclase CyaB, putative |
Gene: Shewmr4_3125: adenylate cyclase CyaB, putative |
Gene: Shewmr7_0842: adenylate cyclase CyaB, putative |
Gene: Sbal_3461: adenylate cyclase CyaB, putative |
|
Gene: Sfri_1665: adenylate cyclase CyaB, putative |
|
Gene: Shew_1517: adenylate cyclase CyaB, putative |
Gene: Spea_0940: adenylate cyclase CyaB, putative |
Gene: Shal_0990: adenylate cyclase CyaB, putative |
Gene: swp_4873: adenylate cyclase CyaB, putative |
Gene: Ssed_1050: adenylate cyclase CyaB, putative |
|
adenylate cyclase CyaB, putative |
| CRON 235. | |||||||||||||||||
| cadC |
*
Shewanella oneidensis MR-1 Site: position = -117 score = 4.57783 sequence = TTTATTGATGTAATTCACAGAT Gene: SO0936: transcriptional regulator-related protein |
|
|
*
Shewanella sp ANA-3 Site: position = -118 score = 4.5794 sequence = TTTATTGATGTGTTTCACAGAT Gene: Shewana3_3347: transcriptional regulator-related protein |
*
Shewanella sp MR-4 Site: position = -118 score = 4.52857 sequence = TTTATTGATGCATTTCACAGAT Gene: Shewmr4_0779: transcriptional regulator-related protein |
*
Shewanella sp MR-7 Site: position = -118 score = 4.52857 sequence = TTTATTGATGCATTTCACAGAT Gene: Shewmr7_3244: transcriptional regulator-related protein |
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -115 score = 4.28238 sequence = TTATGTGCTGATTGTCACGAAA Gene: Shew_0757: transcriptional regulator-related protein |
|
*
Shewanella halifaxensis HAW-EB4 Site: position = -117 score = 4.35665 sequence = TAGTGTGCTAGACCTCACGAAA Gene: Shal_0849: transcriptional regulator-related protein |
*
Shewanella piezotolerans WP3 Site: position = -248 score = 4.23115 sequence = TAACGTGCTAAAGCTCACGAAA Gene: swp_4239: transcriptional regulator-related protein |
*
Shewanella sediminis HAW-EB3 Site: position = -117 score = 4.06927 sequence = TAACGTGTTCCTTGTCACGAAT Gene: Ssed_0879: transcriptional regulator-related protein |
*
Shewanella woodyi ATCC 51908 Site: position = -116 score = 3.72975 sequence = ATATGAGCGCTAAATCACGCTT Gene: Swoo_0881: transcriptional regulator-related protein |
transcriptional regulator-related protein |
| SO0937 |
Gene: SO0937: hypothetical protein |
|
|
Gene: Shewana3_3346: hypothetical protein |
Gene: Shewmr4_0780: hypothetical protein |
Gene: Shewmr7_3243: hypothetical protein |
|
|
|
|
|
|
Gene: Shal_0850: hypothetical protein |
|
Gene: Ssed_0880: hypothetical protein |
Gene: Swoo_0882: hypothetical protein |
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |