Orthologous regulated operons containing Sfri_2271 gene

Properties
Regulog:	Crp - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria

Built upon 2713 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella frigidimarina NCIMB 400
Position: -125 Score: 4.10754 Sequence: TTTTATGACTTAGGTCAACTTA Locus tag: Sfri_2271 Name: Sfri_2271 Funciton: permease of the major facilitator superfamily Locus tag: Sfri_2272 Name: Sfri_2272 Funciton: hypothetical protein Locus tag: Sfri_2273 Name: Sfri_2273 Funciton: nitrogen regulatory protein P-II Locus tag: Sfri_2274 Name: Sfri_2274 Funciton: hypothetical protein
Sfri_2271-Sfri_2272-Sfri_2273-Sfri_2274	-125	4.1	TTTTATGACTTAGGTCAACTTA	Sfri_2271
Shewanella halifaxensis HAW-EB4
Position: -100 Score: 4.31151 Sequence: ATGCTTGATCTAGCTCAAACTT Locus tag: Shal_1659 Name: Sfri_2271 Funciton: permease of the major facilitator superfamily Locus tag: Shal_1660 Name: Sfri_2272 Funciton: hypothetical protein Locus tag: Shal_1661 Name: Sfri_2273 Funciton: nitrogen regulatory protein P-II Locus tag: Shal_1662 Name: Sfri_2274 Funciton: hypothetical protein
Sfri_2271-Sfri_2272-Sfri_2273-Sfri_2274	-100	4.3	ATGCTTGATCTAGCTCAAACTT	Shal_1659
Shewanella loihica PV-4
Position: -123 Score: 4.28786 Sequence: TAACTTGAACTGGCTCACGTAA Locus tag: Shew_1497 Name: Sfri_2271 Funciton: permease of the major facilitator superfamily Locus tag: Shew_1498 Name: Sfri_2272 Funciton: hypothetical protein Locus tag: Shew_1499 Name: Sfri_2273 Funciton: nitrogen regulatory protein P-II Locus tag: Shew_1500 Name: Sfri_2274 Funciton: hypothetical protein
Sfri_2271-Sfri_2272-Sfri_2273-Sfri_2274	-123	4.3	TAACTTGAACTGGCTCACGTAA	Shew_1497
Shewanella pealeana ATCC 700345
Position: -100 Score: 4.7532 Sequence: ATATTTGATCCAGCTCAAACTT Locus tag: Spea_1591 Name: Sfri_2271 Funciton: permease of the major facilitator superfamily Locus tag: Spea_1592 Name: Sfri_2272 Funciton: hypothetical protein Locus tag: Spea_1593 Name: Sfri_2273 Funciton: nitrogen regulatory protein P-II Locus tag: Spea_1594 Name: Sfri_2274 Funciton: hypothetical protein
Sfri_2271-Sfri_2272-Sfri_2273-Sfri_2274	-100	4.8	ATATTTGATCCAGCTCAAACTT	Spea_1591
Shewanella piezotolerans WP3
Position: -100 Score: 4.13878 Sequence: CTCTATGATATAGCTCACAGAT Locus tag: swp_1789 Name: Sfri_2271 Funciton: permease of the major facilitator superfamily Locus tag: swp_1790 Name: Sfri_2272 Funciton: hypothetical protein Locus tag: swp_1791 Name: Sfri_2273 Funciton: nitrogen regulatory protein P-II Locus tag: swp_1792 Name: Sfri_2274 Funciton: hypothetical protein
Sfri_2271-Sfri_2272-Sfri_2273-Sfri_2274	-100	4.1	CTCTATGATATAGCTCACAGAT	swp_1789
Shewanella sediminis HAW-EB3
Position: -165 Score: 3.80413 Sequence: CAACTTGATTTCGCTCAAGTAT Locus tag: Ssed_1826 Name: Sfri_2271 Funciton: permease of the major facilitator superfamily Locus tag: Ssed_1827 Name: Sfri_2272 Funciton: hypothetical protein Locus tag: Ssed_1828 Name: Sfri_2273 Funciton: nitrogen regulatory protein P-II Locus tag: Ssed_1829 Name: Sfri_2274 Funciton: hypothetical protein
Sfri_2271-Sfri_2272-Sfri_2273-Sfri_2274	-165	3.8	CAACTTGATTTCGCTCAAGTAT	Ssed_1826
Shewanella woodyi ATCC 51908
Position: -220 Score: 4.14673 Sequence: AAACTTGATTTCGCTCAAGTAA Locus tag: Swoo_2762 Name: Sfri_2271 Funciton: permease of the major facilitator superfamily Locus tag: Swoo_2761 Name: Sfri_2272 Funciton: hypothetical protein Locus tag: Swoo_2760 Name: Sfri_2273 Funciton: nitrogen regulatory protein P-II Locus tag: Swoo_2759 Name: Sfri_2274 Funciton: hypothetical protein
Sfri_2271-Sfri_2272-Sfri_2273-Sfri_2274	-220	4.1	AAACTTGATTTCGCTCAAGTAA	Swoo_2762

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing Sfri_2271 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --