Regulon of Crp in Shewanella halifaxensis HAW-EB4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shal_3603
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Regulog:	Crp - Shewanellaceae
Statistics of regulated genes:
- Genes	310
- Operons	162
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2713 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - CRP
By effector - Cyclic 3',5'-AMP
By pathway - Carbon catabolism

Regulated operons
	Locus Tag	Name	Function
Position: -88 Score: 5.3 Sequence: AAGCGTGATGTTGATCACATTT Locus tag: Shal_3916 Name: cyaA Funciton: Adenylate cyclase (EC 4.6.1.1)
	Shal_3916	cyaA	Adenylate cyclase (EC 4.6.1.1)
Position: -182 Score: 4.1 Sequence: TATTGTGAAATCGCGCAGAAAA Locus tag: Shal_0488 Name: purH Funciton: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) Locus tag: Shal_0487 Name: purD Funciton: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
	Shal_0488	purH	IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
	Shal_0487	purD	Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
Position: -95 Score: 4.4 Sequence: AAATATTACCCCGATCACATAA Locus tag: Shal_4222 Name: cytcB Funciton: diheme cytochrome c4
	Shal_4222	cytcB	diheme cytochrome c4
Position: -144 Score: 4.2 Sequence: AAATGTGGCGAAAATCACGTTA Locus tag: Shal_3735 Name: scrA Funciton: aminotransferase class V
	Shal_3735	scrA	aminotransferase class V
Position: -149 Score: 4.4 Sequence: AAACGTGAGATTGCTCACTATT Locus tag: Shal_3069 Name: icd Funciton: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
	Shal_3069	icd	Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
Position: -138 Score: 4.7 Sequence: TTTTGTGACATAGGTAACACAA Locus tag: Shal_0486 Name: SO0439 Funciton: hypothetical protein
	Shal_0486	SO0439	hypothetical protein
Position: -148 Score: 4.1 Sequence: GAAAGTGATTTATATCGCGTTT Locus tag: Shal_1549 Name: null Funciton: hypothetical protein
	Shal_1549		hypothetical protein
Position: -261 Score: 4.8 Sequence: ATGTGAGATTTGCATCACAATT Locus tag: Shal_0189 Name: Swoo_4104 Funciton: choline-glycine betaine transporter
	Shal_0189	Swoo_4104	choline-glycine betaine transporter
Position: -226 Score: 3.5 Sequence: AGATGTGATACAAGCCTAATTG Locus tag: Shal_3603 Name: crp Funciton: Cyclic AMP receptor protein Crp
	Shal_3603	crp	Cyclic AMP receptor protein Crp
Position: -165 Score: 3.8 Sequence: TTACGTGATCGAGCGCTAGTTT Position: -104 Score: 4.3 Sequence: AAGTTTGACAGTGTTCAAATAT Locus tag: Shal_3640 Name: null Funciton: hypothetical protein
	Shal_3640		hypothetical protein
Position: -85 Score: 4.2 Sequence: CAGAGTGATTCAAGTCACACTT Locus tag: Shal_2568 Name: rarD Funciton: RarD protein
	Shal_2568	rarD	RarD protein
Position: -89 Score: 4.6 Sequence: ATTTTTGATTCAGTTCACAGTC Locus tag: Shal_1064 Name: SO1328 Funciton: transcriptional regulator, LysR family
	Shal_1064	SO1328	transcriptional regulator, LysR family
Position: -67 Score: 4.4 Sequence: AAGTTTGATCTACAGCTCATTT Locus tag: Shal_1266 Name: fadE Funciton: acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
	Shal_1266	fadE	acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Position: -101 Score: 4.3 Sequence: AAGTGTGATCTTGGCTACAAAT Locus tag: Shal_3744 Name: Spea_3654 Funciton: histidinol-phosphate aminotransferase (EC 2.6.1.9)
	Shal_3744	Spea_3654	histidinol-phosphate aminotransferase (EC 2.6.1.9)
Position: -193 Score: 5.2 Sequence: ATTTGTGACGTTGATCACCTAT Locus tag: Shal_3021 Name: SO1482 Funciton: tonB-dependent receptor, putative
	Shal_3021	SO1482	tonB-dependent receptor, putative
Position: -195 Score: 4.3 Sequence: ATATTTGCTAGACATCACATTG Position: -141 Score: 5 Sequence: ATTCGTGATGGAAATCAAATTA Locus tag: Shal_0318 Name: pilZ Funciton: type IV pilus assembly PilZ
	Shal_0318	pilZ	type IV pilus assembly PilZ
Position: -140 Score: 4.1 Sequence: ATTTGTGAACTATCTGGCAATT Locus tag: Shal_1712 Name: SO2637 Funciton: hypothetical protein
	Shal_1712	SO2637	hypothetical protein
Position: -77 Score: 3.8 Sequence: CGGTGCGATCTGTATCACTATT Locus tag: Shal_1117 Name: null Funciton: hypothetical protein
	Shal_1117		hypothetical protein
Position: -247 Score: 4.2 Sequence: ATTCGTGAGGCAGCTCTCGAAT Position: -138 Score: 4.3 Sequence: TTGTATGACGTAACTCACAAAG Locus tag: Shal_3965 Name: SO1415 Funciton: transcriptional regulator, TetR family
	Shal_3965	SO1415	transcriptional regulator, TetR family
Position: -124 Score: 4.3 Sequence: AAGTTTGTCTTAGATCACATTT Locus tag: Shal_0387 Name: SO0355 Funciton: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) Locus tag: Shal_0386 Name: SO0354 Funciton: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter
	Shal_0387	SO0355	long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
	Shal_0386	SO0354	inner membrane protein YrbG, predicted calcium/sodium:proton antiporter
Position: -133 Score: 4.3 Sequence: ATAGGTGATCTTTATCATAGTA Locus tag: Shal_4072 Name: SO0296 Funciton: integral membrane domain protein
	Shal_4072	SO0296	integral membrane domain protein
Position: -233 Score: 4.1 Sequence: TTTATTGATCTAGCTCAATTTT Position: -214 Score: 4.9 Sequence: TTTTGTGAGTCCGATAACATTT Locus tag: Shal_3589 Name: cydD Funciton: Transport ATP-binding protein CydD Locus tag: Shal_3588 Name: cydC Funciton: Transport ATP-binding protein CydC
	Shal_3589	cydD	Transport ATP-binding protein CydD
	Shal_3588	cydC	Transport ATP-binding protein CydC
Position: -138 Score: 4.8 Sequence: AAGTGTGATCTAAATCTAATTA Locus tag: Shal_3135 Name: deoA Funciton: thymidine phosphorylase (EC 2.4.2.4) Locus tag: Shal_3134 Name: deoB Funciton: phosphopentomutase (EC 5.4.2.7) Locus tag: Shal_3133 Name: deoD-2 Funciton: purine nucleoside phosphorylase (EC 2.4.2.1)
	Shal_3135	deoA	thymidine phosphorylase (EC 2.4.2.4)
	Shal_3134	deoB	phosphopentomutase (EC 5.4.2.7)
	Shal_3133	deoD-2	purine nucleoside phosphorylase (EC 2.4.2.1)
Position: -77 Score: 3.8 Sequence: CGGTGCGATCTGTATCACTATT Locus tag: Shal_1117 Name: swp_3747 Funciton: hypothetical protein
	Shal_1117	swp_3747	hypothetical protein
Position: -174 Score: 4.2 Sequence: ATCTGTGAATCAGATCACCATG Locus tag: Shal_0716 Name: napD Funciton: periplasmic nitrate reductase component NapD Locus tag: Shal_0715 Name: napA Funciton: periplasmic nitrate reductase precursor (EC 1.7.99.4) Locus tag: Shal_0714 Name: napG Funciton: ferredoxin-type protein NapG (periplasmic nitrate reductase) Locus tag: Shal_0713 Name: napH Funciton: polyferredoxin NapH (periplasmic nitrate reductase) Locus tag: Shal_0712 Name: napB Funciton: nitrate reductase cytochrome c550-type subunit
	Shal_0716	napD	periplasmic nitrate reductase component NapD
	Shal_0715	napA	periplasmic nitrate reductase precursor (EC 1.7.99.4)
	Shal_0714	napG	ferredoxin-type protein NapG (periplasmic nitrate reductase)
	Shal_0713	napH	polyferredoxin NapH (periplasmic nitrate reductase)
	Shal_0712	napB	nitrate reductase cytochrome c550-type subunit
Position: -79 Score: 3.9 Sequence: GTTTTTGACTAAGATCAAAAAA Locus tag: Shal_0680 Name: Sputcn32_0777 Funciton: hypothetical protein
	Shal_0680	Sputcn32_0777	hypothetical protein
Position: -93 Score: 4.1 Sequence: TTGTGTTAACTGCGTCAAATAA Locus tag: Shal_2064 Name: SO1419 Funciton: lipoprotein, putative Locus tag: Shal_2065 Name: SO1420 Funciton: outer membrane porin, putative
	Shal_2064	SO1419	lipoprotein, putative
	Shal_2065	SO1420	outer membrane porin, putative
Position: -128 Score: 4.6 Sequence: AACTATGATCTGGCTCAAATTT Locus tag: Shal_3630 Name: petA Funciton: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) Locus tag: Shal_3629 Name: petB Funciton: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) Locus tag: Shal_3628 Name: petC Funciton: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit Locus tag: Shal_3627 Name: sspA Funciton: stringent starvation protein A Locus tag: Shal_3626 Name: sspB Funciton: stringent starvation protein B
	Shal_3630	petA	ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2)
	Shal_3629	petB	ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2)
	Shal_3628	petC	ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit
	Shal_3627	sspA	stringent starvation protein A
	Shal_3626	sspB	stringent starvation protein B
Position: -181 Score: 4.6 Sequence: TTCCTTGATCTAGATCACACTA Locus tag: Shal_2994 Name: null Funciton: hypothetical protein
	Shal_2994		hypothetical protein
Position: -62 Score: 4.1 Sequence: TATTTTGATATTGATGAAATAA Locus tag: Shal_2355 Name: ycbW Funciton: probable membrane protein YcbW
	Shal_2355	ycbW	probable membrane protein YcbW
Position: -109 Score: 4.5 Sequence: TTTTGTGTTTGAGTTAACAAAA Locus tag: Shal_0063 Name: SO0075 Funciton: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
	Shal_0063	SO0075	long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Position: -124 Score: 4.2 Sequence: ATAGTTGATCTAGTTCAAACTA Locus tag: Shal_0100 Name: null Funciton: hypothetical protein Locus tag: Shal_0101 Name: SO4505 Funciton: hypothetical protein probably related to Formate dehydrogenase function Locus tag: Shal_0102 Name: SO4506 Funciton: iron-sulfur cluster-binding protein Locus tag: Shal_0103 Name: SO4507 Funciton: putative formate dehydrogenase-specific chaperone Locus tag: Shal_0104 Name: SO4508 Funciton: formate dehydrogenase subunit or accessory protein Locus tag: Shal_0105 Name: SO4509 Funciton: formate dehydrogenase-O, major subunit (EC 1.2.1.2) Locus tag: Shal_0106 Name: fdhB-1 Funciton: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) Locus tag: Shal_0107 Name: SO4511 Funciton: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2)
	Shal_0100		hypothetical protein
	Shal_0101	SO4505	hypothetical protein probably related to Formate dehydrogenase function
	Shal_0102	SO4506	iron-sulfur cluster-binding protein
	Shal_0103	SO4507	putative formate dehydrogenase-specific chaperone
	Shal_0104	SO4508	formate dehydrogenase subunit or accessory protein
	Shal_0105	SO4509	formate dehydrogenase-O, major subunit (EC 1.2.1.2)
	Shal_0106	fdhB-1	formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2)
	Shal_0107	SO4511	formate dehydrogenase -O, gamma subunit (EC 1.2.1.2)
Position: -100 Score: 4.3 Sequence: ATGCTTGATCTAGCTCAAACTT Locus tag: Shal_1659 Name: Sfri_2271 Funciton: permease of the major facilitator superfamily Locus tag: Shal_1660 Name: Sfri_2272 Funciton: hypothetical protein Locus tag: Shal_1661 Name: Sfri_2273 Funciton: nitrogen regulatory protein P-II Locus tag: Shal_1662 Name: Sfri_2274 Funciton: hypothetical protein
	Shal_1659	Sfri_2271	permease of the major facilitator superfamily
	Shal_1660	Sfri_2272	hypothetical protein
	Shal_1661	Sfri_2273	nitrogen regulatory protein P-II
	Shal_1662	Sfri_2274	hypothetical protein
Position: -196 Score: 3.8 Sequence: TATAGCGATAAAGTTAAAAAAT Locus tag: Shal_3859 Name: SO4118 Funciton: NADP-dependent malic enzyme (EC 1.1.1.40) Locus tag: Shal_3858 Name: mshH Funciton: MSHA biogenesis protein MshH, GGDEF:EAL domain protein Locus tag: Shal_3857 Name: mshI Funciton: MSHA biogenesis protein MshI
	Shal_3859	SO4118	NADP-dependent malic enzyme (EC 1.1.1.40)
	Shal_3858	mshH	MSHA biogenesis protein MshH, GGDEF:EAL domain protein
	Shal_3857	mshI	MSHA biogenesis protein MshI
Position: -174 Score: 4.7 Sequence: ATATTTGAGTTGATTCACAAAA Locus tag: Shal_1780 Name: null Funciton: hypothetical protein
	Shal_1780		hypothetical protein
Position: -112 Score: 4.8 Sequence: TTTTTTGATCTTGCCCACATAT Locus tag: Shal_4178 Name: pckA Funciton: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
	Shal_4178	pckA	phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
Position: -81 Score: 4.9 Sequence: AATAGTGATGCAGATCACACTG Locus tag: Shal_0787 Name: SO3987 Funciton: hypothetical protein
	Shal_0787	SO3987	hypothetical protein
Position: -42 Score: 5 Sequence: AAGTGTGACGCAGATCACCATT Locus tag: Shal_0348 Name: Spea_3921 Funciton: hypothetical protein
	Shal_0348	Spea_3921	hypothetical protein
Position: -156 Score: 4.9 Sequence: AAGCGTGATCTGGTTCACGAAT Locus tag: Shal_3793 Name: Sama_3134 Funciton: membrane protein
	Shal_3793	Sama_3134	membrane protein
Position: -227 Score: 4.6 Sequence: TTCTGTGACCGATAGCACATTA Position: -149 Score: 4.4 Sequence: CTGTGTGATTAACCTCTCATTT Locus tag: Shal_3519 Name: cadC Funciton: transcriptional regulator-related protein Locus tag: Shal_3520 Name: SO0941 Funciton: hypothetical protein
	Shal_3519	cadC	transcriptional regulator-related protein
	Shal_3520	SO0941	hypothetical protein
Position: -99 Score: 4.1 Sequence: TAATCTGATTGGAATAACCTAT Locus tag: Shal_0881 Name: fkpA Funciton: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8)
	Shal_0881	fkpA	FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8)
Position: -86 Score: 4.9 Sequence: ATCTGTGATCTGGATCACCGAT Locus tag: Shal_2493 Name: sdhC Funciton: Succinate dehydrogenase cytochrome b-556 subunit Locus tag: Shal_2492 Name: SO1927.1 Funciton: Succinate dehydrogenase hydrophobic membrane anchor protein Locus tag: Shal_2491 Name: sdhA Funciton: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: Shal_2490 Name: sdhB Funciton: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) Locus tag: Shal_2489 Name: sucA Funciton: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) Locus tag: Shal_2488 Name: sucB Funciton: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) Locus tag: Shal_2487 Name: sucC Funciton: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) Locus tag: Shal_2486 Name: sucD Funciton: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
	Shal_2493	sdhC	Succinate dehydrogenase cytochrome b-556 subunit
	Shal_2492	SO1927.1	Succinate dehydrogenase hydrophobic membrane anchor protein
	Shal_2491	sdhA	succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
	Shal_2490	sdhB	succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
	Shal_2489	sucA	2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2)
	Shal_2488	sucB	dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61)
	Shal_2487	sucC	succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5)
	Shal_2486	sucD	succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
Position: -36 Score: 4.3 Sequence: AAATGGGATGTAAATAACGTAA Locus tag: Shal_0814 Name: null Funciton: nitroreductase Locus tag: Shal_0815 Name: null Funciton: Cupin 2 conserved barrel domain protein Locus tag: Shal_0816 Name: SO3797 Funciton: probable collagenase (EC 3.4.24.3)
	Shal_0814		nitroreductase
	Shal_0815		Cupin 2 conserved barrel domain protein
	Shal_0816	SO3797	probable collagenase (EC 3.4.24.3)
Position: -152 Score: 4.2 Sequence: AAGTGTGAGCAACAACACATTC Locus tag: Shal_0886 Name: nrfA Funciton: cytochrome c552 precursor (EC 1.7.2.2)
	Shal_0886	nrfA	cytochrome c552 precursor (EC 1.7.2.2)
Position: -113 Score: 4.4 Sequence: GAATTTGATCTCAGTCACAATT Locus tag: Shal_3429 Name: SO3683 Funciton: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) Locus tag: Shal_3430 Name: SO3684 Funciton: transcriptional regulator, TetR family
	Shal_3429	SO3683	aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
	Shal_3430	SO3684	transcriptional regulator, TetR family
Position: -274 Score: 4.8 Sequence: AAGTGTGACACACATAACATTA Locus tag: Shal_0219 Name: fixA Funciton: electron transfer flavoprotein, beta subunit FixA Locus tag: Shal_0218 Name: fixB Funciton: electron transfer flavoprotein, alpha subunit FixB Locus tag: Shal_0217 Name: fixC Funciton: probable electron transfer flavoprotein-quinone oxidoreductase FixC (EC 1.5.5.-) Locus tag: Shal_0216 Name: fixX Funciton: ferredoxin-like protein FixX
	Shal_0219	fixA	electron transfer flavoprotein, beta subunit FixA
	Shal_0218	fixB	electron transfer flavoprotein, alpha subunit FixB
	Shal_0217	fixC	probable electron transfer flavoprotein-quinone oxidoreductase FixC (EC 1.5.5.-)
	Shal_0216	fixX	ferredoxin-like protein FixX
Position: -90 Score: 4.8 Sequence: AATTGTGACTGAGATCAAATTC Locus tag: Shal_3428 Name: null Funciton: hypothetical protein Locus tag: Shal_3427 Name: SO3681 Funciton: universal stress protein family Locus tag: Shal_3426 Name: Shewana3_3248 Funciton: UspA domain-containing protein
	Shal_3428		hypothetical protein
	Shal_3427	SO3681	universal stress protein family
	Shal_3426	Shewana3_3248	UspA domain-containing protein
Position: -250 Score: 4.5 Sequence: TAAAGAGATCGAGATCACACTA Position: -140 Score: 3.8 Sequence: TTAAGAGATGTTTATCGCAATC Locus tag: Shal_2750 Name: nadC Funciton: di-and tricarboxylate transporter
	Shal_2750	nadC	di-and tricarboxylate transporter
Position: -95 Score: 4 Sequence: TAAATTGATCTCGCTCAATTTT Locus tag: Shal_1924 Name: gloA Funciton: lactoylglutathione lyase (EC 4.4.1.5)
	Shal_1924	gloA	lactoylglutathione lyase (EC 4.4.1.5)
Position: -95 Score: 4.4 Sequence: TTATTTGACGCAGTTAACACAA Locus tag: Shal_2063 Name: apbE Funciton: thiamin biosynthesis lipoprotein ApbE
	Shal_2063	apbE	thiamin biosynthesis lipoprotein ApbE
Position: -86 Score: 4.7 Sequence: AACCGTGATCTAGTTAACAAAA Locus tag: Shal_1531 Name: phhA Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1) Locus tag: Shal_1532 Name: phhB Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
	Shal_1531	phhA	Phenylalanine-4-hydroxylase (EC 1.14.16.1)
	Shal_1532	phhB	Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
Position: -319 Score: 4.6 Sequence: AAGTGTGATCTGATTCTAACTT Locus tag: Shal_2672 Name: SO3090 Funciton: MoxR-like ATPase in aerotolerance operon Locus tag: Shal_2673 Name: SO3091 Funciton: Conserved hypothetical protein Locus tag: Shal_2674 Name: null Funciton: hypothetical protein Locus tag: Shal_2675 Name: SO3093 Funciton: von Willebrand factor type A domain protein Locus tag: Shal_2676 Name: SO3094 Funciton: TPR domain protein in aerotolerance operon Locus tag: Shal_2677 Name: SO3095 Funciton: hypothetical protein
	Shal_2672	SO3090	MoxR-like ATPase in aerotolerance operon
	Shal_2673	SO3091	Conserved hypothetical protein
	Shal_2674		hypothetical protein
	Shal_2675	SO3093	von Willebrand factor type A domain protein
	Shal_2676	SO3094	TPR domain protein in aerotolerance operon
	Shal_2677	SO3095	hypothetical protein
Position: -99 Score: 5.1 Sequence: TTATTTGACTTAGATCACAAAT Locus tag: Shal_1065 Name: cyaC Funciton: Adenylate cyclase (EC 4.6.1.1)
	Shal_1065	cyaC	Adenylate cyclase (EC 4.6.1.1)
Position: -207 Score: 4 Sequence: AAACGCGATATAAATCACTTTC Locus tag: Shal_1548 Name: SO3120 Funciton: oxidoreductase, Gfo/Idh/MocA family
	Shal_1548	SO3120	oxidoreductase, Gfo/Idh/MocA family
Position: -46 Score: 3.8 Sequence: TATTGCGACTCAATTAATACAT Locus tag: Shal_4287 Name: SO4743 Funciton: ferrichrome-iron receptor Locus tag: Shal_4286 Name: deoR Funciton: transcriptional regulator of glmS gene, DeoR family Locus tag: Shal_4285 Name: glmS Funciton: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
	Shal_4287	SO4743	ferrichrome-iron receptor
	Shal_4286	deoR	transcriptional regulator of glmS gene, DeoR family
	Shal_4285	glmS	glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Position: -92 Score: 3.7 Sequence: TAATATGAAAAAAAGCACAAAC Locus tag: Shal_2982 Name: map Funciton: methionine aminopeptidase (EC 3.4.11.18)
	Shal_2982	map	methionine aminopeptidase (EC 3.4.11.18)
Position: -247 Score: 3.7 Sequence: TTATATAATTTAGATCAAGGTT Position: -139 Score: 5 Sequence: AAATGTGATCGGATTCATACTT Locus tag: Shal_0482 Name: acnB Funciton: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99)
	Shal_0482	acnB	aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99)
Position: -230 Score: 4.4 Sequence: CAATTTGATGTAGTTCGAATAT Locus tag: Shal_4103 Name: scyA Funciton: cytochrome c-type protein
	Shal_4103	scyA	cytochrome c-type protein
Position: -96 Score: 3.8 Sequence: TAGCGTGAAGGGGATCATGCTT Locus tag: Shal_0533 Name: SO4138 Funciton: hypothetical protein
	Shal_0533	SO4138	hypothetical protein
Position: -234 Score: 4.1 Sequence: ATTTGGGATGAGTATCACGGAA Locus tag: Shal_1381 Name: cydA Funciton: cytochrome d ubiquinol oxidase, subunit I, CydA Locus tag: Shal_1382 Name: cydB Funciton: cytochrome d ubiquinol oxidase, subunit II, CydB
	Shal_1381	cydA	cytochrome d ubiquinol oxidase, subunit I, CydA
	Shal_1382	cydB	cytochrome d ubiquinol oxidase, subunit II, CydB
Position: -139 Score: 4 Sequence: TTTTGTGAGGTAGGTAAAGCTA Position: -97 Score: 3.8 Sequence: CCTCGTGATCTGTTTCATGTAA Locus tag: Shal_3525 Name: hemG Funciton: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) Locus tag: Shal_3524 Name: SO3719 Funciton: hypothetical protein
	Shal_3525	hemG	protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
	Shal_3524	SO3719	hypothetical protein
Position: -235 Score: 5.3 Sequence: AAGTGTGATATCGCTCACAAAA Locus tag: Shal_2707 Name: SO3719 Funciton: hypothetical protein
	Shal_2707	SO3719	hypothetical protein
Position: -137 Score: 4 Sequence: AAGCATGATCCCCTTCACGCTA Locus tag: Shal_0532 Name: Sputcn32_0539 Funciton: mechanosensitive ion channel
	Shal_0532	Sputcn32_0539	mechanosensitive ion channel
Position: -92 Score: 4.6 Sequence: AAGTGTGATCAGTTTAACCTTT Locus tag: Shal_0535 Name: udp Funciton: Uridine phosphorylase (EC 2.4.2.3)
	Shal_0535	udp	Uridine phosphorylase (EC 2.4.2.3)
Position: -111 Score: 4.3 Sequence: GAATGTGTTGTTGCTCACACTT Locus tag: Shal_0885 Name: narQ Funciton: Nitrate/nitrite sensor protein (EC 2.7.3.-) Locus tag: Shal_0884 Name: narP Funciton: Nitrate/nitrite response regulator protein
	Shal_0885	narQ	Nitrate/nitrite sensor protein (EC 2.7.3.-)
	Shal_0884	narP	Nitrate/nitrite response regulator protein
Position: -164 Score: 4.2 Sequence: AAGTATGACCCGCTTAACAAAA Locus tag: Shal_0116 Name: SO4520 Funciton: Oxygen-independent coproporphyrinogen III oxidase, putative
	Shal_0116	SO4520	Oxygen-independent coproporphyrinogen III oxidase, putative
Position: -225 Score: 3.9 Sequence: ATTTGATATCAATATCACTTTT Locus tag: Shal_1682 Name: SO2757 Funciton: Histidine permease YuiF
	Shal_1682	SO2757	Histidine permease YuiF
Position: -279 Score: 4.7 Sequence: AAGTGTGATCTGTGTCAAGTTT Position: -158 Score: 4.7 Sequence: AGTTGAGATATTTATCACATAA Locus tag: Shal_2777 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Shal_2776 Name: feoB Funciton: Ferrous iron transport protein B
	Shal_2777	feoA	Ferrous iron transport protein A
	Shal_2776	feoB	Ferrous iron transport protein B
Position: -199 Score: 4.2 Sequence: TTTTGAGGTTTATCTCACAATT Locus tag: Shal_1891 Name: SO2535 Funciton: Predicted glutamine amidotransferase
	Shal_1891	SO2535	Predicted glutamine amidotransferase
Position: -138 Score: 4.2 Sequence: AATGTTGAGCAAGATCACACTT Locus tag: Shal_2878 Name: atoB Funciton: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16) Locus tag: Shal_2877 Name: mmsA Funciton: methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) Locus tag: Shal_2876 Name: SO1679 Funciton: branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12) Locus tag: Shal_2875 Name: SO1680 Funciton: enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17) Locus tag: Shal_2874 Name: SO1681 Funciton: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4) Locus tag: Shal_2873 Name: mmsB Funciton: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) Locus tag: Shal_2872 Name: fabG Funciton: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
	Shal_2878	atoB	3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
	Shal_2877	mmsA	methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
	Shal_2876	SO1679	branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
	Shal_2875	SO1680	enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
	Shal_2874	SO1681	3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
	Shal_2873	mmsB	3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
	Shal_2872	fabG	3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
Position: -95 Score: 4.4 Sequence: AAATATTACCCCGATCACATAA Locus tag: Shal_4222 Name: cytcB Funciton: Cytochrome c4
	Shal_4222	cytcB	Cytochrome c4
Position: -210 Score: 4 Sequence: TAAAGTGATTTTTCTTGCAGAT Locus tag: Shal_1062 Name: SO1326 Funciton: COG1242: Predicted Fe-S oxidoreductase
	Shal_1062	SO1326	COG1242: Predicted Fe-S oxidoreductase
Position: -114 Score: 4.4 Sequence: AATAGTGAGCAATCTCACGTTT Locus tag: Shal_3068 Name: SO1539 Funciton: Probable acylaminoacyl-peptidase (EC 3.4.19.1)
	Shal_3068	SO1539	Probable acylaminoacyl-peptidase (EC 3.4.19.1)
Position: -96 Score: 4.7 Sequence: TTATGTGATCGGGGTAATATTT Locus tag: Shal_4221 Name: engB Funciton: GTP-binding protein EngB
	Shal_4221	engB	GTP-binding protein EngB
Position: -266 Score: 3.6 Sequence: TATTGCGGGGTTTGTCACGTTT Locus tag: Shal_1686 Name: SO2753 Funciton: prolyl endopeptidase (EC 3.4.21.26)
	Shal_1686	SO2753	prolyl endopeptidase (EC 3.4.21.26)
Position: -63 Score: 3.9 Sequence: AAATTAAAGCTAGATCACATTA Locus tag: Shal_2409 Name: hmgA Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
	Shal_2409	hmgA	Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Position: -133 Score: 5.1 Sequence: AAATGTGATCAACATCACGCTT Locus tag: Shal_3917 Name: hemC Funciton: Porphobilinogen deaminase (EC 2.5.1.61) Locus tag: Shal_3918 Name: hemD Funciton: Uroporphyrinogen-III synthase (EC 4.2.1.75) Locus tag: Shal_3919 Name: hemX Funciton: Homolog of E. coli HemX protein Locus tag: Shal_3920 Name: hemY Funciton: HemY domain-containing protein
	Shal_3917	hemC	Porphobilinogen deaminase (EC 2.5.1.61)
	Shal_3918	hemD	Uroporphyrinogen-III synthase (EC 4.2.1.75)
	Shal_3919	hemX	Homolog of E. coli HemX protein
	Shal_3920	hemY	HemY domain-containing protein
Position: -269 Score: 4.4 Sequence: TTGTGGGATCTAGGTAACATTT Locus tag: Shal_1245 Name: purE Funciton: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
	Shal_1245	purE	phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
Position: -163 Score: 4.3 Sequence: ATCTGTGAACCTTGTCGCATTT Locus tag: Shal_1059 Name: Sbal_1323 Funciton: HTH-type transcriptional regulator BetI Locus tag: Shal_1058 Name: Sbal_1324 Funciton: betaine aldehyde dehydrogenase (EC 1.2.1.8) Locus tag: Shal_1057 Name: Sbal_1325 Funciton: choline dehydrogenase (EC 1.1.99.1) Locus tag: Shal_1056 Name: Sden_0716 Funciton: predicted choline transporter BetT-II Locus tag: Shal_1055 Name: Sbal_1327 Funciton: conserved hypothetical protein 2001 Locus tag: Shal_1054 Name: marR Funciton: transcriptional regulator, MarR family
	Shal_1059	Sbal_1323	HTH-type transcriptional regulator BetI
	Shal_1058	Sbal_1324	betaine aldehyde dehydrogenase (EC 1.2.1.8)
	Shal_1057	Sbal_1325	choline dehydrogenase (EC 1.1.99.1)
	Shal_1056	Sden_0716	predicted choline transporter BetT-II
	Shal_1055	Sbal_1327	conserved hypothetical protein 2001
	Shal_1054	marR	transcriptional regulator, MarR family
Position: -160 Score: 4.3 Sequence: TTAAGCGATCTAGCTCTCAATT Locus tag: Shal_0823 Name: SO0919 Funciton: Serine transporter, putative Locus tag: Shal_0824 Name: Sfri_0687 Funciton: L-serine dehydratase (EC 4.3.1.17)
	Shal_0823	SO0919	Serine transporter, putative
	Shal_0824	Sfri_0687	L-serine dehydratase (EC 4.3.1.17)
Position: -105 Score: 4.2 Sequence: TATTGTAAACCACGTCGCAAAT Locus tag: Shal_0192 Name: null Funciton: hypothetical protein
	Shal_0192		hypothetical protein
Position: -110 Score: 3.9 Sequence: TAAAATGATGAGTGTCATAATT Locus tag: Shal_3794 Name: SO0572 Funciton: enoyl-CoA hydratase (EC 4.2.1.17)
	Shal_3794	SO0572	enoyl-CoA hydratase (EC 4.2.1.17)
Position: -81 Score: 3.9 Sequence: AACTGAGATCTTCATCTCATTC Locus tag: Shal_1783 Name: cdd Funciton: cytidine deaminase (EC 3.5.4.5)
	Shal_1783	cdd	cytidine deaminase (EC 3.5.4.5)
Position: -253 Score: 4.8 Sequence: GTTTGTGATGTCTATCACGTTT Locus tag: Shal_0678 Name: SO3895 Funciton: HesA/MoeB/ThiF family protein related to EC-YgdL
	Shal_0678	SO3895	HesA/MoeB/ThiF family protein related to EC-YgdL
Position: -306 Score: 5.5 Sequence: AATTGTGATGCGCGTCACAATT Position: -199 Score: 4.1 Sequence: ACTTGTGCTGTTTGTCACAATG Locus tag: Shal_1923 Name: null Funciton: TonB-dependent receptor
	Shal_1923		TonB-dependent receptor
Position: -130 Score: 4.6 Sequence: GATTGTGATCCGTATCAAACAA Locus tag: Shal_0478 Name: lpdA Funciton: Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
	Shal_0478	lpdA	Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
Position: -155 Score: 5 Sequence: TTATGTGATGATAATCAAAATT Locus tag: Shal_1832 Name: fadD1 Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
	Shal_1832	fadD1	Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Position: -177 Score: 5 Sequence: TTTTGTTATACCAATCACATAT Locus tag: Shal_0297 Name: menD Funciton: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) Locus tag: Shal_0296 Name: SO4574 Funciton: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) Locus tag: Shal_0295 Name: menC Funciton: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) Locus tag: Shal_0294 Name: SO4576 Funciton: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26)
	Shal_0297	menD	2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9)
	Shal_0296	SO4574	2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20)
	Shal_0295	menC	O-succinylbenzoate-CoA synthase (EC 4.2.1.-)
	Shal_0294	SO4576	O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26)
Position: -106 Score: 3.9 Sequence: ATTTGTGAGCCCGCTTGTATTT Locus tag: Shal_0072 Name: hutC Funciton: histidine utilization repressor Locus tag: Shal_0073 Name: hutU Funciton: urocanate hydratase (EC 4.2.1.49) Locus tag: Shal_0074 Name: hutH Funciton: histidine ammonia-lyase (EC 4.3.1.3)
	Shal_0072	hutC	histidine utilization repressor
	Shal_0073	hutU	urocanate hydratase (EC 4.2.1.49)
	Shal_0074	hutH	histidine ammonia-lyase (EC 4.3.1.3)
Position: -181 Score: 4.2 Sequence: TAGTTTGAACTAGATCAACTAT Position: -85 Score: 4.5 Sequence: AAATGTGATCTACTACTAATTT Locus tag: Shal_0099 Name: SO4503 Funciton: formate dehydrogenase chain D (EC 1.2.1.2) Locus tag: Shal_0098 Name: SO4502 Funciton: conserved domain protein
	Shal_0099	SO4503	formate dehydrogenase chain D (EC 1.2.1.2)
	Shal_0098	SO4502	conserved domain protein
Position: -162 Score: 4.3 Sequence: AAATGTGATGTTTAACTCAAAC Locus tag: Shal_2256 Name: fumB Funciton: Fumarate hydratase class I, aerobic (EC 4.2.1.2)
	Shal_2256	fumB	Fumarate hydratase class I, aerobic (EC 4.2.1.2)
Position: -74 Score: 3.7 Sequence: ATTTGAGCCTTGGCTCATAAAT Locus tag: Shal_2680 Name: putP Funciton: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter
	Shal_2680	putP	proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter
Position: -84 Score: 4.7 Sequence: AATTGTGAACAACATCACACAG Locus tag: Shal_1567 Name: SO2806 Funciton: hypothetical protein
	Shal_1567	SO2806	hypothetical protein
Position: -96 Score: 4 Sequence: TTTTGTGCACATCTTCAAACTT Locus tag: Shal_3986 Name: ygbA Funciton: nitrosative stress induced protein
	Shal_3986	ygbA	nitrosative stress induced protein
Position: -84 Score: 4.4 Sequence: CAGCGTGATCTACGTCACATTG Locus tag: Shal_1764 Name: SO2589 Funciton: isopenicillin N synthase
	Shal_1764	SO2589	isopenicillin N synthase
Position: -192 Score: 4.4 Sequence: ATTTGCGACGTGGTTTACAATA Position: -142 Score: 4.2 Sequence: AAATTTGATCTAGATCCTAGAT Locus tag: Shal_0193 Name: prlC Funciton: Oligopeptidase A (EC 3.4.24.70)
	Shal_0193	prlC	Oligopeptidase A (EC 3.4.24.70)
Position: -255 Score: 4.9 Sequence: AGTCGTGATCTAAATCACGTTT Locus tag: Shal_1109 Name: SO3421 Funciton: b-type cytochrome, putative
	Shal_1109	SO3421	b-type cytochrome, putative
Position: -102 Score: 4.3 Sequence: AAATGCGACCTAATTCAAGTAA Locus tag: Shal_3720 Name: modE Funciton: molybdate-binding domain of ModE
	Shal_3720	modE	molybdate-binding domain of ModE
Position: -81 Score: 4.3 Sequence: TATTGTGCTCACAGTTACATTT Locus tag: Shal_0228 Name: swp_4930 Funciton: transcriptional regulator, LysR family
	Shal_0228	swp_4930	transcriptional regulator, LysR family
Position: -235 Score: 4.7 Sequence: TTTTGTTACATGGATCGCATAT Locus tag: Shal_3818 Name: SO0543 Funciton: hypothetical protein
	Shal_3818	SO0543	hypothetical protein
Position: -119 Score: 3.9 Sequence: AAGTTAGAATCAGATCACACTT Locus tag: Shal_2671 Name: fadI Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) Locus tag: Shal_2670 Name: fadJ Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
	Shal_2671	fadI	3-ketoacyl-CoA thiolase (EC 2.3.1.16)
	Shal_2670	fadJ	Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
Position: -93 Score: 3.7 Sequence: AACAATGATACACTTCACAACT Locus tag: Shal_2336 Name: sodB Funciton: superoxide dismutase [Fe] (EC 1.15.1.1)
	Shal_2336	sodB	superoxide dismutase [Fe] (EC 1.15.1.1)
Position: -221 Score: 4.5 Sequence: AGATTTGATCTAGATCAACTTT Position: -178 Score: 4.6 Sequence: TTTTTTGATATAGCTCAAGTAT Locus tag: Shal_2197 Name: ccoN Funciton: Cbb3-type cytochrome c oxidase, subunit I, CcoN Locus tag: Shal_2198 Name: ccoO Funciton: Cbb3-type cytochrome c oxidase, subunit II, CcoO Locus tag: Shal_2199 Name: ccoQ Funciton: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ Locus tag: Shal_2200 Name: ccoP Funciton: Cbb3-type cytochrome c oxidase, subunit III, CcoP
	Shal_2197	ccoN	Cbb3-type cytochrome c oxidase, subunit I, CcoN
	Shal_2198	ccoO	Cbb3-type cytochrome c oxidase, subunit II, CcoO
	Shal_2199	ccoQ	Cbb3-type cytochrome c oxidase, subunit IV, CcoQ
	Shal_2200	ccoP	Cbb3-type cytochrome c oxidase, subunit III, CcoP
Position: -138 Score: 3.7 Sequence: AACTGGCATTCTGATCACATTT Locus tag: Shal_3610 Name: astC Funciton: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) Locus tag: Shal_3609 Name: astA Funciton: Arginine N-succinyltransferase (EC 2.3.1.109) Locus tag: Shal_3608 Name: astD Funciton: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) Locus tag: Shal_3607 Name: SO0620 Funciton: FIG008480: hypothetical protein
	Shal_3610	astC	Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
	Shal_3609	astA	Arginine N-succinyltransferase (EC 2.3.1.109)
	Shal_3608	astD	Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
	Shal_3607	SO0620	FIG008480: hypothetical protein
Position: -328 Score: 4.2 Sequence: AAATGAGAGGTTAATCACACAG Position: -250 Score: 4.7 Sequence: TAATGTGCTATCGGTCACAGAA Locus tag: Shal_3518 Name: SO0939 Funciton: split-soret diheme cytochrome c Locus tag: Shal_3517 Name: null Funciton: hypothetical protein
	Shal_3518	SO0939	split-soret diheme cytochrome c
	Shal_3517		hypothetical protein
Position: -134 Score: 4.4 Sequence: TTTTGTGATTAGTCGCACACTG Locus tag: Shal_0016 Name: fadB Funciton: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) Locus tag: Shal_0015 Name: fadA Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
	Shal_0016	fadB	enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
	Shal_0015	fadA	3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
Position: -114 Score: 4.5 Sequence: TAATGTGATCTAGCTTTAATTT Locus tag: Shal_2408 Name: hmgR Funciton: Tyrosine degradation transcriptional regulator, LysR family
	Shal_2408	hmgR	Tyrosine degradation transcriptional regulator, LysR family
Position: -161 Score: 5.1 Sequence: AAATGTGATCTTCATCGCCTTT Position: -111 Score: 4.8 Sequence: ATTTTTGATTCAGGTCAAATTT Locus tag: Shal_2887 Name: ompW Funciton: outer membrane protein W precursor
	Shal_2887	ompW	outer membrane protein W precursor
Position: -117 Score: 4.4 Sequence: TAGTGTGCTAGACCTCACGAAA Locus tag: Shal_0849 Name: cadC Funciton: transcriptional regulator-related protein Locus tag: Shal_0850 Name: null Funciton: hypothetical protein
	Shal_0849	cadC	transcriptional regulator-related protein
	Shal_0850		hypothetical protein
Position: -312 Score: 4.2 Sequence: AGTTGTTAACTGGATCTCAAAT Locus tag: Shal_2591 Name: Spea_1673 Funciton: hypothetical protein
	Shal_2591	Spea_1673	hypothetical protein
Position: -138 Score: 3.9 Sequence: GTTTGTGATCTACGTCTAATAG Position: -106 Score: 4.2 Sequence: TGTAGTGACACTGATCACGAAA Position: -94 Score: 4.1 Sequence: TTTGTTGATCTATCTCACGGTT Locus tag: Shal_3899 Name: frdA Funciton: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: Shal_3898 Name: fdrC2 Funciton: Fumarate reductase cytochrome b subunit Locus tag: Shal_3897 Name: frdA Funciton: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: Shal_3896 Name: frdB Funciton: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
	Shal_3899	frdA	Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
	Shal_3898	fdrC2	Fumarate reductase cytochrome b subunit
	Shal_3897	frdA	Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
	Shal_3896	frdB	Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
Position: -144 Score: 4.5 Sequence: CAGTGTGATTTATCTCACGCTA Locus tag: Shal_1534 Name: fahA Funciton: Fumarylacetoacetate hydrolase family protein Locus tag: Shal_1535 Name: maiA Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
	Shal_1534	fahA	Fumarylacetoacetate hydrolase family protein
	Shal_1535	maiA	Maleylacetoacetate isomerase (EC 5.2.1.2)
Position: -83 Score: 4.6 Sequence: AAACATGACCTAGATCACACTA Position: -58 Score: 3.8 Sequence: TAATGTGATTGGACTATTGTAA Locus tag: Shal_4284 Name: yfiA-2 Funciton: Ribosome hibernation protein YfiA
	Shal_4284	yfiA-2	Ribosome hibernation protein YfiA
Position: -76 Score: 4.6 Sequence: AAACGTGATTTAGATCACGACT Locus tag: Shal_1108 Name: yfiA-2 Funciton: Ribosome hibernation protein YfiA
	Shal_1108	yfiA-2	Ribosome hibernation protein YfiA
Position: -269 Score: 4.4 Sequence: TTGTGGGATCTAGGTAACATTT Locus tag: Shal_1245 Name: purE Funciton: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
	Shal_1245	purE	phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
Position: -80 Score: 4 Sequence: TAGTGTGATTGATATCTATAAT Locus tag: Shal_1587 Name: null Funciton: hypothetical protein
	Shal_1587		hypothetical protein
Position: -147 Score: 3.9 Sequence: AAATATGAGCTTGTTCCAAATT Locus tag: Shal_3535 Name: swp_4060 Funciton: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A
	Shal_3535	swp_4060	phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A
Position: -157 Score: 4.3 Sequence: TAATGTGATTTTCAGAATAATT Locus tag: Shal_2004 Name: swp_4060 Funciton: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A
	Shal_2004	swp_4060	phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A
Position: -248 Score: 3.8 Sequence: ATTTATAATGATAATCACAACT Locus tag: Shal_0790 Name: asnC Funciton: regulatory protein AsnC
	Shal_0790	asnC	regulatory protein AsnC
Position: -117 Score: 4.7 Sequence: TTAGGTGATCTGCCTCACAAAG Locus tag: Shal_3802 Name: Spea_3717 Funciton: hypothetical protein Locus tag: Shal_3801 Name: omp_Zn Funciton: zinc-regulated TonB-dependent outer membrane receptor Locus tag: Shal_3800 Name: znuA Funciton: zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Shal_3799 Name: znuB Funciton: zinc ABC transporter, inner membrane permease protein ZnuB
	Shal_3802	Spea_3717	hypothetical protein
	Shal_3801	omp_Zn	zinc-regulated TonB-dependent outer membrane receptor
	Shal_3800	znuA	zinc ABC transporter, periplasmic-binding protein ZnuA
	Shal_3799	znuB	zinc ABC transporter, inner membrane permease protein ZnuB
Position: -287 Score: 4.4 Sequence: TATTGTGACAAGACTCAACTTA Position: -110 Score: 4 Sequence: AATTGTGACCACAATCAATTTG Locus tag: Shal_0693 Name: Sputcn32_1188 Funciton: iron-sulfur cluster-binding protein Locus tag: Shal_0692 Name: Sputcn32_1189 Funciton: hypothetical protein
	Shal_0693	Sputcn32_1188	iron-sulfur cluster-binding protein
	Shal_0692	Sputcn32_1189	hypothetical protein
Position: -156 Score: 4.5 Sequence: TAATTTGACTGAGCGCACATTT Locus tag: Shal_2472 Name: null Funciton: cytochrome c3
	Shal_2472		cytochrome c3
Position: -183 Score: 4.5 Sequence: AACTGTGAATTGCTTCACAAAC Locus tag: Shal_3127 Name: psrA Funciton: polysulfide reductase, subunit A Locus tag: Shal_3126 Name: psrB Funciton: polysulfide reductase, subunit B Locus tag: Shal_3125 Name: psrC Funciton: polysulfide reductase, subunit C
	Shal_3127	psrA	polysulfide reductase, subunit A
	Shal_3126	psrB	polysulfide reductase, subunit B
	Shal_3125	psrC	polysulfide reductase, subunit C
Position: -305 Score: 4.5 Sequence: TTATGTGATAAATATCTCAACT Position: -184 Score: 4.6 Sequence: AAACTTGACACAGATCACACTT Locus tag: Shal_2778 Name: mtrD Funciton: periplasmic decaheme cytochrome c, MtrD Locus tag: Shal_2779 Name: mtrE Funciton: outer membrane protein, MtrE Locus tag: Shal_2780 Name: mtrF Funciton: surface localized decaheme cytochrome c lipoprotein, MtrF Locus tag: Shal_2781 Name: omcA Funciton: surface localized decaheme cytochrome c lipoprotein, OmcA
	Shal_2778	mtrD	periplasmic decaheme cytochrome c, MtrD
	Shal_2779	mtrE	outer membrane protein, MtrE
	Shal_2780	mtrF	surface localized decaheme cytochrome c lipoprotein, MtrF
	Shal_2781	omcA	surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -182 Score: 4.5 Sequence: AATCGTGATAAACCACACAAAA Locus tag: Shal_2000 Name: swp_4302 Funciton: hypothetical protein
	Shal_2000	swp_4302	hypothetical protein
Position: -169 Score: 4.5 Sequence: AGTAGTGATCTCGTGCACACAT Locus tag: Shal_0924 Name: purT Funciton: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-)
	Shal_0924	purT	phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-)
Position: -137 Score: 4 Sequence: AAGCATGATCCCCTTCACGCTA Locus tag: Shal_0532 Name: kefA Funciton: mechanosensitive ion channel
	Shal_0532	kefA	mechanosensitive ion channel
Position: -269 Score: 4.4 Sequence: TTGTGGGATCTAGGTAACATTT Locus tag: Shal_1245 Name: null Funciton: phosphoribosylaminoimidazole carboxylase, catalytic subunit Locus tag: Shal_1246 Name: SO3551 Funciton: RNA polymerase sigma-70 factor, ECF subfamily Locus tag: Shal_1247 Name: null Funciton: hypothetical protein
	Shal_1245		phosphoribosylaminoimidazole carboxylase, catalytic subunit
	Shal_1246	SO3551	RNA polymerase sigma-70 factor, ECF subfamily
	Shal_1247		hypothetical protein
Position: -265 Score: 4.2 Sequence: ATGTTTGAGCTAGATCACTCTT Locus tag: Shal_3007 Name: SO1603 Funciton: putative transcriptional regulator, inferred for PFA pathway Locus tag: Shal_3008 Name: SO1602 Funciton: omega-3 polyunsaturated fatty acid synthase subunit, PfaA Locus tag: Shal_3009 Name: Sputcn32_1325 Funciton: omega-3 polyunsaturated fatty acid synthase PfaB Locus tag: Shal_3010 Name: SO1599 Funciton: omega-3 polyunsaturated fatty acid synthase subunit, PfaC
	Shal_3007	SO1603	putative transcriptional regulator, inferred for PFA pathway
	Shal_3008	SO1602	omega-3 polyunsaturated fatty acid synthase subunit, PfaA
	Shal_3009	Sputcn32_1325	omega-3 polyunsaturated fatty acid synthase PfaB
	Shal_3010	SO1599	omega-3 polyunsaturated fatty acid synthase subunit, PfaC
Position: -150 Score: 4.4 Sequence: AAACATGATCTAGTCCACAATT Locus tag: Shal_0676 Name: omp35 Funciton: outer membrane porin
	Shal_0676	omp35	outer membrane porin
Position: -96 Score: 4.3 Sequence: TAAGGTGATCTCTTTCATGTTT Locus tag: Shal_1103 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: Shal_1104 Name: hcr Funciton: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1
	Shal_1103	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	Shal_1104	hcr	Flavodoxin reductases (ferredoxin-NADPH reductases) family 1
Position: -268 Score: 4.5 Sequence: TTCCGTGATCAATATCACCTTA Position: -40 Score: 3.7 Sequence: ATTTGAGATTCTATTTACAACT Locus tag: Shal_3174 Name: Spea_3089 Funciton: hypothetical protein
	Shal_3174	Spea_3089	hypothetical protein
Position: -212 Score: 3.9 Sequence: TTTTGTGACATAAACCGTACTA Position: -112 Score: 3.8 Sequence: ATATTCGAACTACATCAAATTG Locus tag: Shal_4104 Name: ccmA Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA Locus tag: Shal_4105 Name: ccmB Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit Locus tag: Shal_4106 Name: ccmC Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE Locus tag: Shal_4107 Name: ccmD Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE Locus tag: Shal_4108 Name: ccmE Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
	Shal_4104	ccmA	ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
	Shal_4105	ccmB	ABC transporter involved in cytochrome c biogenesis, CcmB subunit
	Shal_4106	ccmC	cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
	Shal_4107	ccmD	cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
	Shal_4108	ccmE	cytochrome c-type biogenesis protein CcmE, heme chaperone
Position: -100 Score: 3.6 Sequence: ATAATTGATTTGTATCAATGTT Locus tag: Shal_0300 Name: null Funciton: hypothetical protein Locus tag: Shal_0301 Name: nrfB Funciton: Cytochrome c-type protein NrfB precursor Locus tag: Shal_0302 Name: nrfC Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein Locus tag: Shal_0303 Name: nrfD-2 Funciton: nitrite reductase, quinol dehydrogenase component, NrfD
	Shal_0300		hypothetical protein
	Shal_0301	nrfB	Cytochrome c-type protein NrfB precursor
	Shal_0302	nrfC	4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
	Shal_0303	nrfD-2	nitrite reductase, quinol dehydrogenase component, NrfD
Position: -340 Score: 4.3 Sequence: TTTTGTGACCTCTCTAGCCTTT Locus tag: Shal_0551 Name: mccA Funciton: cytochrome c, putative
	Shal_0551	mccA	cytochrome c, putative
Position: -284 Score: 3.8 Sequence: TTTTGCGATTCAAAAAACGTTA Position: -262 Score: 3.9 Sequence: AGTTGTGATTTTTATATCTAAA Position: -159 Score: 4.1 Sequence: AAGTGTGCTGTAGCGCAGATTT Locus tag: Shal_0567 Name: mccA Funciton: cytochrome c, putative
	Shal_0567	mccA	cytochrome c, putative
Position: -286 Score: 4.5 Sequence: AAGTATGAATCCGATCACATTT Position: -178 Score: 3.7 Sequence: AACCTTGATCTAAATTATATAA Locus tag: Shal_0481 Name: yniC Funciton: 2-deoxyglucose-6-phosphate hydrolase YniC
	Shal_0481	yniC	2-deoxyglucose-6-phosphate hydrolase YniC
Position: -154 Score: 3.9 Sequence: AGTTGTGAAGTGTATCATTGTT Locus tag: Shal_2335 Name: ydhD Funciton: Probable monothiol glutaredoxin ydhD
	Shal_2335	ydhD	Probable monothiol glutaredoxin ydhD
Position: -106 Score: 5 Sequence: AAAAGTGATATAGAGCACATTA Locus tag: Shal_4095 Name: ppc Funciton: phosphoenolpyruvate carboxylase (EC 4.1.1.31) Locus tag: Shal_4096 Name: yceB Funciton: uncharacterized lipoprotein YceB precursor
	Shal_4095	ppc	phosphoenolpyruvate carboxylase (EC 4.1.1.31)
	Shal_4096	yceB	uncharacterized lipoprotein YceB precursor
Position: -264 Score: 4 Sequence: TTTTATTACATTTATCACGTAT Locus tag: Shal_2784 Name: mtrC Funciton: surface localized decaheme cytochrome c lipoprotein, MtrC Locus tag: Shal_2785 Name: mtrA Funciton: periplasmic decaheme cytochrome c, MtrA Locus tag: Shal_2786 Name: mtrB Funciton: outer membrane protein, MtrB
	Shal_2784	mtrC	surface localized decaheme cytochrome c lipoprotein, MtrC
	Shal_2785	mtrA	periplasmic decaheme cytochrome c, MtrA
	Shal_2786	mtrB	outer membrane protein, MtrB
Position: -56 Score: 4.3 Sequence: TATAGTGAGTTATATAAAATTT Locus tag: Shal_1124 Name: phk Funciton: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9)
	Shal_1124	phk	Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9)
Position: -269 Score: 4 Sequence: AATCGGGATTCACTTCACGCTA Position: -228 Score: 4.2 Sequence: CTTTGTGAGTTACGTCATACAA Position: -78 Score: 4.4 Sequence: TGGCGTGACTTAGTTCACCTTT Locus tag: Shal_3966 Name: SO1414 Funciton: flavocytochrome c flavin subunit Locus tag: Shal_3967 Name: SO1413 Funciton: flavocytochrome c heme subunit
	Shal_3966	SO1414	flavocytochrome c flavin subunit
	Shal_3967	SO1413	flavocytochrome c heme subunit
Position: -97 Score: 4.6 Sequence: CAATTTGATCGATATCACGTTT Locus tag: Shal_0534 Name: SO4134 Funciton: Protein of unknown function DUF465
	Shal_0534	SO4134	Protein of unknown function DUF465
Position: -156 Score: 4.1 Sequence: ATTCGCGACTTGGCTCACGAAT Position: -115 Score: 4.1 Sequence: CTGCGTGATCCAATTCAACTTT Locus tag: Shal_3970 Name: SO1410 Funciton: conserved domain protein
	Shal_3970	SO1410	conserved domain protein
Position: -319 Score: 3.9 Sequence: AAGAGTGATAAAAATCAAGCTA Position: -230 Score: 3.8 Sequence: TATCCTGATGAATGCCACAATT Locus tag: Shal_1258 Name: yfiA-1 Funciton: ribosomal subunit interface protein
	Shal_1258	yfiA-1	ribosomal subunit interface protein
Position: -94 Score: 4.1 Sequence: TTTGTTGATCTATCTCACGGTT Locus tag: Shal_3898 Name: fdrC Funciton: fumarate reductase cytochrome b subunit Locus tag: Shal_3897 Name: frdA Funciton: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: Shal_3896 Name: frdB Funciton: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
	Shal_3898	fdrC	fumarate reductase cytochrome b subunit
	Shal_3897	frdA	succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
	Shal_3896	frdB	succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
Position: -300 Score: 4.5 Sequence: TTACGTGACACGGATCACAGAG Position: -265 Score: 4.5 Sequence: AACTGTGATCAGTCTCACTAAT Locus tag: Shal_3083 Name: lldP Funciton: L-lactate permease Locus tag: Shal_3084 Name: dldD Funciton: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing
	Shal_3083	lldP	L-lactate permease
	Shal_3084	dldD	D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing
Position: -212 Score: 5 Sequence: TTACGTGATCTCCATCACCTTT Locus tag: Shal_2261 Name: hyaA Funciton: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) Locus tag: Shal_2262 Name: hyaB Funciton: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) Locus tag: Shal_2263 Name: hydC Funciton: Ni,Fe-hydrogenase I cytochrome b subunit Locus tag: Shal_2264 Name: hyaD Funciton: Hydrogenase maturation protease (EC 3.4.24.-) Locus tag: Shal_2265 Name: hyaE Funciton: NiFe hydrogenase assembly chaperone, HyaE Locus tag: Shal_2266 Name: hyaF Funciton: NiFe hydrogenase assembly protein, HypF
	Shal_2261	hyaA	Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
	Shal_2262	hyaB	Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
	Shal_2263	hydC	Ni,Fe-hydrogenase I cytochrome b subunit
	Shal_2264	hyaD	Hydrogenase maturation protease (EC 3.4.24.-)
	Shal_2265	hyaE	NiFe hydrogenase assembly chaperone, HyaE
	Shal_2266	hyaF	NiFe hydrogenase assembly protein, HypF
Position: -76 Score: 5.2 Sequence: AAATGTGATCCGTATTACATTT Locus tag: Shal_3240 Name: lipB Funciton: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase Locus tag: Shal_3241 Name: lipA Funciton: Lipoate synthase
	Shal_3240	lipB	Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase
	Shal_3241	lipA	Lipoate synthase
Position: -289 Score: 3.8 Sequence: AAGTGTGATCTAGATCTGTTAC Locus tag: Shal_0616 Name: SO4142 Funciton: cytochrome c family protein Locus tag: Shal_0615 Name: SO4143 Funciton: hypothetical protein Locus tag: Shal_0614 Name: SO4144 Funciton: octaheme tetrathionate reductase
	Shal_0616	SO4142	cytochrome c family protein
	Shal_0615	SO4143	hypothetical protein
	Shal_0614	SO4144	octaheme tetrathionate reductase
Position: -108 Score: 4.4 Sequence: AAAAGTGATATTGATATCAAAT Locus tag: Shal_1683 Name: Swoo_2741 Funciton: Alkyl hydroperoxide reductase subunit C-like protein
	Shal_1683	Swoo_2741	Alkyl hydroperoxide reductase subunit C-like protein
Position: -114 Score: 3.8 Sequence: TTTTGTGCTGTTTTTTATAAAG Locus tag: Shal_0442 Name: SO4232 Funciton: long-chain fatty acid transport protein Locus tag: Shal_0443 Name: Sden_0341 Funciton: hypothetical protein Locus tag: Shal_0444 Name: glpK Funciton: glycerol kinase (EC 2.7.1.30)
	Shal_0442	SO4232	long-chain fatty acid transport protein
	Shal_0443	Sden_0341	hypothetical protein
	Shal_0444	glpK	glycerol kinase (EC 2.7.1.30)
Position: -222 Score: 4.3 Sequence: TGGCGTGATAACTGTCACAAAA Locus tag: Shal_0122 Name: moaA Funciton: molybdenum cofactor biosynthesis protein MoaA Locus tag: Shal_0123 Name: moaB Funciton: molybdenum cofactor biosynthesis protein MoaB Locus tag: Shal_0124 Name: moaC Funciton: molybdenum cofactor biosynthesis protein MoaC Locus tag: Shal_0125 Name: moaD Funciton: molybdenum cofactor biosynthesis protein MoaD Locus tag: Shal_0126 Name: moaE Funciton: molybdenum cofactor biosynthesis protein MoaE Locus tag: Shal_0127 Name: modA Funciton: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) Locus tag: Shal_0128 Name: modB Funciton: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Shal_0129 Name: modC Funciton: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	Shal_0122	moaA	molybdenum cofactor biosynthesis protein MoaA
	Shal_0123	moaB	molybdenum cofactor biosynthesis protein MoaB
	Shal_0124	moaC	molybdenum cofactor biosynthesis protein MoaC
	Shal_0125	moaD	molybdenum cofactor biosynthesis protein MoaD
	Shal_0126	moaE	molybdenum cofactor biosynthesis protein MoaE
	Shal_0127	modA	molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
	Shal_0128	modB	molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	Shal_0129	modC	molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Position: -46 Score: 3.9 Sequence: AAGATGGATCTGAATCACAAAA Locus tag: Shal_0903 Name: mdh Funciton: malate dehydrogenase (EC 1.1.1.37)
	Shal_0903	mdh	malate dehydrogenase (EC 1.1.1.37)
Position: -250 Score: 4 Sequence: CAGTGTGCGACTAATCACAAAA Locus tag: Shal_0017 Name: pepQ Funciton: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) Locus tag: Shal_0018 Name: SO0023 Funciton: FIG000605: protein co-occurring with transport systems (COG1739) Locus tag: Shal_0019 Name: trkH-1 Funciton: potassium uptake protein TrkH Locus tag: Shal_0020 Name: hemG Funciton: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
	Shal_0017	pepQ	Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
	Shal_0018	SO0023	FIG000605: protein co-occurring with transport systems (COG1739)
	Shal_0019	trkH-1	potassium uptake protein TrkH
	Shal_0020	hemG	protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
Position: -301 Score: 4 Sequence: TAGCTTGATTTTTATCACTCTT Position: -140 Score: 4.2 Sequence: ATTTGAGAGCTATATCGCAGTT Locus tag: Shal_1257 Name: SO3406 Funciton: FIG024006: iron uptake protein Locus tag: Shal_1256 Name: SO3407 Funciton: FIG138928: iron-regulated membrane protein Locus tag: Shal_1255 Name: SO3408 Funciton: FIG016502: iron uptake protein
	Shal_1257	SO3406	FIG024006: iron uptake protein
	Shal_1256	SO3407	FIG138928: iron-regulated membrane protein
	Shal_1255	SO3408	FIG016502: iron uptake protein
Position: -64 Score: 5.1 Sequence: ATTTGTGACTCTGGTCACAAAT Locus tag: Shal_2329 Name: SO2871 Funciton: arsenate reductase (EC 1.20.4.1) Locus tag: Shal_2330 Name: SO2872 Funciton: hypothetical protein
	Shal_2329	SO2871	arsenate reductase (EC 1.20.4.1)
	Shal_2330	SO2872	hypothetical protein
Position: -70 Score: 4.3 Sequence: AATTGTGAGATAAACCTCAAAA Locus tag: Shal_1890 Name: fadE2 Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
	Shal_1890	fadE2	Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Position: -281 Score: 3.9 Sequence: TTTCGTGATCAGTGTCACTACA Position: -249 Score: 3.7 Sequence: CTATTAGACGTAGATCACAAAC Locus tag: Shal_3900 Name: prmA Funciton: ribosomal protein L11 methyltransferase (EC 2.1.1.-) Locus tag: Shal_3901 Name: nifR3 Funciton: tRNA dihydrouridine synthase B (EC 1.-.-.-) Locus tag: Shal_3902 Name: fis Funciton: DNA-binding protein Fis
	Shal_3900	prmA	ribosomal protein L11 methyltransferase (EC 2.1.1.-)
	Shal_3901	nifR3	tRNA dihydrouridine synthase B (EC 1.-.-.-)
	Shal_3902	fis	DNA-binding protein Fis
Position: -216 Score: 4.5 Sequence: TTAAGTGATTTGTATCGCCATA Position: -119 Score: 4.8 Sequence: AATAGTGAGGTGGGTCACAAAT Locus tag: Shal_3336 Name: Shew_1222 Funciton: hypothetical protein
	Shal_3336	Shew_1222	hypothetical protein
Position: -180 Score: 4.2 Sequence: TTTTGTGACAGTTATCACGCCA Locus tag: Shal_0121 Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
	Shal_0121	etfD	Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Position: -127 Score: 3.7 Sequence: CAGCGTGATTACAGTCGCACTT Locus tag: Shal_3187 Name: nqrA-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) Locus tag: Shal_3186 Name: nqrB-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) Locus tag: Shal_3185 Name: nqrC-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) Locus tag: Shal_3184 Name: nqrD-1 Funciton: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) Locus tag: Shal_3183 Name: nqrE-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) Locus tag: Shal_3182 Name: nqrF-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
	Shal_3187	nqrA-2	Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
	Shal_3186	nqrB-2	Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
	Shal_3185	nqrC-2	Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
	Shal_3184	nqrD-1	Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
	Shal_3183	nqrE-2	Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
	Shal_3182	nqrF-2	Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Crp in Shewanella halifaxensis HAW-EB4

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --