Orthologous regulated operons containing SO4142 gene

Properties
Regulog:	Crp - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria

Built upon 2713 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -268 Score: 3.8573 Sequence: AAACGTCACATAGATCACACAC Locus tag: Sama_3178 Name: SO4142 Funciton: cytochrome c family protein Locus tag: Sama_3179 Name: SO4143 Funciton: hypothetical protein Locus tag: Sama_3180 Name: SO4144 Funciton: octaheme tetrathionate reductase
SO4142-SO4143-SO4144	-268	3.9	AAACGTCACATAGATCACACAC	Sama_3178
Shewanella frigidimarina NCIMB 400
Position: -112 Score: 4.02774 Sequence: GGATATGATCTACTTCAAATTA Locus tag: Sfri_3554 Name: SO4142 Funciton: cytochrome c family protein Locus tag: Sfri_3555 Name: SO4143 Funciton: hypothetical protein Locus tag: Sfri_3556 Name: SO4144 Funciton: octaheme tetrathionate reductase
SO4142-SO4143-SO4144	-112	4	GGATATGATCTACTTCAAATTA	Sfri_3554
Shewanella halifaxensis HAW-EB4
Position: -289 Score: 3.78179 Sequence: AAGTGTGATCTAGATCTGTTAC Locus tag: Shal_0616 Name: SO4142 Funciton: cytochrome c family protein Locus tag: Shal_0615 Name: SO4143 Funciton: hypothetical protein Locus tag: Shal_0614 Name: SO4144 Funciton: octaheme tetrathionate reductase
SO4142-SO4143-SO4144	-289	3.8	AAGTGTGATCTAGATCTGTTAC	Shal_0616
Shewanella loihica PV-4
Position: -113 Score: 4.08943 Sequence: GAAGGTGATCAACATCAAATTT Locus tag: Shew_0516 Name: SO4142 Funciton: cytochrome c family protein Locus tag: Shew_0515 Name: SO4143 Funciton: hypothetical protein Locus tag: Shew_0514 Name: SO4144 Funciton: octaheme tetrathionate reductase
SO4142-SO4143-SO4144	-113	4.1	GAAGGTGATCAACATCAAATTT	Shew_0516
Shewanella oneidensis MR-1
Position: -121 Score: 3.92872 Sequence: GAAAGTGACACACCTCAAATAA Locus tag: SO4142 Name: SO4142 Funciton: cytochrome c family protein Locus tag: SO4143 Name: SO4143 Funciton: hypothetical protein Locus tag: SO4144 Name: SO4144 Funciton: octaheme tetrathionate reductase
SO4142-SO4143-SO4144	-121	3.9	GAAAGTGACACACCTCAAATAA	SO4142
Shewanella piezotolerans WP3
Position: -133 Score: 3.98105 Sequence: GAAAGTGATCGAGCTCAACTAT Locus tag: swp_4577 Name: SO4142 Funciton: cytochrome c family protein Locus tag: swp_4578 Name: SO4143 Funciton: hypothetical protein Locus tag: swp_4579 Name: SO4144 Funciton: octaheme tetrathionate reductase
SO4142-SO4143-SO4144	-133	4	GAAAGTGATCGAGCTCAACTAT	swp_4577
Shewanella sediminis HAW-EB3
Position: -112 Score: 4.68668 Sequence: AAAGGTGATCAACATCAAATTT Locus tag: Ssed_4058 Name: SO4142 Funciton: cytochrome c family protein Locus tag: Ssed_4059 Name: SO4143 Funciton: hypothetical protein Locus tag: Ssed_4060 Name: SO4144 Funciton: octaheme tetrathionate reductase
SO4142-SO4143-SO4144	-112	4.7	AAAGGTGATCAACATCAAATTT	Ssed_4058
Shewanella sp ANA-3
Position: -118 Score: 4.18536 Sequence: GAAAGTGATACACCTCAAATAA Locus tag: Shewana3_3688 Name: SO4142 Funciton: cytochrome c family protein Locus tag: Shewana3_3689 Name: SO4143 Funciton: hypothetical protein Locus tag: Shewana3_3690 Name: SO4144 Funciton: octaheme tetrathionate reductase
SO4142-SO4143-SO4144	-118	4.2	GAAAGTGATACACCTCAAATAA	Shewana3_3688
Shewanella sp MR-4
Position: -118 Score: 4.18536 Sequence: GAAAGTGATACACCTCAAATAA Locus tag: Shewmr4_3511 Name: SO4142 Funciton: cytochrome c family protein Locus tag: Shewmr4_3512 Name: SO4143 Funciton: hypothetical protein Locus tag: Shewmr4_3513 Name: SO4144 Funciton: octaheme tetrathionate reductase
SO4142-SO4143-SO4144	-118	4.2	GAAAGTGATACACCTCAAATAA	Shewmr4_3511
Shewanella sp MR-7
Position: -122 Score: 4.00757 Sequence: GAAGGTGATACACCTCAAATAA Locus tag: Shewmr7_0441 Name: SO4142 Funciton: cytochrome c family protein Locus tag: Shewmr7_0440 Name: SO4143 Funciton: hypothetical protein Locus tag: Shewmr7_0439 Name: SO4144 Funciton: octaheme tetrathionate reductase
SO4142-SO4143-SO4144	-122	4	GAAGGTGATACACCTCAAATAA	Shewmr7_0441

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing SO4142 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --