Regulon of Crp in Shewanella sp MR-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr4_0618
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Regulog:	Crp - Shewanellaceae
Statistics of regulated genes:
- Genes	346
- Operons	181
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2713 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - CRP
By effector - Cyclic 3',5'-AMP
By pathway - Carbon catabolism

Regulated operons
	Locus Tag	Name	Function
Position: -315 Score: 3.9 Sequence: AAGTATGAATCAGGTCACACTC Locus tag: Shewmr4_0436 Name: yniC Funciton: 2-deoxyglucose-6-phosphate hydrolase YniC
	Shewmr4_0436	yniC	2-deoxyglucose-6-phosphate hydrolase YniC
Position: -241 Score: 4.9 Sequence: AAACGAGATCTAAATCACATTT Locus tag: Shewmr4_1133 Name: SO3421 Funciton: b-type cytochrome, putative
	Shewmr4_1133	SO3421	b-type cytochrome, putative
Position: -135 Score: 3.9 Sequence: AAGTTAGAATCAGATCACACTT Locus tag: Shewmr4_1407 Name: fadI Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) Locus tag: Shewmr4_1408 Name: fadJ Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
	Shewmr4_1407	fadI	3-ketoacyl-CoA thiolase (EC 2.3.1.16)
	Shewmr4_1408	fadJ	Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
Position: -177 Score: 4.2 Sequence: GTTAGTGATGGCGATCACAAAC Locus tag: Shewmr4_2182 Name: SO2586 Funciton: inactive homolog of metal-dependent proteases, putative molecular chaperone Locus tag: Shewmr4_2181 Name: SO2585 Funciton: hypothetical protein Locus tag: Shewmr4_2180 Name: SO2584 Funciton: Tlr1621 protein
	Shewmr4_2182	SO2586	inactive homolog of metal-dependent proteases, putative molecular chaperone
	Shewmr4_2181	SO2585	hypothetical protein
	Shewmr4_2180	SO2584	Tlr1621 protein
Position: -77 Score: 3.8 Sequence: AAGCGTGAACTTAAGCACACTC Locus tag: Shewmr4_0442 Name: SO0439 Funciton: hypothetical protein
	Shewmr4_0442	SO0439	hypothetical protein
Position: -273 Score: 4.3 Sequence: CAATGTGAGCTAGTTAACATCA Locus tag: Shewmr4_1059 Name: SO1247 Funciton: hypothetical protein
	Shewmr4_1059	SO1247	hypothetical protein
Position: -109 Score: 4 Sequence: AAAATCGATTTTGCTCACACTA Locus tag: Shewmr4_2868 Name: SO1328 Funciton: transcriptional regulator, LysR family
	Shewmr4_2868	SO1328	transcriptional regulator, LysR family
Position: -134 Score: 4.5 Sequence: TAATGTGACAAAGATTAAATTA Locus tag: Shewmr4_3245 Name: SO3914 Funciton: ferrichrome-iron receptor Locus tag: Shewmr4_3244 Name: piuC Funciton: iron-uptake factor PiuC
	Shewmr4_3245	SO3914	ferrichrome-iron receptor
	Shewmr4_3244	piuC	iron-uptake factor PiuC
Position: -80 Score: 4.8 Sequence: AAATTTGAGCTTGATCACACTA Locus tag: Shewmr4_0094 Name: Shewana3_0095 Funciton: hypothetical protein
	Shewmr4_0094	Shewana3_0095	hypothetical protein
Position: -113 Score: 4.1 Sequence: AAATGTGCGATGAGTAACAAAA Locus tag: Shewmr4_0582 Name: bfd Funciton: bacterioferritin-associated ferredoxin
	Shewmr4_0582	bfd	bacterioferritin-associated ferredoxin
Position: -261 Score: 4.2 Sequence: AGTTGTGATCTTTGGCGCGTAT Locus tag: Shewmr4_1156 Name: SO3395 Funciton: hypothetical protein
	Shewmr4_1156	SO3395	hypothetical protein
Position: -241 Score: 3.8 Sequence: ATTCGTGAGTTATCTCGTGAAT Position: -94 Score: 4 Sequence: TGATGTGAGCTTAATCCCGATT Locus tag: Shewmr4_0298 Name: SO1415 Funciton: transcriptional regulator, TetR family
	Shewmr4_0298	SO1415	transcriptional regulator, TetR family
Position: -292 Score: 3.8 Sequence: AAGTTTGAACCTTAGCAAAATT Locus tag: Shewmr4_3002 Name: SO3588 Funciton: gpr1/fun34/yaaH family protein
	Shewmr4_3002	SO3588	gpr1/fun34/yaaH family protein
Position: -249 Score: 3.7 Sequence: TATTGTGAGTTAGGTCATGTCG Position: -60 Score: 4.1 Sequence: AAAAATGAACTAGATCAAAATA Locus tag: Shewmr4_2909 Name: SO1278 Funciton: methyl-accepting chemotaxis protein
	Shewmr4_2909	SO1278	methyl-accepting chemotaxis protein
Position: -246 Score: 3.8 Sequence: CAATGTGCATCAACGCACATTA Locus tag: Shewmr4_0783 Name: cadC Funciton: transcriptional regulator-related protein Locus tag: Shewmr4_0784 Name: SO0941 Funciton: hypothetical protein
	Shewmr4_0783	cadC	transcriptional regulator-related protein
	Shewmr4_0784	SO0941	hypothetical protein
Position: -135 Score: 3.9 Sequence: AAGTGTGACCTAAATCTAGTTG Locus tag: Shewmr4_1038 Name: deoA Funciton: thymidine phosphorylase (EC 2.4.2.4) Locus tag: Shewmr4_1039 Name: deoB Funciton: phosphopentomutase (EC 5.4.2.7) Locus tag: Shewmr4_1040 Name: deoD-2 Funciton: purine nucleoside phosphorylase (EC 2.4.2.1)
	Shewmr4_1038	deoA	thymidine phosphorylase (EC 2.4.2.4)
	Shewmr4_1039	deoB	phosphopentomutase (EC 5.4.2.7)
	Shewmr4_1040	deoD-2	purine nucleoside phosphorylase (EC 2.4.2.1)
Position: -149 Score: 3.9 Sequence: AACTTTGATCCCGATCGACTAT Locus tag: Shewmr4_0705 Name: napD Funciton: periplasmic nitrate reductase component NapD Locus tag: Shewmr4_0704 Name: napA Funciton: periplasmic nitrate reductase precursor (EC 1.7.99.4) Locus tag: Shewmr4_0703 Name: napG Funciton: ferredoxin-type protein NapG (periplasmic nitrate reductase) Locus tag: Shewmr4_0702 Name: napH Funciton: polyferredoxin NapH (periplasmic nitrate reductase) Locus tag: Shewmr4_0701 Name: napB Funciton: nitrate reductase cytochrome c550-type subunit
	Shewmr4_0705	napD	periplasmic nitrate reductase component NapD
	Shewmr4_0704	napA	periplasmic nitrate reductase precursor (EC 1.7.99.4)
	Shewmr4_0703	napG	ferredoxin-type protein NapG (periplasmic nitrate reductase)
	Shewmr4_0702	napH	polyferredoxin NapH (periplasmic nitrate reductase)
	Shewmr4_0701	napB	nitrate reductase cytochrome c550-type subunit
Position: -150 Score: 4.2 Sequence: AAATGTTATCTTTATCACTCAG Locus tag: Shewmr4_2806 Name: SO1389 Funciton: ROK family protein, in a cluster with chitinase
	Shewmr4_2806	SO1389	ROK family protein, in a cluster with chitinase
Position: -233 Score: 4.2 Sequence: CTGAGTGATAAAGATAACATTT Locus tag: Shewmr4_2807 Name: SO1388 Funciton: Xaa-Pro aminopeptidase (EC 3.4.11.9)
	Shewmr4_2807	SO1388	Xaa-Pro aminopeptidase (EC 3.4.11.9)
Position: -85 Score: 5 Sequence: AGATGTGACTTGCCTCACAATT Locus tag: Shewmr4_1141 Name: swp_3747 Funciton: hypothetical protein
	Shewmr4_1141	swp_3747	hypothetical protein
Position: -103 Score: 4.8 Sequence: TTAGGTGATCTTTGTCACAAAT Locus tag: Shewmr4_1561 Name: yceI Funciton: hypothetical protein Locus tag: Shewmr4_1562 Name: SO2891 Funciton: type IIA topoisomerase, B subunit
	Shewmr4_1561	yceI	hypothetical protein
	Shewmr4_1562	SO2891	type IIA topoisomerase, B subunit
Position: -132 Score: 3.7 Sequence: CACTATGATCTGCTTCTAATTT Position: -103 Score: 3.7 Sequence: TAATGAGCCCCGCTTCAAACTT Locus tag: Shewmr4_0602 Name: petA Funciton: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) Locus tag: Shewmr4_0603 Name: petB Funciton: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) Locus tag: Shewmr4_0604 Name: petC Funciton: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit Locus tag: Shewmr4_0605 Name: sspA Funciton: stringent starvation protein A Locus tag: Shewmr4_0606 Name: sspB Funciton: stringent starvation protein B
	Shewmr4_0602	petA	ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2)
	Shewmr4_0603	petB	ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2)
	Shewmr4_0604	petC	ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit
	Shewmr4_0605	sspA	stringent starvation protein A
	Shewmr4_0606	sspB	stringent starvation protein B
Position: -136 Score: 4.1 Sequence: TTCCTTGATTTAGATCACACTC Locus tag: Shewmr4_2656 Name: null Funciton: hypothetical protein
	Shewmr4_2656		hypothetical protein
Position: -208 Score: 3.9 Sequence: AAATGTGATCTACGCCTAAATG Locus tag: Shewmr4_1606 Name: icd Funciton: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
	Shewmr4_1606	icd	isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
Position: -161 Score: 4.1 Sequence: TTTCGTGAGCTAGATTAGATAT Locus tag: Shewmr4_0134 Name: SO0141 Funciton: sensory box/GGDEF family protein
	Shewmr4_0134	SO0141	sensory box/GGDEF family protein
Position: -96 Score: 4.5 Sequence: AAGTGTGATACTTGCCACAAAA Locus tag: Shewmr4_2587 Name: SO1689 Funciton: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4)
	Shewmr4_2587	SO1689	lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -63 Score: 3.8 Sequence: TATTTTGATATTGAATAAAATA Position: -34 Score: 3.8 Sequence: TGATGTGCCAGTGTTCAAATAG Position: -2 Score: 4 Sequence: TTATGTTATTATTGCCACAAAA Locus tag: Shewmr4_1682 Name: ycbW Funciton: probable membrane protein YcbW
	Shewmr4_1682	ycbW	probable membrane protein YcbW
Position: -101 Score: 4.7 Sequence: TTATGCGAGCGGAATCACATTT Locus tag: Shewmr4_2417 Name: SO2797 Funciton: glutaredoxin
	Shewmr4_2417	SO2797	glutaredoxin
Position: -144 Score: 4.2 Sequence: AGTCGCGACTTTGTTCACAATT Locus tag: Shewmr4_1036 Name: tsx Funciton: nucleoside-specific channel-forming protein, Tsx
	Shewmr4_1036	tsx	nucleoside-specific channel-forming protein, Tsx
Position: -316 Score: 4.6 Sequence: TTTTCTGACGCCGCTCACATTA Locus tag: Shewmr4_3822 Name: Sputcn32_3857 Funciton: hypothetical protein Locus tag: Shewmr4_3823 Name: Sputcn32_3858 Funciton: cytochrome O ubiquinol oxidase subunit II (EC 1.10.3.-) Locus tag: Shewmr4_3824 Name: Sputcn32_3859 Funciton: cytochrome O ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: Shewmr4_3825 Name: Sputcn32_3860 Funciton: cytochrome O ubiquinol oxidase subunit III (EC 1.10.3.-) Locus tag: Shewmr4_3826 Name: Sputcn32_3861 Funciton: cytochrome O ubiquinol oxidase subunit IV (EC 1.10.3.-) Locus tag: Shewmr4_3827 Name: Sputcn32_3862 Funciton: heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
	Shewmr4_3822	Sputcn32_3857	hypothetical protein
	Shewmr4_3823	Sputcn32_3858	cytochrome O ubiquinol oxidase subunit II (EC 1.10.3.-)
	Shewmr4_3824	Sputcn32_3859	cytochrome O ubiquinol oxidase subunit I (EC 1.10.3.-)
	Shewmr4_3825	Sputcn32_3860	cytochrome O ubiquinol oxidase subunit III (EC 1.10.3.-)
	Shewmr4_3826	Sputcn32_3861	cytochrome O ubiquinol oxidase subunit IV (EC 1.10.3.-)
	Shewmr4_3827	Sputcn32_3862	heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Position: -225 Score: 3.8 Sequence: ATGCGTGATCCGTCGCAATTAT Position: -131 Score: 3.9 Sequence: TTTGATGATCCACCTCAAACAA Locus tag: Shewmr4_3715 Name: null Funciton: hypothetical protein Locus tag: Shewmr4_3716 Name: SO4505 Funciton: hypothetical protein probably related to Formate dehydrogenase function Locus tag: Shewmr4_3717 Name: SO4506 Funciton: iron-sulfur cluster-binding protein Locus tag: Shewmr4_3718 Name: SO4507 Funciton: putative formate dehydrogenase-specific chaperone Locus tag: Shewmr4_3719 Name: SO4508 Funciton: formate dehydrogenase subunit or accessory protein Locus tag: Shewmr4_3720 Name: SO4509 Funciton: formate dehydrogenase-O, major subunit (EC 1.2.1.2) Locus tag: Shewmr4_3721 Name: fdhB-1 Funciton: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) Locus tag: Shewmr4_3722 Name: SO4511 Funciton: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2)
	Shewmr4_3715		hypothetical protein
	Shewmr4_3716	SO4505	hypothetical protein probably related to Formate dehydrogenase function
	Shewmr4_3717	SO4506	iron-sulfur cluster-binding protein
	Shewmr4_3718	SO4507	putative formate dehydrogenase-specific chaperone
	Shewmr4_3719	SO4508	formate dehydrogenase subunit or accessory protein
	Shewmr4_3720	SO4509	formate dehydrogenase-O, major subunit (EC 1.2.1.2)
	Shewmr4_3721	fdhB-1	formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2)
	Shewmr4_3722	SO4511	formate dehydrogenase -O, gamma subunit (EC 1.2.1.2)
Position: -125 Score: 4.1 Sequence: AATTGTGCCGGATATCACTTTC Locus tag: Shewmr4_2393 Name: null Funciton: hypothetical protein
	Shewmr4_2393		hypothetical protein
Position: -149 Score: 3.8 Sequence: CTCAATGATCCAGCTCACACTT Locus tag: Shewmr4_0152 Name: pckA Funciton: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
	Shewmr4_0152	pckA	phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
Position: -66 Score: 3.9 Sequence: TTACGTGACTTACAGCACGTCT Locus tag: Shewmr4_3188 Name: sfcA Funciton: NAD-dependent malic enzyme (EC 1.1.1.38)
	Shewmr4_3188	sfcA	NAD-dependent malic enzyme (EC 1.1.1.38)
Position: -83 Score: 4.1 Sequence: TCTTGTGACCTAGTTCACGCCT Locus tag: Shewmr4_0652 Name: SO3987 Funciton: hypothetical protein
	Shewmr4_0652	SO3987	hypothetical protein
Position: -312 Score: 4.2 Sequence: TATTGTAATTTAATCAACATTT Locus tag: Shewmr4_3492 Name: SO4118 Funciton: NADP-dependent malic enzyme (EC 1.1.1.40) Locus tag: Shewmr4_3491 Name: mshH Funciton: MSHA biogenesis protein MshH, GGDEF:EAL domain protein Locus tag: Shewmr4_3490 Name: mshI Funciton: MSHA biogenesis protein MshI
	Shewmr4_3492	SO4118	NADP-dependent malic enzyme (EC 1.1.1.40)
	Shewmr4_3491	mshH	MSHA biogenesis protein MshH, GGDEF:EAL domain protein
	Shewmr4_3490	mshI	MSHA biogenesis protein MshI
Position: -128 Score: 4.1 Sequence: AAGCGTGATGGATTTTGCAAAA Locus tag: Shewmr4_3804 Name: yhgI Funciton: NfuA Fe-S protein maturation
	Shewmr4_3804	yhgI	NfuA Fe-S protein maturation
Position: -141 Score: 4.2 Sequence: CAATGTGAGCGGCTTCAAATTG Locus tag: Shewmr4_3123 Name: SO3776 Funciton: hypothetical protein
	Shewmr4_3123	SO3776	hypothetical protein
Position: -255 Score: 4.1 Sequence: AAGTGTGATCAAGATCGCGTGT Position: -234 Score: 4.3 Sequence: TTTTTTGATTCAGATCAAAGAC Locus tag: Shewmr4_1834 Name: rplY Funciton: LSU ribosomal protein L25p
	Shewmr4_1834	rplY	LSU ribosomal protein L25p
Position: -120 Score: 4.4 Sequence: TAGAGTGAGATTAATCACAGTT Locus tag: Shewmr4_3034 Name: fkpA Funciton: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8)
	Shewmr4_3034	fkpA	FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8)
Position: -132 Score: 4.4 Sequence: TATAGTGTTGTCCGTCACATTT Locus tag: Shewmr4_3122 Name: SO3774 Funciton: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
	Shewmr4_3122	SO3774	proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
Position: -53 Score: 4.5 Sequence: TTTTGTTATACTCGTCACCTTT Locus tag: Shewmr4_3138 Name: SO3797 Funciton: probable collagenase (EC 3.4.24.3)
	Shewmr4_3138	SO3797	probable collagenase (EC 3.4.24.3)
Position: -143 Score: 3.9 Sequence: TTATGCGATATTGTTCTAATTC Locus tag: Shewmr4_0718 Name: serA Funciton: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) Locus tag: Shewmr4_0717 Name: SO0861 Funciton: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress
	Shewmr4_0718	serA	D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95)
	Shewmr4_0717	SO0861	folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress
Position: -70 Score: 4.5 Sequence: TTTTGTAACTATGATCACACAA Locus tag: Shewmr4_2974 Name: SO3553 Funciton: putative sulfate permease
	Shewmr4_2974	SO3553	putative sulfate permease
Position: -151 Score: 4.1 Sequence: CGGTGTGATCAGGATCTCAGTT Locus tag: Shewmr4_2501 Name: miaE Funciton: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-)
	Shewmr4_2501	miaE	tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-)
Position: -234 Score: 4.3 Sequence: AGATGTGATCTAGATCGGCTTA Locus tag: Shewmr4_2761 Name: Sputcn32_1245 Funciton: transcriptional regulator, MarR family
	Shewmr4_2761	Sputcn32_1245	transcriptional regulator, MarR family
Position: -131 Score: 3.9 Sequence: AAGTGTGAACAACAACACTATT Position: -108 Score: 4.1 Sequence: CATTTTGATCTAGCGCAAACTT Locus tag: Shewmr4_0659 Name: nrfA Funciton: cytochrome c552 precursor (EC 1.7.2.2)
	Shewmr4_0659	nrfA	cytochrome c552 precursor (EC 1.7.2.2)
Position: -66 Score: 4.6 Sequence: TTTTGTGAAACGTTTCACTATT Position: -25 Score: 3.8 Sequence: TAGCGTGTTTTTCATCGAATTT Locus tag: Shewmr4_3654 Name: SO0319 Funciton: conserved domain protein Locus tag: Shewmr4_3653 Name: SO0320 Funciton: conserved domain protein Locus tag: Shewmr4_3652 Name: SO0321 Funciton: hypothetical protein
	Shewmr4_3654	SO0319	conserved domain protein
	Shewmr4_3653	SO0320	conserved domain protein
	Shewmr4_3652	SO0321	hypothetical protein
Position: -166 Score: 3.7 Sequence: TGACGTGATTTGTGGCGTATAA Locus tag: Shewmr4_0873 Name: null Funciton: hypothetical protein Locus tag: Shewmr4_0874 Name: SO3681 Funciton: universal stress protein family Locus tag: Shewmr4_0875 Name: Shewana3_3248 Funciton: UspA domain-containing protein
	Shewmr4_0873		hypothetical protein
	Shewmr4_0874	SO3681	universal stress protein family
	Shewmr4_0875	Shewana3_3248	UspA domain-containing protein
Position: -100 Score: 3.9 Sequence: GTCTTTGATCTGAATCAAAAAA Position: -79 Score: 4.3 Sequence: ACACGCGATCTTGATCACACTT Locus tag: Shewmr4_1833 Name: SO2111 Funciton: hypothetical protein
	Shewmr4_1833	SO2111	hypothetical protein
Position: -205 Score: 4 Sequence: TTTTGTGAGCAAGAGCTAAATA Position: -153 Score: 4.8 Sequence: CAAAGTGATACAGCTCACATTA Locus tag: Shewmr4_2107 Name: gloA Funciton: lactoylglutathione lyase (EC 4.4.1.5)
	Shewmr4_2107	gloA	lactoylglutathione lyase (EC 4.4.1.5)
Position: -234 Score: 4.3 Sequence: AGATGTGATCTAGATCGGCTTA Locus tag: Shewmr4_2761 Name: Sputcn32_1245 Funciton: transcriptional regulator, MarR family
	Shewmr4_2761	Sputcn32_1245	transcriptional regulator, MarR family
Position: -319 Score: 5.6 Sequence: AAATGTGATGTGCGTCACATTT Position: -275 Score: 3.9 Sequence: AAATGTTATTTTATTAACAGCT Locus tag: Shewmr4_1903 Name: null Funciton: TonB-dependent receptor
	Shewmr4_1903		TonB-dependent receptor
Position: -187 Score: 3.9 Sequence: TTGGGTGAGCGCTGTCACAGTT Locus tag: Shewmr4_0273 Name: moaA Funciton: molybdenum cofactor biosynthesis protein MoaA Locus tag: Shewmr4_0274 Name: moaC Funciton: molybdenum cofactor biosynthesis protein MoaC Locus tag: Shewmr4_0275 Name: moaD Funciton: molybdenum cofactor biosynthesis protein MoaD Locus tag: Shewmr4_0276 Name: moaE Funciton: molybdenum cofactor biosynthesis protein MoaE Locus tag: Shewmr4_0277 Name: modA Funciton: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) Locus tag: Shewmr4_0278 Name: modB Funciton: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Shewmr4_0279 Name: modC Funciton: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	Shewmr4_0273	moaA	molybdenum cofactor biosynthesis protein MoaA
	Shewmr4_0274	moaC	molybdenum cofactor biosynthesis protein MoaC
	Shewmr4_0275	moaD	molybdenum cofactor biosynthesis protein MoaD
	Shewmr4_0276	moaE	molybdenum cofactor biosynthesis protein MoaE
	Shewmr4_0277	modA	molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
	Shewmr4_0278	modB	molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	Shewmr4_0279	modC	molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Position: -56 Score: 4.3 Sequence: AACTGTGATTAATCTCACTCTA Locus tag: Shewmr4_3035 Name: SO1064 Funciton: FOG: WD40 repeat Locus tag: Shewmr4_3036 Name: slyX Funciton: protein SlyX Locus tag: Shewmr4_3037 Name: def-2 Funciton: peptide deformylase (EC 3.5.1.88) Locus tag: Shewmr4_3038 Name: SO1061 Funciton: TPR domain protein Locus tag: Shewmr4_3039 Name: spaP Funciton: Putative lipoprotein Locus tag: Shewmr4_3040 Name: SO1059 Funciton: membrane alanine aminopeptidase N (EC 3.4.11.2)
	Shewmr4_3035	SO1064	FOG: WD40 repeat
	Shewmr4_3036	slyX	protein SlyX
	Shewmr4_3037	def-2	peptide deformylase (EC 3.5.1.88)
	Shewmr4_3038	SO1061	TPR domain protein
	Shewmr4_3039	spaP	Putative lipoprotein
	Shewmr4_3040	SO1059	membrane alanine aminopeptidase N (EC 3.4.11.2)
Position: -162 Score: 4.4 Sequence: TGGATTGATCCAGATCACAAAT Locus tag: Shewmr4_2867 Name: cyaC Funciton: Adenylate cyclase (EC 4.6.1.1)
	Shewmr4_2867	cyaC	Adenylate cyclase (EC 4.6.1.1)
Position: -97 Score: 4.1 Sequence: TTTTGTGCGCATCTTCATAAAT Locus tag: Shewmr4_3649 Name: ygbA Funciton: nitrosative stress induced protein
	Shewmr4_3649	ygbA	nitrosative stress induced protein
Position: -186 Score: 4.3 Sequence: AAACGCGATCTTTATCACTATT Locus tag: Shewmr4_1375 Name: SO3120 Funciton: oxidoreductase, Gfo/Idh/MocA family
	Shewmr4_1375	SO3120	oxidoreductase, Gfo/Idh/MocA family
Position: -96 Score: 4.2 Sequence: CATTGTGAAGCGTATCATGTAA Locus tag: Shewmr4_3508 Name: SO4138 Funciton: hypothetical protein
	Shewmr4_3508	SO4138	hypothetical protein
Position: -222 Score: 4.2 Sequence: TTTTGTGATTAGAATCTCAGCA Locus tag: Shewmr4_0231 Name: ccmA Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA Locus tag: Shewmr4_0230 Name: ccmB Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit Locus tag: Shewmr4_0229 Name: ccmC Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE Locus tag: Shewmr4_0228 Name: ccmD Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE Locus tag: Shewmr4_0227 Name: ccmE Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
	Shewmr4_0231	ccmA	ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
	Shewmr4_0230	ccmB	ABC transporter involved in cytochrome c biogenesis, CcmB subunit
	Shewmr4_0229	ccmC	cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
	Shewmr4_0228	ccmD	cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
	Shewmr4_0227	ccmE	cytochrome c-type biogenesis protein CcmE, heme chaperone
Position: -234 Score: 4 Sequence: CAATTTGATGTGGTTCCAATAA Position: -125 Score: 4.1 Sequence: TGCTGAGATTCTAATCACAAAA Locus tag: Shewmr4_0232 Name: scyA Funciton: cytochrome c-type protein
	Shewmr4_0232	scyA	cytochrome c-type protein
Position: -95 Score: 4 Sequence: TCTTGTGAATTGAGTCACAGAG Locus tag: Shewmr4_2426 Name: SO2806 Funciton: hypothetical protein
	Shewmr4_2426	SO2806	hypothetical protein
Position: -266 Score: 4.5 Sequence: ATGTGTGACATGGATCTAATTT Locus tag: Shewmr4_3340 Name: argR Funciton: arginine pathway regulatory protein ArgR, repressor of arg regulon
	Shewmr4_3340	argR	arginine pathway regulatory protein ArgR, repressor of arg regulon
Position: -105 Score: 3.9 Sequence: CCGTGTGAGGTATTTCGCAAAT Locus tag: Shewmr4_1513 Name: SO2858 Funciton: hypothetical protein Locus tag: Shewmr4_1514 Name: SO2857 Funciton: sodium solute symporter family protein Locus tag: Shewmr4_1515 Name: SO2856 Funciton: predicted signal-transduction protein containing cAMP-binding and CBS domains Locus tag: Shewmr4_1516 Name: SO2855 Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
	Shewmr4_1513	SO2858	hypothetical protein
	Shewmr4_1514	SO2857	sodium solute symporter family protein
	Shewmr4_1515	SO2856	predicted signal-transduction protein containing cAMP-binding and CBS domains
	Shewmr4_1516	SO2855	DNA polymerase III epsilon subunit (EC 2.7.7.7)
Position: -320 Score: 4.1 Sequence: TTTTGTGAGCAAGCTAGAATTA Locus tag: Shewmr4_3066 Name: hemG Funciton: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) Locus tag: Shewmr4_3065 Name: SO3719 Funciton: hypothetical protein
	Shewmr4_3066	hemG	protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
	Shewmr4_3065	SO3719	hypothetical protein
Position: -92 Score: 4.1 Sequence: TTCTGTGATCAAGTTAACCTTC Locus tag: Shewmr4_3505 Name: udp Funciton: Uridine phosphorylase (EC 2.4.2.3)
	Shewmr4_3505	udp	Uridine phosphorylase (EC 2.4.2.3)
Position: -66 Score: 4.1 Sequence: GAGTGTGACCTGATTCATACTT Locus tag: Shewmr4_0437 Name: acnB Funciton: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99)
	Shewmr4_0437	acnB	aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99)
Position: -94 Score: 4.3 Sequence: TTACATGATACGCTTCACAATG Locus tag: Shewmr4_3509 Name: Sputcn32_0539 Funciton: mechanosensitive ion channel Locus tag: Shewmr4_3510 Name: SO4139 Funciton: tetratricopeptide repeat family protein
	Shewmr4_3509	Sputcn32_0539	mechanosensitive ion channel
	Shewmr4_3510	SO4139	tetratricopeptide repeat family protein
Position: -203 Score: 4.2 Sequence: TAGTGTGACTAGGGTCTCAGTA Locus tag: Shewmr4_1239 Name: cydA Funciton: cytochrome d ubiquinol oxidase, subunit I, CydA Locus tag: Shewmr4_1240 Name: cydB Funciton: cytochrome d ubiquinol oxidase, subunit II, CydB
	Shewmr4_1239	cydA	cytochrome d ubiquinol oxidase, subunit I, CydA
	Shewmr4_1240	cydB	cytochrome d ubiquinol oxidase, subunit II, CydB
Position: -139 Score: 3.7 Sequence: AAGTTTGCGCTAGATCAAAATG Position: -116 Score: 4.5 Sequence: AATAGTGTTGTTGTTCACACTT Locus tag: Shewmr4_0658 Name: narQ Funciton: Nitrate/nitrite sensor protein (EC 2.7.3.-) Locus tag: Shewmr4_0657 Name: narP Funciton: Nitrate/nitrite response regulator protein
	Shewmr4_0658	narQ	Nitrate/nitrite sensor protein (EC 2.7.3.-)
	Shewmr4_0657	narP	Nitrate/nitrite response regulator protein
Position: -86 Score: 4.3 Sequence: TATAGTGATTTCAATCACAACC Locus tag: Shewmr4_0361 Name: ilvC Funciton: Ketol-acid reductoisomerase (EC 1.1.1.86)
	Shewmr4_0361	ilvC	Ketol-acid reductoisomerase (EC 1.1.1.86)
Position: -146 Score: 4.1 Sequence: TTTTGTGATTAAGCGCATAACT Locus tag: Shewmr4_0543 Name: SO0544 Funciton: sensory box histidine kinase Locus tag: Shewmr4_0544 Name: SO0544.1 Funciton: response regulator receiver protein
	Shewmr4_0543	SO0544	sensory box histidine kinase
	Shewmr4_0544	SO0544.1	response regulator receiver protein
Position: -95 Score: 4.4 Sequence: AAAAGCGACTCAGTTCACAATT Locus tag: Shewmr4_3843 Name: null Funciton: hypothetical protein
	Shewmr4_3843		hypothetical protein
Position: -136 Score: 4.3 Sequence: AATTGTGAACTGAGTCGCTTTT Locus tag: Shewmr4_3842 Name: prlC Funciton: Oligopeptidase A (EC 3.4.24.70)
	Shewmr4_3842	prlC	Oligopeptidase A (EC 3.4.24.70)
Position: -192 Score: 4 Sequence: AGTTATGCGCTTAATCACAAAA Locus tag: Shewmr4_0542 Name: SO0543 Funciton: hypothetical protein
	Shewmr4_0542	SO0543	hypothetical protein
Position: -127 Score: 4.5 Sequence: AATAGTGAGCAATATCACGATT Locus tag: Shewmr4_2719 Name: SO1539 Funciton: Probable acylaminoacyl-peptidase (EC 3.4.19.1)
	Shewmr4_2719	SO1539	Probable acylaminoacyl-peptidase (EC 3.4.19.1)
Position: -95 Score: 4.4 Sequence: AAATATTACCCCGATCACATTA Locus tag: Shewmr4_3907 Name: cytcB Funciton: diheme cytochrome c4
	Shewmr4_3907	cytcB	diheme cytochrome c4
Position: -276 Score: 5 Sequence: AAGTGTGATCTTGTTCTCACTT Position: -153 Score: 4.4 Sequence: CATTGAGATTTTTGTCACATAA Locus tag: Shewmr4_2505 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Shewmr4_2504 Name: feoB Funciton: Ferrous iron transport protein B
	Shewmr4_2505	feoA	Ferrous iron transport protein A
	Shewmr4_2504	feoB	Ferrous iron transport protein B
Position: -82 Score: 4.1 Sequence: AAACGCGAACTAACTCGCATTT Locus tag: Shewmr4_2411 Name: cdd Funciton: cytidine deaminase (EC 3.5.4.5)
	Shewmr4_2411	cdd	cytidine deaminase (EC 3.5.4.5)
Position: -167 Score: 4.6 Sequence: AAATGTGATATTGGTCTTAAAT Locus tag: Shewmr4_2376 Name: Swoo_2741 Funciton: Alkyl hydroperoxide reductase subunit C-like protein
	Shewmr4_2376	Swoo_2741	Alkyl hydroperoxide reductase subunit C-like protein
Position: -149 Score: 4.7 Sequence: AATCGTGATATTGCTCACTATT Locus tag: Shewmr4_2720 Name: icd Funciton: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
	Shewmr4_2720	icd	Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
Position: -92 Score: 4.7 Sequence: AAGTGTGACGAACTTCTCATTT Position: -52 Score: 3.9 Sequence: AAGTGTTAACATGAGCACACTT Locus tag: Shewmr4_0389 Name: cyaA Funciton: Adenylate cyclase (EC 4.6.1.1)
	Shewmr4_0389	cyaA	Adenylate cyclase (EC 4.6.1.1)
Position: -73 Score: 3.8 Sequence: TAATGGGTTCTTGCTCAAACAT Locus tag: Shewmr4_1398 Name: putP Funciton: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter
	Shewmr4_1398	putP	proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter
Position: -248 Score: 4.2 Sequence: TTATGTGAGGTGACGCAAGTTT Locus tag: Shewmr4_3073 Name: cobA Funciton: uroporphyrinogen-III methyltransferase (EC 2.1.1.107) Locus tag: Shewmr4_3072 Name: cysD Funciton: sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) Locus tag: Shewmr4_3071 Name: cysN Funciton: sulfate adenylyltransferase subunit 1 (EC 2.7.7.4) Locus tag: Shewmr4_3070 Name: Shew_1424 Funciton: sulfate permease, Trk-type Locus tag: Shewmr4_3069 Name: cysC Funciton: adenylylsulfate kinase (EC 2.7.1.25)
	Shewmr4_3073	cobA	uroporphyrinogen-III methyltransferase (EC 2.1.1.107)
	Shewmr4_3072	cysD	sulfate adenylyltransferase subunit 2 (EC 2.7.7.4)
	Shewmr4_3071	cysN	sulfate adenylyltransferase subunit 1 (EC 2.7.7.4)
	Shewmr4_3070	Shew_1424	sulfate permease, Trk-type
	Shewmr4_3069	cysC	adenylylsulfate kinase (EC 2.7.1.25)
Position: -140 Score: 4.4 Sequence: TTTTGTGATGTTTCTCTACATA Locus tag: Shewmr4_2468 Name: SO1821 Funciton: outer membrane porin, putative
	Shewmr4_2468	SO1821	outer membrane porin, putative
Position: -193 Score: 4.4 Sequence: TTTGTTGATTGCGATCACAATT Locus tag: Shewmr4_2145 Name: SO2535 Funciton: Predicted glutamine amidotransferase
	Shewmr4_2145	SO2535	Predicted glutamine amidotransferase
Position: -96 Score: 4.7 Sequence: TAATGTGATCGGGGTAATATTT Locus tag: Shewmr4_3906 Name: engB Funciton: GTP-binding protein EngB
	Shewmr4_3906	engB	GTP-binding protein EngB
Position: -95 Score: 4.4 Sequence: AAATATTACCCCGATCACATTA Locus tag: Shewmr4_3907 Name: cytcB Funciton: Cytochrome c4
	Shewmr4_3907	cytcB	Cytochrome c4
Position: -108 Score: 4.4 Sequence: TGCCGTGATCCAATTCACCTTT Position: -68 Score: 4.1 Sequence: TATTGTTAGTCACGTAACAATA Locus tag: Shewmr4_0303 Name: SO1410 Funciton: conserved domain protein
	Shewmr4_0303	SO1410	conserved domain protein
Position: -104 Score: 4.6 Sequence: AAATGTGATGTAGCCCAAAAAG Locus tag: Shewmr4_2124 Name: fumB Funciton: Fumarate hydratase class I, aerobic (EC 4.2.1.2)
	Shewmr4_2124	fumB	Fumarate hydratase class I, aerobic (EC 4.2.1.2)
Position: -116 Score: 4.3 Sequence: AAACTTGATCTAAGTCACGCTA Locus tag: Shewmr4_3922 Name: SO4743 Funciton: ferrichrome-iron receptor Locus tag: Shewmr4_3921 Name: deoR Funciton: transcriptional regulator of glmS gene, DeoR family Locus tag: Shewmr4_3920 Name: glmS Funciton: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
	Shewmr4_3922	SO4743	ferrichrome-iron receptor
	Shewmr4_3921	deoR	transcriptional regulator of glmS gene, DeoR family
	Shewmr4_3920	glmS	glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Position: -77 Score: 3.9 Sequence: ATTTGTGAGCGATATTAATTTT Locus tag: Shewmr4_0403 Name: fdrC Funciton: fumarate reductase cytochrome b subunit Locus tag: Shewmr4_0404 Name: frdA Funciton: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: Shewmr4_0405 Name: frdB Funciton: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
	Shewmr4_0403	fdrC	fumarate reductase cytochrome b subunit
	Shewmr4_0404	frdA	succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
	Shewmr4_0405	frdB	succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
Position: -225 Score: 4.2 Sequence: ATTTAAGACCAATATCACATTT Locus tag: Shewmr4_2377 Name: SO2757 Funciton: Histidine permease YuiF
	Shewmr4_2377	SO2757	Histidine permease YuiF
Position: -270 Score: 4.2 Sequence: TTTAGTGATATTAGTCAACTAA Locus tag: Shewmr4_0619 Name: sel1 Funciton: Sel1 domain protein repeat-containing protein precursor
	Shewmr4_0619	sel1	Sel1 domain protein repeat-containing protein precursor
Position: -166 Score: 3.9 Sequence: AAATTAGATCTGCATCATGTTA Position: -106 Score: 4.2 Sequence: ATTCTTGATATGCATCAAGAAT Locus tag: Shewmr4_1822 Name: hyaA Funciton: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) Locus tag: Shewmr4_1821 Name: hyaB Funciton: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) Locus tag: Shewmr4_1820 Name: hydC Funciton: Ni,Fe-hydrogenase I cytochrome b subunit Locus tag: Shewmr4_1819 Name: hyaD Funciton: Hydrogenase maturation protease (EC 3.4.24.-) Locus tag: Shewmr4_1818 Name: hyaE Funciton: NiFe hydrogenase assembly chaperone, HyaE Locus tag: Shewmr4_1817 Name: hyaF Funciton: NiFe hydrogenase assembly protein, HypF
	Shewmr4_1822	hyaA	Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
	Shewmr4_1821	hyaB	Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
	Shewmr4_1820	hydC	Ni,Fe-hydrogenase I cytochrome b subunit
	Shewmr4_1819	hyaD	Hydrogenase maturation protease (EC 3.4.24.-)
	Shewmr4_1818	hyaE	NiFe hydrogenase assembly chaperone, HyaE
	Shewmr4_1817	hyaF	NiFe hydrogenase assembly protein, HypF
Position: -53 Score: 5 Sequence: AAATGTGACGCGGATCACTTAT Locus tag: Shewmr4_0081 Name: Sbal_4271 Funciton: membrane protein, HPP family
	Shewmr4_0081	Sbal_4271	membrane protein, HPP family
Position: -84 Score: 4.9 Sequence: ATTTGTTACATTTATCACATAA Locus tag: Shewmr4_0950 Name: Sbal_2136 Funciton: putative OMR family iron-siderophore receptor precursor
	Shewmr4_0950	Sbal_2136	putative OMR family iron-siderophore receptor precursor
Position: -144 Score: 3.9 Sequence: TTTTTAGATTGAGATAACAGAT Position: -88 Score: 3.9 Sequence: AATTGATAAGAAGATCACACTA Locus tag: Shewmr4_2291 Name: hmgA Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
	Shewmr4_2291	hmgA	Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Position: -172 Score: 4.2 Sequence: AAGTGTGCTCATGTTAACACTT Position: -132 Score: 4.3 Sequence: AAATGAGAAGTTCGTCACACTT Locus tag: Shewmr4_0388 Name: hemC Funciton: Porphobilinogen deaminase (EC 2.5.1.61) Locus tag: Shewmr4_0387 Name: hemD Funciton: Uroporphyrinogen-III synthase (EC 4.2.1.75) Locus tag: Shewmr4_0386 Name: hemX Funciton: Homolog of E. coli HemX protein Locus tag: Shewmr4_0385 Name: hemY Funciton: HemY domain-containing protein
	Shewmr4_0388	hemC	Porphobilinogen deaminase (EC 2.5.1.61)
	Shewmr4_0387	hemD	Uroporphyrinogen-III synthase (EC 4.2.1.75)
	Shewmr4_0386	hemX	Homolog of E. coli HemX protein
	Shewmr4_0385	hemY	HemY domain-containing protein
Position: -184 Score: 4.4 Sequence: TTACATGATGCAGCGCACATTT Locus tag: Shewmr4_2318 Name: cctA Funciton: cytochrome c3
	Shewmr4_2318	cctA	cytochrome c3
Position: -49 Score: 4.5 Sequence: TTTTTTGAGATGAATCACCTAA Locus tag: Shewmr4_2959 Name: mviN Funciton: proposed peptidoglycan lipid II flippase MurJ Locus tag: Shewmr4_2958 Name: ribF Funciton: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) Locus tag: Shewmr4_2957 Name: ileS Funciton: isoleucyl-tRNA synthetase (EC 6.1.1.5) Locus tag: Shewmr4_2956 Name: lspA Funciton: lipoprotein signal peptidase (EC 3.4.23.36) Locus tag: Shewmr4_2955 Name: fkbP-2 Funciton: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) Locus tag: Shewmr4_2954 Name: lytB Funciton: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) Locus tag: Shewmr4_2953 Name: pilV Funciton: type IV fimbrial biogenesis protein PilV Locus tag: Shewmr4_2952 Name: pilW Funciton: type IV fimbrial biogenesis protein PilW Locus tag: Shewmr4_2951 Name: pilX Funciton: type IV fimbrial biogenesis protein PilX Locus tag: Shewmr4_2950 Name: pilY1 Funciton: type IV fimbrial biogenesis protein PilY1 Locus tag: Shewmr4_2949 Name: pilE Funciton: type IV pilus biogenesis protein PilE
	Shewmr4_2959	mviN	proposed peptidoglycan lipid II flippase MurJ
	Shewmr4_2958	ribF	riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
	Shewmr4_2957	ileS	isoleucyl-tRNA synthetase (EC 6.1.1.5)
	Shewmr4_2956	lspA	lipoprotein signal peptidase (EC 3.4.23.36)
	Shewmr4_2955	fkbP-2	FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
	Shewmr4_2954	lytB	4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
	Shewmr4_2953	pilV	type IV fimbrial biogenesis protein PilV
	Shewmr4_2952	pilW	type IV fimbrial biogenesis protein PilW
	Shewmr4_2951	pilX	type IV fimbrial biogenesis protein PilX
	Shewmr4_2950	pilY1	type IV fimbrial biogenesis protein PilY1
	Shewmr4_2949	pilE	type IV pilus biogenesis protein PilE
Position: -129 Score: 4.3 Sequence: CAGCGTGATTGCGATCGCATTT Locus tag: Shewmr4_0936 Name: nqrA-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) Locus tag: Shewmr4_0937 Name: nqrB-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) Locus tag: Shewmr4_0938 Name: nqrC-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) Locus tag: Shewmr4_0939 Name: nqrD-1 Funciton: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) Locus tag: Shewmr4_0940 Name: nqrE-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) Locus tag: Shewmr4_0941 Name: nqrF-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
	Shewmr4_0936	nqrA-2	Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
	Shewmr4_0937	nqrB-2	Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
	Shewmr4_0938	nqrC-2	Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
	Shewmr4_0939	nqrD-1	Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
	Shewmr4_0940	nqrE-2	Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
	Shewmr4_0941	nqrF-2	Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
Position: -75 Score: 4.5 Sequence: AACTGTGAGGGAGTTAACAAAA Locus tag: Shewmr4_2607 Name: phhA Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1) Locus tag: Shewmr4_2606 Name: phhB Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
	Shewmr4_2607	phhA	Phenylalanine-4-hydroxylase (EC 1.14.16.1)
	Shewmr4_2606	phhB	Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
Position: -156 Score: 4.4 Sequence: TTTTGTTACTCATCGCACATTT Locus tag: Shewmr4_0583 Name: SO0584 Funciton: methyl-accepting chemotaxis protein
	Shewmr4_0583	SO0584	methyl-accepting chemotaxis protein
Position: -95 Score: 4.3 Sequence: AATTTGGATGTAGAACACATTT Locus tag: Shewmr4_2965 Name: phk Funciton: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9)
	Shewmr4_2965	phk	Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9)
Position: -228 Score: 3.7 Sequence: AATATTGCGTTAGCTCGCATTT Position: -184 Score: 4.3 Sequence: TATCGTGATTAGTTGCATATAA Locus tag: Shewmr4_3710 Name: ppc Funciton: phosphoenolpyruvate carboxylase (EC 4.1.1.31) Locus tag: Shewmr4_3711 Name: yceB Funciton: uncharacterized lipoprotein YceB precursor
	Shewmr4_3710	ppc	phosphoenolpyruvate carboxylase (EC 4.1.1.31)
	Shewmr4_3711	yceB	uncharacterized lipoprotein YceB precursor
Position: -155 Score: 5.1 Sequence: TTATGTGATGATGATCAAAATT Locus tag: Shewmr4_2177 Name: fadD1 Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
	Shewmr4_2177	fadD1	Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Position: -118 Score: 4.5 Sequence: TTTATTGATGCATTTCACAGAT Locus tag: Shewmr4_0779 Name: cadC Funciton: transcriptional regulator-related protein Locus tag: Shewmr4_0780 Name: null Funciton: hypothetical protein
	Shewmr4_0779	cadC	transcriptional regulator-related protein
	Shewmr4_0780		hypothetical protein
Position: -266 Score: 4.2 Sequence: ATTCTTGATGCATATCAAGAAT Position: -206 Score: 4.2 Sequence: TAACATGATGCAGATCTAATTT Locus tag: Shewmr4_1823 Name: resA Funciton: C-type cytochrome biogenesis protein ResA (thioredoxin) Locus tag: Shewmr4_1824 Name: SO2101 Funciton: lipoprotein, putative Locus tag: Shewmr4_1825 Name: null Funciton: hypothetical protein Locus tag: Shewmr4_1826 Name: apbE Funciton: thiamin biosynthesis lipoprotein ApbE Locus tag: Shewmr4_1827 Name: SO2104 Funciton: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase Locus tag: Shewmr4_1828 Name: SO2105 Funciton: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
	Shewmr4_1823	resA	C-type cytochrome biogenesis protein ResA (thioredoxin)
	Shewmr4_1824	SO2101	lipoprotein, putative
	Shewmr4_1825		hypothetical protein
	Shewmr4_1826	apbE	thiamin biosynthesis lipoprotein ApbE
	Shewmr4_1827	SO2104	DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase
	Shewmr4_1828	SO2105	Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
Position: -287 Score: 3.7 Sequence: AGTTAAGATACAGAACACATTA Position: -92 Score: 4.1 Sequence: ACTTGAGACTGGTTTCACATTA Locus tag: Shewmr4_3766 Name: Sbal_0179 Funciton: transcriptional regulator, LysR family Locus tag: Shewmr4_3767 Name: menD Funciton: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) Locus tag: Shewmr4_3768 Name: SO4574 Funciton: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) Locus tag: Shewmr4_3769 Name: menC Funciton: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) Locus tag: Shewmr4_3770 Name: SO4576 Funciton: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26)
	Shewmr4_3766	Sbal_0179	transcriptional regulator, LysR family
	Shewmr4_3767	menD	2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9)
	Shewmr4_3768	SO4574	2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20)
	Shewmr4_3769	menC	O-succinylbenzoate-CoA synthase (EC 4.2.1.-)
	Shewmr4_3770	SO4576	O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26)
Position: -236 Score: 4.1 Sequence: TTTTGTTAAGCAGATCATGTTT Locus tag: Shewmr4_3729 Name: SO4519 Funciton: sodium-dependent transporter
	Shewmr4_3729	SO4519	sodium-dependent transporter
Position: -172 Score: 4.4 Sequence: AAACATGATCTGCTTAACAAAA Locus tag: Shewmr4_3730 Name: SO4520 Funciton: Oxygen-independent coproporphyrinogen III oxidase, putative
	Shewmr4_3730	SO4520	Oxygen-independent coproporphyrinogen III oxidase, putative
Position: -102 Score: 4.5 Sequence: TATTTTGACGCATGTCAAAATT Locus tag: Shewmr4_0573 Name: SO0572 Funciton: enoyl-CoA hydratase (EC 4.2.1.17)
	Shewmr4_0573	SO0572	enoyl-CoA hydratase (EC 4.2.1.17)
Position: -142 Score: 4 Sequence: AACTGGTATTTTGATCACAATT Locus tag: Shewmr4_0611 Name: astC Funciton: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) Locus tag: Shewmr4_0612 Name: astA Funciton: Arginine N-succinyltransferase (EC 2.3.1.109) Locus tag: Shewmr4_0613 Name: astD Funciton: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) Locus tag: Shewmr4_0614 Name: SO0620 Funciton: FIG008480: hypothetical protein
	Shewmr4_0611	astC	Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
	Shewmr4_0612	astA	Arginine N-succinyltransferase (EC 2.3.1.109)
	Shewmr4_0613	astD	Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
	Shewmr4_0614	SO0620	FIG008480: hypothetical protein
Position: -318 Score: 4.2 Sequence: AGAAGTGATCTTGATCAATTTT Locus tag: Shewmr4_3791 Name: SO4606 Funciton: cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: Shewmr4_3792 Name: SO4607 Funciton: cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: Shewmr4_3793 Name: coxG Funciton: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: Shewmr4_3794 Name: SO4609 Funciton: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
	Shewmr4_3791	SO4606	cytochrome c oxidase polypeptide II (EC 1.9.3.1)
	Shewmr4_3792	SO4607	cytochrome c oxidase polypeptide I (EC 1.9.3.1)
	Shewmr4_3793	coxG	cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
	Shewmr4_3794	SO4609	cytochrome c oxidase polypeptide III (EC 1.9.3.1)
Position: -55 Score: 4.3 Sequence: AATAGTGATTTTTATTGCAAAT Locus tag: Shewmr4_2871 Name: Shewmr4_2871 Funciton: hypothetical protein Locus tag: Shewmr4_2870 Name: SO1326 Funciton: COG1242: Predicted Fe-S oxidoreductase
	Shewmr4_2871	Shewmr4_2871	hypothetical protein
	Shewmr4_2870	SO1326	COG1242: Predicted Fe-S oxidoreductase
Position: -166 Score: 4.3 Sequence: AAGTGTTATGCCTATCCCATAT Locus tag: Shewmr4_0857 Name: SO3699.1 Funciton: hypothetical protein
	Shewmr4_0857	SO3699.1	hypothetical protein
Position: -199 Score: 4.1 Sequence: TTATGTGATTTTCACAACAACA Position: -157 Score: 3.8 Sequence: AATTGTAAATTTTTGCATATAT Locus tag: Shewmr4_3504 Name: SO4131 Funciton: nucleoside-binding outer membrane protein
	Shewmr4_3504	SO4131	nucleoside-binding outer membrane protein
Position: -124 Score: 4 Sequence: TAAGGTGATCTCCCTCTAAGAT Locus tag: Shewmr4_2832 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: Shewmr4_2831 Name: hcr Funciton: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1
	Shewmr4_2832	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	Shewmr4_2831	hcr	Flavodoxin reductases (ferredoxin-NADPH reductases) family 1
Position: -142 Score: 4.1 Sequence: TTATGTGAGCCAGCTTGTATTT Locus tag: Shewmr4_0098 Name: hutC Funciton: histidine utilization repressor Locus tag: Shewmr4_0099 Name: hutU Funciton: urocanate hydratase (EC 4.2.1.49) Locus tag: Shewmr4_0100 Name: hutH Funciton: histidine ammonia-lyase (EC 4.3.1.3)
	Shewmr4_0098	hutC	histidine utilization repressor
	Shewmr4_0099	hutU	urocanate hydratase (EC 4.2.1.49)
	Shewmr4_0100	hutH	histidine ammonia-lyase (EC 4.3.1.3)
Position: -174 Score: 3.5 Sequence: TTAGTTGACTAATATCACTAAA Locus tag: Shewmr4_0618 Name: crp Funciton: Cyclic AMP receptor protein Crp
	Shewmr4_0618	crp	Cyclic AMP receptor protein Crp
Position: -181 Score: 4.1 Sequence: TATTGTGAAATCGCGCAGAAAA Locus tag: Shewmr4_0445 Name: purH Funciton: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) Locus tag: Shewmr4_0444 Name: purD Funciton: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
	Shewmr4_0445	purH	IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
	Shewmr4_0444	purD	Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
Position: -187 Score: 4.4 Sequence: TTTATTGATCTTTATCTCATTT Position: -167 Score: 4.5 Sequence: TTTTGTGAATAGGCTAACAAAA Locus tag: Shewmr4_3127 Name: cydD Funciton: Transport ATP-binding protein CydD Locus tag: Shewmr4_3126 Name: cydC Funciton: Transport ATP-binding protein CydC Locus tag: Shewmr4_3125 Name: cyaB Funciton: adenylate cyclase CyaB, putative
	Shewmr4_3127	cydD	Transport ATP-binding protein CydD
	Shewmr4_3126	cydC	Transport ATP-binding protein CydC
	Shewmr4_3125	cyaB	adenylate cyclase CyaB, putative
Position: -99 Score: 5.2 Sequence: AAATGTGATCTATGTCAAAAAA Locus tag: Shewmr4_3765 Name: null Funciton: hypothetical protein Locus tag: Shewmr4_3764 Name: nrfB Funciton: Cytochrome c-type protein NrfB precursor Locus tag: Shewmr4_3763 Name: nrfC Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein Locus tag: Shewmr4_3762 Name: nrfD-2 Funciton: nitrite reductase, quinol dehydrogenase component, NrfD
	Shewmr4_3765		hypothetical protein
	Shewmr4_3764	nrfB	Cytochrome c-type protein NrfB precursor
	Shewmr4_3763	nrfC	4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
	Shewmr4_3762	nrfD-2	nitrite reductase, quinol dehydrogenase component, NrfD
Position: -65 Score: 4.9 Sequence: TTTTGTGATCTTAATCACTGTA Locus tag: Shewmr4_2257 Name: null Funciton: hypothetical protein
	Shewmr4_2257		hypothetical protein
Position: -148 Score: 4.6 Sequence: TAGTGTGATCTTCTTATCAATT Position: -92 Score: 3.9 Sequence: ATCTGTTATCTCAATCTAAAAA Locus tag: Shewmr4_2290 Name: hmgR Funciton: Tyrosine degradation transcriptional regulator, LysR family
	Shewmr4_2290	hmgR	Tyrosine degradation transcriptional regulator, LysR family
Position: -210 Score: 4.1 Sequence: CTTTGTGCAGTGTATCACAAAG Locus tag: Shewmr4_0018 Name: fadB Funciton: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) Locus tag: Shewmr4_0017 Name: fadA Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
	Shewmr4_0018	fadB	enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
	Shewmr4_0017	fadA	3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
Position: -171 Score: 4.3 Sequence: TTTTTTGACATGGCTCAAGTAT Locus tag: Shewmr4_2006 Name: ccoN Funciton: Cbb3-type cytochrome c oxidase, subunit I, CcoN Locus tag: Shewmr4_2007 Name: ccoO Funciton: Cbb3-type cytochrome c oxidase, subunit II, CcoO Locus tag: Shewmr4_2008 Name: ccoQ Funciton: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ Locus tag: Shewmr4_2009 Name: ccoP Funciton: Cbb3-type cytochrome c oxidase, subunit III, CcoP
	Shewmr4_2006	ccoN	Cbb3-type cytochrome c oxidase, subunit I, CcoN
	Shewmr4_2007	ccoO	Cbb3-type cytochrome c oxidase, subunit II, CcoO
	Shewmr4_2008	ccoQ	Cbb3-type cytochrome c oxidase, subunit IV, CcoQ
	Shewmr4_2009	ccoP	Cbb3-type cytochrome c oxidase, subunit III, CcoP
Position: -201 Score: 4.6 Sequence: AAAAGTGATTTATCTCACTAAA Locus tag: Shewmr4_3584 Name: SO4232 Funciton: long-chain fatty acid transport protein Locus tag: Shewmr4_3583 Name: glpK Funciton: glycerol kinase (EC 2.7.1.30)
	Shewmr4_3584	SO4232	long-chain fatty acid transport protein
	Shewmr4_3583	glpK	glycerol kinase (EC 2.7.1.30)
Position: -196 Score: 5.1 Sequence: AAATGTGATTTTGCTCACGCTA Locus tag: Shewmr4_2604 Name: fahA Funciton: Fumarylacetoacetate hydrolase family protein Locus tag: Shewmr4_2603 Name: maiA Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
	Shewmr4_2604	fahA	Fumarylacetoacetate hydrolase family protein
	Shewmr4_2603	maiA	Maleylacetoacetate isomerase (EC 5.2.1.2)
Position: -70 Score: 4.5 Sequence: TTTTGTAACTATGATCACACAA Locus tag: Shewmr4_2974 Name: SO3553 Funciton: putative sulfate permease Locus tag: Shewmr4_2975 Name: purE Funciton: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) Locus tag: Shewmr4_2976 Name: purK Funciton: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) Locus tag: Shewmr4_2977 Name: SO3556 Funciton: cyclic nucleotide phosphodiesterase, putative
	Shewmr4_2974	SO3553	putative sulfate permease
	Shewmr4_2975	purE	phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
	Shewmr4_2976	purK	phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
	Shewmr4_2977	SO3556	cyclic nucleotide phosphodiesterase, putative
Position: -144 Score: 4.2 Sequence: TTTTGTGATCCTCTTCTAAGAG Position: -77 Score: 3.9 Sequence: ATTTGTGAGCGATATTAATTTT Locus tag: Shewmr4_0402 Name: frdC1 Funciton: Fumarate reductase cytochrome b subunit Locus tag: Shewmr4_0403 Name: fdrC2 Funciton: Fumarate reductase cytochrome b subunit Locus tag: Shewmr4_0404 Name: frdA Funciton: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: Shewmr4_0405 Name: frdB Funciton: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
	Shewmr4_0402	frdC1	Fumarate reductase cytochrome b subunit
	Shewmr4_0403	fdrC2	Fumarate reductase cytochrome b subunit
	Shewmr4_0404	frdA	Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
	Shewmr4_0405	frdB	Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
Position: -159 Score: 4.3 Sequence: TTTTATGATATTTTTCATATTG Locus tag: Shewmr4_0481 Name: SO4003 Funciton: response regulator
	Shewmr4_0481	SO4003	response regulator
Position: -175 Score: 4.3 Sequence: AACTGTGACAGCGCTCACCCAA Locus tag: Shewmr4_0272 Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
	Shewmr4_0272	etfD	Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Position: -78 Score: 5.1 Sequence: AAATGTGATTTAGATCTCGTTT Locus tag: Shewmr4_1132 Name: yfiA-2 Funciton: Ribosome hibernation protein YfiA
	Shewmr4_1132	yfiA-2	Ribosome hibernation protein YfiA
Position: -151 Score: 3.7 Sequence: AACTGAGATCCTGATCACACCG Locus tag: Shewmr4_2502 Name: SO1787 Funciton: probable membrane protein YPO2362
	Shewmr4_2502	SO1787	probable membrane protein YPO2362
Position: -156 Score: 4.2 Sequence: AAAGGTGACGAGTATAACAAAA Locus tag: Shewmr4_3139 Name: Sputcn32_0834 Funciton: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70) Locus tag: Shewmr4_3140 Name: asnC Funciton: regulatory protein AsnC
	Shewmr4_3139	Sputcn32_0834	ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
	Shewmr4_3140	asnC	regulatory protein AsnC
Position: -203 Score: 3.9 Sequence: AAACTTGCGTCACCTCACATAA Locus tag: Shewmr4_3074 Name: swp_4060 Funciton: phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A
	Shewmr4_3074	swp_4060	phospholipase A1 precursor (EC 3.1.1.32, EC 3.1.1.4); outer membrane phospholipase A
Position: -125 Score: 4.2 Sequence: TTAAGTGATCTTGGCCACAATC Locus tag: Shewmr4_0667 Name: SO3967 Funciton: Molybdenum-binding periplasmic protein
	Shewmr4_0667	SO3967	Molybdenum-binding periplasmic protein
Position: -273 Score: 4 Sequence: CTTATTGATCTTATTCACGATT Locus tag: Shewmr4_3444 Name: psrA Funciton: polysulfide reductase, subunit A Locus tag: Shewmr4_3443 Name: psrB Funciton: polysulfide reductase, subunit B Locus tag: Shewmr4_3442 Name: psrC Funciton: polysulfide reductase, subunit C
	Shewmr4_3444	psrA	polysulfide reductase, subunit A
	Shewmr4_3443	psrB	polysulfide reductase, subunit B
	Shewmr4_3442	psrC	polysulfide reductase, subunit C
Position: -295 Score: 4.4 Sequence: TTATGTGACAAAAATCTCAATG Position: -172 Score: 4.3 Sequence: AAGTGAGAACAAGATCACACTT Locus tag: Shewmr4_2506 Name: mtrD Funciton: periplasmic decaheme cytochrome c, MtrD Locus tag: Shewmr4_2507 Name: mtrE Funciton: outer membrane protein, MtrE Locus tag: Shewmr4_2508 Name: mtrF Funciton: surface localized decaheme cytochrome c lipoprotein, MtrF Locus tag: Shewmr4_2509 Name: omcA Funciton: surface localized decaheme cytochrome c lipoprotein, OmcA
	Shewmr4_2506	mtrD	periplasmic decaheme cytochrome c, MtrD
	Shewmr4_2507	mtrE	outer membrane protein, MtrE
	Shewmr4_2508	mtrF	surface localized decaheme cytochrome c lipoprotein, MtrF
	Shewmr4_2509	omcA	surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -271 Score: 4.5 Sequence: TAATGTTAGCCCCCTCACACTT Locus tag: Shewmr4_2741 Name: Shewana3_2910 Funciton: putative membrane protein
	Shewmr4_2741	Shewana3_2910	putative membrane protein
Position: -202 Score: 4 Sequence: ATTTGTTACCCACCTCTTATTT Locus tag: Shewmr4_2613 Name: mtrF Funciton: decaheme cytochrome c MtrF
	Shewmr4_2613	mtrF	decaheme cytochrome c MtrF
Position: -121 Score: 3.9 Sequence: TAGCTTGATCGAAAACACAGTT Locus tag: Shewmr4_3020 Name: purT Funciton: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-)
	Shewmr4_3020	purT	phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-)
Position: -217 Score: 4 Sequence: GTTTGTGATCGCCATCACTAAC Locus tag: Shewmr4_2183 Name: hemB-1 Funciton: porphobilinogen synthase (EC 4.2.1.24)
	Shewmr4_2183	hemB-1	porphobilinogen synthase (EC 4.2.1.24)
Position: -86 Score: 4.6 Sequence: TGCTTTGATTTACATCACAATT Locus tag: Shewmr4_1948 Name: Sama_2599 Funciton: putative lipoprotein
	Shewmr4_1948	Sama_2599	putative lipoprotein
Position: -94 Score: 4.3 Sequence: TTACATGATACGCTTCACAATG Locus tag: Shewmr4_3509 Name: kefA Funciton: mechanosensitive ion channel
	Shewmr4_3509	kefA	mechanosensitive ion channel
Position: -304 Score: 4.6 Sequence: TTTTGCGATCCGCCTCACAATC Locus tag: Shewmr4_3728 Name: Shewana3_3924 Funciton: methyl-accepting chemotaxis protein
	Shewmr4_3728	Shewana3_3924	methyl-accepting chemotaxis protein
Position: -165 Score: 4.4 Sequence: TTGTGTGATCATAGTTACAAAA Locus tag: Shewmr4_2973 Name: SO3552 Funciton: Von Willebrand factor type A domain protein Locus tag: Shewmr4_2972 Name: SO3551 Funciton: RNA polymerase sigma-70 factor, ECF subfamily Locus tag: Shewmr4_2971 Name: null Funciton: hypothetical protein
	Shewmr4_2973	SO3552	Von Willebrand factor type A domain protein
	Shewmr4_2972	SO3551	RNA polymerase sigma-70 factor, ECF subfamily
	Shewmr4_2971		hypothetical protein
Position: -198 Score: 4.3 Sequence: CCCTGTGATCTAGCTCAAATTT Locus tag: Shewmr4_3223 Name: SO3890 Funciton: methyl-accepting chemotaxis protein
	Shewmr4_3223	SO3890	methyl-accepting chemotaxis protein
Position: -67 Score: 3.7 Sequence: AAATGTGTAAAACCACACAAAA Locus tag: Shewmr4_3228 Name: omp35 Funciton: outer membrane porin
	Shewmr4_3228	omp35	outer membrane porin
Position: -113 Score: 4.7 Sequence: TATTGTGATCAGTATCAAACAC Locus tag: Shewmr4_0430 Name: lpdA Funciton: Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
	Shewmr4_0430	lpdA	Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
Position: -187 Score: 4.2 Sequence: AACATTGAACTAGATCACAATT Position: -93 Score: 4.3 Sequence: TTAATTGACCTAGATCAAACTT Locus tag: Shewmr4_3498 Name: null Funciton: hypothetical protein
	Shewmr4_3498		hypothetical protein
Position: -157 Score: 4.5 Sequence: ATTTGTGATGTGAATCATTGTT Locus tag: Shewmr4_1573 Name: ydhD Funciton: Probable monothiol glutaredoxin ydhD
	Shewmr4_1573	ydhD	Probable monothiol glutaredoxin ydhD
Position: -189 Score: 3.5 Sequence: TAGAAAGATCCAAGTCACACAT Locus tag: Shewmr4_2510 Name: mtrC Funciton: surface localized decaheme cytochrome c lipoprotein, MtrC Locus tag: Shewmr4_2511 Name: mtrA Funciton: periplasmic decaheme cytochrome c, MtrA Locus tag: Shewmr4_2512 Name: mtrB Funciton: outer membrane protein, MtrB
	Shewmr4_2510	mtrC	surface localized decaheme cytochrome c lipoprotein, MtrC
	Shewmr4_2511	mtrA	periplasmic decaheme cytochrome c, MtrA
	Shewmr4_2512	mtrB	outer membrane protein, MtrB
Position: -328 Score: 3.8 Sequence: GAATGTGATCTGTCTCGGCATT Position: -133 Score: 4.4 Sequence: TAATGTGCTCTAGCTCAGGTTT Locus tag: Shewmr4_0488 Name: mccA Funciton: cytochrome c, putative
	Shewmr4_0488	mccA	cytochrome c, putative
Position: -205 Score: 4 Sequence: AAGTGTGAGCCAGATCTAACTC Position: -91 Score: 4.6 Sequence: AATATTGATCCAAATCACGTTT Locus tag: Shewmr4_3506 Name: SO4134 Funciton: Protein of unknown function DUF465
	Shewmr4_3506	SO4134	Protein of unknown function DUF465
Position: -187 Score: 4 Sequence: TTGTTTGAGGTGGATCATCAAA Position: -91 Score: 4 Sequence: AATTGCGACGGATCACGCATTT Locus tag: Shewmr4_3714 Name: SO4503 Funciton: formate dehydrogenase chain D (EC 1.2.1.2) Locus tag: Shewmr4_3713 Name: SO4502 Funciton: conserved domain protein
	Shewmr4_3714	SO4503	formate dehydrogenase chain D (EC 1.2.1.2)
	Shewmr4_3713	SO4502	conserved domain protein
Position: -383 Score: 4.3 Sequence: TACTGTGATCCCGTTAACCCAA Position: -217 Score: 4 Sequence: TAATGTGCGTTGATGCACATTG Locus tag: Shewmr4_0782 Name: SO0939 Funciton: split-soret diheme cytochrome c Locus tag: Shewmr4_0781 Name: null Funciton: hypothetical protein
	Shewmr4_0782	SO0939	split-soret diheme cytochrome c
	Shewmr4_0781		hypothetical protein
Position: -70 Score: 4.5 Sequence: TTTTGTAACTATGATCACACAA Locus tag: Shewmr4_2974 Name: SO3553 Funciton: putative sulfate permease Locus tag: Shewmr4_2975 Name: purE Funciton: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) Locus tag: Shewmr4_2976 Name: purK Funciton: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) Locus tag: Shewmr4_2977 Name: SO3556 Funciton: cyclic nucleotide phosphodiesterase, putative
	Shewmr4_2974	SO3553	putative sulfate permease
	Shewmr4_2975	purE	phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
	Shewmr4_2976	purK	phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
	Shewmr4_2977	SO3556	cyclic nucleotide phosphodiesterase, putative
Position: -263 Score: 4 Sequence: AATCGGGATTAAGCTCACATCA Locus tag: Shewmr4_0299 Name: SO1414 Funciton: flavocytochrome c flavin subunit Locus tag: Shewmr4_0300 Name: SO1413 Funciton: flavocytochrome c heme subunit
	Shewmr4_0299	SO1414	flavocytochrome c flavin subunit
	Shewmr4_0300	SO1413	flavocytochrome c heme subunit
Position: -118 Score: 4.2 Sequence: GAAAGTGATACACCTCAAATAA Locus tag: Shewmr4_3511 Name: SO4142 Funciton: cytochrome c family protein Locus tag: Shewmr4_3512 Name: SO4143 Funciton: hypothetical protein Locus tag: Shewmr4_3513 Name: SO4144 Funciton: octaheme tetrathionate reductase
	Shewmr4_3511	SO4142	cytochrome c family protein
	Shewmr4_3512	SO4143	hypothetical protein
	Shewmr4_3513	SO4144	octaheme tetrathionate reductase
Position: -234 Score: 4.8 Sequence: TTAAGTGATCTGGCTCACTTAA Locus tag: Shewmr4_2373 Name: SO2753 Funciton: prolyl endopeptidase (EC 3.4.21.26)
	Shewmr4_2373	SO2753	prolyl endopeptidase (EC 3.4.21.26)
Position: -142 Score: 4.1 Sequence: AATTGTTAAGTATTTCATATTG Locus tag: Shewmr4_3152 Name: SO3811 Funciton: lipoprotein, putative Locus tag: Shewmr4_3153 Name: ppiA Funciton: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) Locus tag: Shewmr4_3154 Name: SO3813 Funciton: hypothetical protein Locus tag: Shewmr4_3155 Name: ampG Funciton: AmpG permease
	Shewmr4_3152	SO3811	lipoprotein, putative
	Shewmr4_3153	ppiA	peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
	Shewmr4_3154	SO3813	hypothetical protein
	Shewmr4_3155	ampG	AmpG permease
Position: -309 Score: 3.9 Sequence: AAATGTGATCTGGATCATTGGA Locus tag: Shewmr4_3226 Name: SO3895 Funciton: HesA/MoeB/ThiF family protein related to EC-YgdL
	Shewmr4_3226	SO3895	HesA/MoeB/ThiF family protein related to EC-YgdL
Position: -278 Score: 4.8 Sequence: ATTTGTGACAAATTGCACATTA Position: -205 Score: 4.1 Sequence: ATTCGTTAGGGATCTCACAGAT Locus tag: Shewmr4_1148 Name: SO3406 Funciton: FIG024006: iron uptake protein Locus tag: Shewmr4_1147 Name: SO3407 Funciton: FIG138928: iron-regulated membrane protein Locus tag: Shewmr4_1146 Name: SO3408 Funciton: FIG016502: iron uptake protein
	Shewmr4_1148	SO3406	FIG024006: iron uptake protein
	Shewmr4_1147	SO3407	FIG138928: iron-regulated membrane protein
	Shewmr4_1146	SO3408	FIG016502: iron uptake protein
Position: -255 Score: 4.4 Sequence: CTTTGTGATACACTGCACAAAG Locus tag: Shewmr4_0019 Name: pepQ Funciton: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) Locus tag: Shewmr4_0020 Name: SO0023 Funciton: FIG000605: protein co-occurring with transport systems (COG1739) Locus tag: Shewmr4_0021 Name: trkH-1 Funciton: potassium uptake protein TrkH Locus tag: Shewmr4_0022 Name: hemG Funciton: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
	Shewmr4_0019	pepQ	Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
	Shewmr4_0020	SO0023	FIG000605: protein co-occurring with transport systems (COG1739)
	Shewmr4_0021	trkH-1	potassium uptake protein TrkH
	Shewmr4_0022	hemG	protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
Position: -263 Score: 4.1 Sequence: TCGAGTGACATAGATCACAGTT Position: -181 Score: 4.2 Sequence: CAAAATGATCTAGATCATATTA Locus tag: Shewmr4_2734 Name: lldP Funciton: L-lactate permease Locus tag: Shewmr4_2735 Name: dldD Funciton: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing
	Shewmr4_2734	lldP	L-lactate permease
	Shewmr4_2735	dldD	D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing
Position: -91 Score: 4.3 Sequence: AACAATGATTCACATCACAAAT Locus tag: Shewmr4_1572 Name: sodB Funciton: superoxide dismutase [Fe] (EC 1.15.1.1)
	Shewmr4_1572	sodB	superoxide dismutase [Fe] (EC 1.15.1.1)
Position: -72 Score: 4.8 Sequence: AATTGTGATCGCAATCAACAAA Locus tag: Shewmr4_2146 Name: fadE2 Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
	Shewmr4_2146	fadE2	Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Position: -46 Score: 4.3 Sequence: AAATTAGATCCATGTCACACAT Locus tag: Shewmr4_3339 Name: mdh Funciton: malate dehydrogenase (EC 1.1.1.37)
	Shewmr4_3339	mdh	malate dehydrogenase (EC 1.1.1.37)
Position: -202 Score: 4 Sequence: ATTTGTTACCCACCTCTTATTT Locus tag: Shewmr4_2613 Name: mtrF Funciton: decaheme cytochrome c MtrF
	Shewmr4_2613	mtrF	decaheme cytochrome c MtrF
Position: -130 Score: 4 Sequence: TCCAATGATCCAGATCACATTT Locus tag: Shewmr4_3227 Name: Shewana3_0734 Funciton: outer membrane porin, putative
	Shewmr4_3227	Shewana3_0734	outer membrane porin, putative
Position: -225 Score: 4.5 Sequence: TTAGGTGATTCATCTCAAAAAA Locus tag: Shewmr4_2960 Name: rpsT Funciton: SSU ribosomal protein S20p
	Shewmr4_2960	rpsT	SSU ribosomal protein S20p
Position: -308 Score: 4.3 Sequence: AAATGTCGTCTTGATCACATTT Locus tag: Shewmr4_3777 Name: cymA Funciton: membrane anchored tetraheme cytochrome c, CymA
	Shewmr4_3777	cymA	membrane anchored tetraheme cytochrome c, CymA
Position: -142 Score: 4.6 Sequence: TTCTTTGATAAATCTCACATTT Locus tag: Shewmr4_1150 Name: yfiA-1 Funciton: ribosomal subunit interface protein
	Shewmr4_1150	yfiA-1	ribosomal subunit interface protein
Position: -74 Score: 5.2 Sequence: AAATGTGATCTGTCTTACATTT Locus tag: Shewmr4_0985 Name: lipB Funciton: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase Locus tag: Shewmr4_0984 Name: lipA Funciton: Lipoate synthase
	Shewmr4_0985	lipB	Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase
	Shewmr4_0984	lipA	Lipoate synthase
Position: -85 Score: 5 Sequence: AGATGTGACTTGCCTCACAATT Locus tag: Shewmr4_1141 Name: null Funciton: hypothetical protein Locus tag: Shewmr4_1142 Name: SO3412 Funciton: extracellular solute-binding proteins, family 3 protein Locus tag: Shewmr4_1143 Name: SO3411 Funciton: tricorn protease homolog (EC 3.4.21.-)
	Shewmr4_1141		hypothetical protein
	Shewmr4_1142	SO3412	extracellular solute-binding proteins, family 3 protein
	Shewmr4_1143	SO3411	tricorn protease homolog (EC 3.4.21.-)
Position: -160 Score: 4.6 Sequence: AAGTGTGATCTGATTCTAACTT Locus tag: Shewmr4_1406 Name: SO3090 Funciton: MoxR-like ATPase in aerotolerance operon Locus tag: Shewmr4_1405 Name: SO3091 Funciton: Conserved hypothetical protein Locus tag: Shewmr4_1404 Name: null Funciton: hypothetical protein Locus tag: Shewmr4_1403 Name: SO3093 Funciton: von Willebrand factor type A domain protein Locus tag: Shewmr4_1402 Name: SO3094 Funciton: TPR domain protein in aerotolerance operon Locus tag: Shewmr4_1401 Name: SO3095 Funciton: hypothetical protein
	Shewmr4_1406	SO3090	MoxR-like ATPase in aerotolerance operon
	Shewmr4_1405	SO3091	Conserved hypothetical protein
	Shewmr4_1404		hypothetical protein
	Shewmr4_1403	SO3093	von Willebrand factor type A domain protein
	Shewmr4_1402	SO3094	TPR domain protein in aerotolerance operon
	Shewmr4_1401	SO3095	hypothetical protein
Position: -171 Score: 4.5 Sequence: AATAGTGATAAAGATCGCGTTT Locus tag: Shewmr4_1376 Name: null Funciton: hypothetical protein
	Shewmr4_1376		hypothetical protein
Position: -239 Score: 4.3 Sequence: CAATGTGATTGATATCAATAAA Locus tag: Shewmr4_0778 Name: nhaD Funciton: Na+/H+ antiporter NhaD type
	Shewmr4_0778	nhaD	Na+/H+ antiporter NhaD type

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Crp in Shewanella sp MR-4

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --