Regulon of Crp in Shewanella sp W3-18-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputw3181_3522
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Regulog:	Crp - Shewanellaceae
Statistics of regulated genes:
- Genes	316
- Operons	164
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2713 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - CRP
By effector - Cyclic 3',5'-AMP
By pathway - Carbon catabolism

Regulated operons
	Locus Tag	Name	Function
Position: -136 Score: 3.9 Sequence: AAGTTAGAATCAGATCACACTT Locus tag: Sputw3181_1548 Name: fadI Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) Locus tag: Sputw3181_1549 Name: fadJ Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
	Sputw3181_1548	fadI	3-ketoacyl-CoA thiolase (EC 2.3.1.16)
	Sputw3181_1549	fadJ	Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
Position: -183 Score: 4.4 Sequence: TTACATGATGCAGCGCACATTT Locus tag: Sputw3181_1675 Name: cctA Funciton: cytochrome c3
	Sputw3181_1675	cctA	cytochrome c3
Position: -148 Score: 4.7 Sequence: AATCGTGATATCGCTCACTATT Locus tag: Sputw3181_2820 Name: icd Funciton: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
	Sputw3181_2820	icd	Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
Position: -143 Score: 4 Sequence: CTGTGTGATCATGATTGCAAAT Locus tag: Sputw3181_3122 Name: SO3552 Funciton: Von Willebrand factor type A domain protein Locus tag: Sputw3181_3121 Name: SO3551 Funciton: RNA polymerase sigma-70 factor, ECF subfamily Locus tag: Sputw3181_3120 Name: null Funciton: hypothetical protein
	Sputw3181_3122	SO3552	Von Willebrand factor type A domain protein
	Sputw3181_3121	SO3551	RNA polymerase sigma-70 factor, ECF subfamily
	Sputw3181_3120		hypothetical protein
Position: -103 Score: 4.6 Sequence: AAATGTGATGTAGCCCAAAAAG Locus tag: Sputw3181_2218 Name: fumB Funciton: Fumarate hydratase class I, aerobic (EC 4.2.1.2)
	Sputw3181_2218	fumB	Fumarate hydratase class I, aerobic (EC 4.2.1.2)
Position: -269 Score: 4.7 Sequence: TTAAGTGACTTATATCACATTG Locus tag: Sputw3181_2269 Name: SO2586 Funciton: inactive homolog of metal-dependent proteases, putative molecular chaperone Locus tag: Sputw3181_2268 Name: SO2585 Funciton: hypothetical protein Locus tag: Sputw3181_2267 Name: SO2584 Funciton: Tlr1621 protein
	Sputw3181_2269	SO2586	inactive homolog of metal-dependent proteases, putative molecular chaperone
	Sputw3181_2268	SO2585	hypothetical protein
	Sputw3181_2267	SO2584	Tlr1621 protein
Position: -116 Score: 4.7 Sequence: TAATTTGATCGGTATCACACTC Locus tag: Sputw3181_4050 Name: SO4743 Funciton: ferrichrome-iron receptor Locus tag: Sputw3181_4049 Name: deoR Funciton: transcriptional regulator of glmS gene, DeoR family Locus tag: Sputw3181_4048 Name: glmS Funciton: glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
	Sputw3181_4050	SO4743	ferrichrome-iron receptor
	Sputw3181_4049	deoR	transcriptional regulator of glmS gene, DeoR family
	Sputw3181_4048	glmS	glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Position: -65 Score: 5.1 Sequence: TTTTGTGATCTCCATCACCGTT Locus tag: Sputw3181_1703 Name: null Funciton: hypothetical protein
	Sputw3181_1703		hypothetical protein
Position: -90 Score: 4.5 Sequence: AAATGTGAACCAGAGCACACTC Locus tag: Sputw3181_0540 Name: SO0439 Funciton: hypothetical protein
	Sputw3181_0540	SO0439	hypothetical protein
Position: -109 Score: 3.9 Sequence: AATGGCGATTCGGCTCACACTC Locus tag: Sputw3181_3025 Name: SO1328 Funciton: transcriptional regulator, LysR family
	Sputw3181_3025	SO1328	transcriptional regulator, LysR family
Position: -312 Score: 4.1 Sequence: AATTTTGAACCAATGCAAATAT Position: -44 Score: 4.3 Sequence: TATTTTGATTTTAATCAATTTA Locus tag: Sputw3181_3151 Name: SO3588 Funciton: gpr1/fun34/yaaH family protein
	Sputw3181_3151	SO3588	gpr1/fun34/yaaH family protein
Position: -125 Score: 4 Sequence: AAATGTGCGCAGAGTAACAAAT Locus tag: Sputw3181_0646 Name: bfd Funciton: bacterioferritin-associated ferredoxin
	Sputw3181_0646	bfd	bacterioferritin-associated ferredoxin
Position: -259 Score: 3.7 Sequence: AAACGTGATCAGTTACCCGTAA Locus tag: Sputw3181_1290 Name: SO3395 Funciton: hypothetical protein
	Sputw3181_1290	SO3395	hypothetical protein
Position: -136 Score: 3.7 Sequence: AAGTGTGACCTAAATCTATTTG Locus tag: Sputw3181_1190 Name: deoA Funciton: thymidine phosphorylase (EC 2.4.2.4) Locus tag: Sputw3181_1191 Name: deoB Funciton: phosphopentomutase (EC 5.4.2.7) Locus tag: Sputw3181_1192 Name: deoD-2 Funciton: purine nucleoside phosphorylase (EC 2.4.2.1)
	Sputw3181_1190	deoA	thymidine phosphorylase (EC 2.4.2.4)
	Sputw3181_1191	deoB	phosphopentomutase (EC 5.4.2.7)
	Sputw3181_1192	deoD-2	purine nucleoside phosphorylase (EC 2.4.2.1)
Position: -147 Score: 3.9 Sequence: AACTTTGATCCCGATCGACTAT Locus tag: Sputw3181_0796 Name: napD Funciton: periplasmic nitrate reductase component NapD Locus tag: Sputw3181_0795 Name: napA Funciton: periplasmic nitrate reductase precursor (EC 1.7.99.4) Locus tag: Sputw3181_0794 Name: napG Funciton: ferredoxin-type protein NapG (periplasmic nitrate reductase) Locus tag: Sputw3181_0793 Name: napH Funciton: polyferredoxin NapH (periplasmic nitrate reductase) Locus tag: Sputw3181_0792 Name: napB Funciton: nitrate reductase cytochrome c550-type subunit
	Sputw3181_0796	napD	periplasmic nitrate reductase component NapD
	Sputw3181_0795	napA	periplasmic nitrate reductase precursor (EC 1.7.99.4)
	Sputw3181_0794	napG	ferredoxin-type protein NapG (periplasmic nitrate reductase)
	Sputw3181_0793	napH	polyferredoxin NapH (periplasmic nitrate reductase)
	Sputw3181_0792	napB	nitrate reductase cytochrome c550-type subunit
Position: -140 Score: 4.5 Sequence: AAACTTGATTCGTGTCACACAA Locus tag: Sputw3181_3398 Name: Sputcn32_0777 Funciton: hypothetical protein
	Sputw3181_3398	Sputcn32_0777	hypothetical protein
Position: -236 Score: 4.5 Sequence: AATAGTGATACAAACCACACTT Locus tag: Sputw3181_0682 Name: SO4019 Funciton: DNA helicase
	Sputw3181_0682	SO4019	DNA helicase
Position: -70 Score: 3.8 Sequence: TAAATGGATGTAAATCACGATT Locus tag: Sputw3181_2375 Name: yceI Funciton: hypothetical protein Locus tag: Sputw3181_2374 Name: SO2891 Funciton: type IIA topoisomerase, B subunit
	Sputw3181_2375	yceI	hypothetical protein
	Sputw3181_2374	SO2891	type IIA topoisomerase, B subunit
Position: -130 Score: 3.7 Sequence: CACTATGATCTGCTTCTAATTT Position: -101 Score: 3.7 Sequence: TAATGAGCCCCGCTTCAAACTT Locus tag: Sputw3181_0665 Name: petA Funciton: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2) Locus tag: Sputw3181_0666 Name: petB Funciton: ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2) Locus tag: Sputw3181_0667 Name: petC Funciton: ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit Locus tag: Sputw3181_0668 Name: sspA Funciton: stringent starvation protein A Locus tag: Sputw3181_0669 Name: sspB Funciton: stringent starvation protein B
	Sputw3181_0665	petA	ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2)
	Sputw3181_0666	petB	ubiquinol--cytochrome c reductase, cytochrome B subunit (EC 1.10.2.2)
	Sputw3181_0667	petC	ubiquinol cytochrome C oxidoreductase, cytochrome C1 subunit
	Sputw3181_0668	sspA	stringent starvation protein A
	Sputw3181_0669	sspB	stringent starvation protein B
Position: -142 Score: 4.1 Sequence: TTCCTTGATTTAGATCACACTC Locus tag: Sputw3181_2769 Name: null Funciton: hypothetical protein
	Sputw3181_2769		hypothetical protein
Position: -212 Score: 3.9 Sequence: AAATGTGATCTGTGCCTAAATG Locus tag: Sputw3181_1779 Name: icd Funciton: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
	Sputw3181_1779	icd	isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
Position: -174 Score: 4.2 Sequence: TTTCGTGACCTAGATTAGATAT Locus tag: Sputw3181_3939 Name: SO0141 Funciton: sensory box/GGDEF family protein
	Sputw3181_3939	SO0141	sensory box/GGDEF family protein
Position: -63 Score: 3.8 Sequence: TATTTTGATATTGAATAAAATA Position: -34 Score: 3.7 Sequence: TGATGTGCGAGTGTTCAAATAG Position: -2 Score: 3.8 Sequence: TTATGTTATTAATGCCGCAAAA Locus tag: Sputw3181_1816 Name: ycbW Funciton: probable membrane protein YcbW
	Sputw3181_1816	ycbW	probable membrane protein YcbW
Position: -268 Score: 3.8 Sequence: AATAGTGATTTCTGTCGTGAAT Locus tag: Sputw3181_1188 Name: tsx Funciton: nucleoside-specific channel-forming protein, Tsx
	Sputw3181_1188	tsx	nucleoside-specific channel-forming protein, Tsx
Position: -279 Score: 4.2 Sequence: ATTATTGATGTATATCAAGAAT Position: -219 Score: 3.9 Sequence: TAACATGACGCAGATCTAATTT Locus tag: Sputw3181_1925 Name: resA Funciton: C-type cytochrome biogenesis protein ResA (thioredoxin) Locus tag: Sputw3181_1926 Name: SO2101 Funciton: lipoprotein, putative Locus tag: Sputw3181_1927 Name: null Funciton: hypothetical protein Locus tag: Sputw3181_1928 Name: apbE Funciton: thiamin biosynthesis lipoprotein ApbE Locus tag: Sputw3181_1929 Name: SO2104 Funciton: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase Locus tag: Sputw3181_1930 Name: SO2105 Funciton: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
	Sputw3181_1925	resA	C-type cytochrome biogenesis protein ResA (thioredoxin)
	Sputw3181_1926	SO2101	lipoprotein, putative
	Sputw3181_1927		hypothetical protein
	Sputw3181_1928	apbE	thiamin biosynthesis lipoprotein ApbE
	Sputw3181_1929	SO2104	DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase
	Sputw3181_1930	SO2105	Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
Position: -140 Score: 4.1 Sequence: TTTGATGATCTACTTCAAACTT Locus tag: Sputw3181_3866 Name: null Funciton: hypothetical protein Locus tag: Sputw3181_3867 Name: SO4505 Funciton: hypothetical protein probably related to Formate dehydrogenase function Locus tag: Sputw3181_3868 Name: SO4506 Funciton: iron-sulfur cluster-binding protein Locus tag: Sputw3181_3869 Name: SO4507 Funciton: putative formate dehydrogenase-specific chaperone Locus tag: Sputw3181_3870 Name: SO4508 Funciton: formate dehydrogenase subunit or accessory protein Locus tag: Sputw3181_3871 Name: SO4509 Funciton: formate dehydrogenase-O, major subunit (EC 1.2.1.2) Locus tag: Sputw3181_3872 Name: fdhB-1 Funciton: formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2) Locus tag: Sputw3181_3873 Name: SO4511 Funciton: formate dehydrogenase -O, gamma subunit (EC 1.2.1.2)
	Sputw3181_3866		hypothetical protein
	Sputw3181_3867	SO4505	hypothetical protein probably related to Formate dehydrogenase function
	Sputw3181_3868	SO4506	iron-sulfur cluster-binding protein
	Sputw3181_3869	SO4507	putative formate dehydrogenase-specific chaperone
	Sputw3181_3870	SO4508	formate dehydrogenase subunit or accessory protein
	Sputw3181_3871	SO4509	formate dehydrogenase-O, major subunit (EC 1.2.1.2)
	Sputw3181_3872	fdhB-1	formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2); putative formate dehydrogenase iron-sulfur subunit (EC 1.2.1.2)
	Sputw3181_3873	SO4511	formate dehydrogenase -O, gamma subunit (EC 1.2.1.2)
Position: -151 Score: 4 Sequence: CACCATGATCCAGTTCACACTT Locus tag: Sputw3181_3708 Name: pckA Funciton: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
	Sputw3181_3708	pckA	phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
Position: -54 Score: 4.4 Sequence: TTACGTGACTTAAAGCACGTAT Locus tag: Sputw3181_3391 Name: sfcA Funciton: NAD-dependent malic enzyme (EC 1.1.1.38)
	Sputw3181_3391	sfcA	NAD-dependent malic enzyme (EC 1.1.1.38)
Position: -83 Score: 4 Sequence: TCTTGTGAGCCAGTTCACGCCT Locus tag: Sputw3181_3492 Name: SO3987 Funciton: hypothetical protein
	Sputw3181_3492	SO3987	hypothetical protein
Position: -117 Score: 4.6 Sequence: CGTTGTGATGTTTTTCACGATA Locus tag: Sputw3181_3197 Name: fadD-2 Funciton: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
	Sputw3181_3197	fadD-2	long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Position: -129 Score: 4.2 Sequence: AATCGTGATCACTTTTGCAAAA Locus tag: Sputw3181_0119 Name: yhgI Funciton: NfuA Fe-S protein maturation
	Sputw3181_0119	yhgI	NfuA Fe-S protein maturation
Position: -147 Score: 4.2 Sequence: CAATGTGAGCGGCTTCAAATTG Locus tag: Sputw3181_0842 Name: SO3776 Funciton: hypothetical protein
	Sputw3181_0842	SO3776	hypothetical protein
Position: -245 Score: 4.4 Sequence: AAATGTGATCTAGATCTCGTGT Locus tag: Sputw3181_2113 Name: rplY Funciton: LSU ribosomal protein L25p
	Sputw3181_2113	rplY	LSU ribosomal protein L25p
Position: -128 Score: 3.8 Sequence: GATAGTGTTGTCCGTCACATTT Locus tag: Sputw3181_0845 Name: SO3774 Funciton: proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
	Sputw3181_0845	SO3774	proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
Position: -142 Score: 4.2 Sequence: TTATGCGATATTGTTCTAAATT Locus tag: Sputw3181_0804 Name: serA Funciton: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) Locus tag: Sputw3181_0803 Name: SO0861 Funciton: folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress
	Sputw3181_0804	serA	D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95)
	Sputw3181_0803	SO0861	folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress
Position: -81 Score: 4 Sequence: ATTTGCAATCATGATCACACAG Locus tag: Sputw3181_3123 Name: SO3553 Funciton: putative sulfate permease
	Sputw3181_3123	SO3553	putative sulfate permease
Position: -105 Score: 4.5 Sequence: TCATGTGATCCCGATCTCAGTT Locus tag: Sputw3181_2617 Name: miaE Funciton: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-)
	Sputw3181_2617	miaE	tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-)
Position: -263 Score: 4.5 Sequence: ATTTGTGACGCAGATCGAATTG Position: -234 Score: 3.8 Sequence: ATTTGTAAGTGATTTCCCACTA Locus tag: Sputw3181_2859 Name: Sputcn32_1245 Funciton: transcriptional regulator, MarR family
	Sputw3181_2859	Sputcn32_1245	transcriptional regulator, MarR family
Position: -149 Score: 3.9 Sequence: AAGTGTGAACAACAACACTATT Position: -126 Score: 4.1 Sequence: CATTTTGATCTGGCGCAAACTT Locus tag: Sputw3181_3486 Name: nrfA Funciton: cytochrome c552 precursor (EC 1.7.2.2)
	Sputw3181_3486	nrfA	cytochrome c552 precursor (EC 1.7.2.2)
Position: -245 Score: 3.8 Sequence: AAAAGTGATAATGTTCTTAGAT Position: -173 Score: 3.9 Sequence: TATCGTGATTAGCTTGACGTAA Position: -130 Score: 4 Sequence: AAATATGATTTTATTAGCAGTT Locus tag: Sputw3181_3818 Name: SO0318 Funciton: hypothetical protein Locus tag: Sputw3181_3817 Name: SO0319 Funciton: conserved domain protein Locus tag: Sputw3181_3816 Name: SO0320 Funciton: conserved domain protein Locus tag: Sputw3181_3815 Name: SO0321 Funciton: hypothetical protein
	Sputw3181_3818	SO0318	hypothetical protein
	Sputw3181_3817	SO0319	conserved domain protein
	Sputw3181_3816	SO0320	conserved domain protein
	Sputw3181_3815	SO0321	hypothetical protein
Position: -76 Score: 3.8 Sequence: ATTTTTGAGCAAGATCACGGCT Locus tag: Sputw3181_0966 Name: null Funciton: hypothetical protein Locus tag: Sputw3181_0967 Name: SO3681 Funciton: universal stress protein family
	Sputw3181_0966		hypothetical protein
	Sputw3181_0967	SO3681	universal stress protein family
Position: -66 Score: 4.5 Sequence: ACACGAGATCTAGATCACATTT Locus tag: Sputw3181_2114 Name: SO2111 Funciton: hypothetical protein
	Sputw3181_2114	SO2111	hypothetical protein
Position: -262 Score: 4.8 Sequence: AAGTGTGATTAGTGTCACAGTT Position: -154 Score: 4.1 Sequence: TTTGGTGATTTTTGTCGCGTAA Position: -125 Score: 3.9 Sequence: TTTTGCGATTTTTATCGACAAA Position: -92 Score: 3.8 Sequence: TGATGTGATAAAGCTACAAAAT Position: -57 Score: 3.8 Sequence: GTGTGTGATCTATGCCATAAAT Locus tag: Sputw3181_0550 Name: nadC Funciton: di-and tricarboxylate transporter
	Sputw3181_0550	nadC	di-and tricarboxylate transporter
Position: -120 Score: 3.8 Sequence: TTTTGTGAGCAACAACCAATTT Position: -4 Score: 3.8 Sequence: ATTAATGATCTCGTTAACGCAA Locus tag: Sputw3181_1911 Name: gloA Funciton: lactoylglutathione lyase (EC 4.4.1.5)
	Sputw3181_1911	gloA	lactoylglutathione lyase (EC 4.4.1.5)
Position: -168 Score: 4.3 Sequence: AGCCGTGATCTTGCTCAAAAAT Locus tag: Sputw3181_0965 Name: SO3683 Funciton: aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) Locus tag: Sputw3181_0964 Name: SO3684 Funciton: transcriptional regulator, TetR family
	Sputw3181_0965	SO3683	aldehyde dehydrogenase (EC 1.2.1.3); probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
	Sputw3181_0964	SO3684	transcriptional regulator, TetR family
Position: -263 Score: 4.5 Sequence: ATTTGTGACGCAGATCGAATTG Position: -234 Score: 3.8 Sequence: ATTTGTAAGTGATTTCCCACTA Locus tag: Sputw3181_2859 Name: Sputcn32_1245 Funciton: transcriptional regulator, MarR family
	Sputw3181_2859	Sputcn32_1245	transcriptional regulator, MarR family
Position: -81 Score: 4 Sequence: ATTTGCAATCATGATCACACAG Locus tag: Sputw3181_3123 Name: SO3553 Funciton: putative sulfate permease Locus tag: Sputw3181_3124 Name: purE Funciton: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) Locus tag: Sputw3181_3125 Name: purK Funciton: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) Locus tag: Sputw3181_3126 Name: SO3556 Funciton: cyclic nucleotide phosphodiesterase, putative
	Sputw3181_3123	SO3553	putative sulfate permease
	Sputw3181_3124	purE	phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
	Sputw3181_3125	purK	phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
	Sputw3181_3126	SO3556	cyclic nucleotide phosphodiesterase, putative
Position: -187 Score: 3.8 Sequence: TTGGGTGAGGACTGTCACAGAT Locus tag: Sputw3181_0243 Name: moaA Funciton: molybdenum cofactor biosynthesis protein MoaA Locus tag: Sputw3181_0244 Name: moaC Funciton: molybdenum cofactor biosynthesis protein MoaC Locus tag: Sputw3181_0245 Name: moaD Funciton: molybdenum cofactor biosynthesis protein MoaD Locus tag: Sputw3181_0246 Name: moaE Funciton: molybdenum cofactor biosynthesis protein MoaE Locus tag: Sputw3181_0247 Name: modA Funciton: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1) Locus tag: Sputw3181_0248 Name: modB Funciton: molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Sputw3181_0249 Name: modC Funciton: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	Sputw3181_0243	moaA	molybdenum cofactor biosynthesis protein MoaA
	Sputw3181_0244	moaC	molybdenum cofactor biosynthesis protein MoaC
	Sputw3181_0245	moaD	molybdenum cofactor biosynthesis protein MoaD
	Sputw3181_0246	moaE	molybdenum cofactor biosynthesis protein MoaE
	Sputw3181_0247	modA	molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
	Sputw3181_0248	modB	molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	Sputw3181_0249	modC	molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Position: -57 Score: 4.1 Sequence: AATAGTGATTAATCTCACTTTC Locus tag: Sputw3181_0938 Name: SO1064 Funciton: FOG: WD40 repeat Locus tag: Sputw3181_0937 Name: slyX Funciton: protein SlyX Locus tag: Sputw3181_0936 Name: def-2 Funciton: peptide deformylase (EC 3.5.1.88) Locus tag: Sputw3181_0935 Name: SO1061 Funciton: TPR domain protein Locus tag: Sputw3181_0934 Name: spaP Funciton: Putative lipoprotein Locus tag: Sputw3181_0933 Name: SO1059 Funciton: membrane alanine aminopeptidase N (EC 3.4.11.2)
	Sputw3181_0938	SO1064	FOG: WD40 repeat
	Sputw3181_0937	slyX	protein SlyX
	Sputw3181_0936	def-2	peptide deformylase (EC 3.5.1.88)
	Sputw3181_0935	SO1061	TPR domain protein
	Sputw3181_0934	spaP	Putative lipoprotein
	Sputw3181_0933	SO1059	membrane alanine aminopeptidase N (EC 3.4.11.2)
Position: -140 Score: 4.4 Sequence: TTTTGTGATGTTAATCTACATA Locus tag: Sputw3181_2585 Name: SO1821 Funciton: outer membrane porin, putative
	Sputw3181_2585	SO1821	outer membrane porin, putative
Position: -96 Score: 4.1 Sequence: TTTTGTGCGCACCTTCATAAAT Locus tag: Sputw3181_3804 Name: ygbA Funciton: nitrosative stress induced protein
	Sputw3181_3804	ygbA	nitrosative stress induced protein
Position: -173 Score: 4.3 Sequence: AAACGCGATCTTTATCACTATT Locus tag: Sputw3181_1518 Name: SO3120 Funciton: oxidoreductase, Gfo/Idh/MocA family
	Sputw3181_1518	SO3120	oxidoreductase, Gfo/Idh/MocA family
Position: -84 Score: 3.8 Sequence: CTATTTGCGCAGCATCACAAAA Position: -45 Score: 3.9 Sequence: TAAAGTGATGGGGTAAAAATAA Locus tag: Sputw3181_3774 Name: SO0355 Funciton: long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) Locus tag: Sputw3181_3775 Name: SO0354 Funciton: inner membrane protein YrbG, predicted calcium/sodium:proton antiporter
	Sputw3181_3774	SO0355	long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
	Sputw3181_3775	SO0354	inner membrane protein YrbG, predicted calcium/sodium:proton antiporter
Position: -313 Score: 4 Sequence: TATTGTAATTTAGCCAAAATTT Position: -114 Score: 3.8 Sequence: GAATATGACAGGTTTCACGTTT Locus tag: Sputw3181_3618 Name: SO4118 Funciton: NADP-dependent malic enzyme (EC 1.1.1.40) Locus tag: Sputw3181_3617 Name: mshH Funciton: MSHA biogenesis protein MshH, GGDEF:EAL domain protein Locus tag: Sputw3181_3616 Name: mshI Funciton: MSHA biogenesis protein MshI
	Sputw3181_3618	SO4118	NADP-dependent malic enzyme (EC 1.1.1.40)
	Sputw3181_3617	mshH	MSHA biogenesis protein MshH, GGDEF:EAL domain protein
	Sputw3181_3616	mshI	MSHA biogenesis protein MshI
Position: -183 Score: 4.6 Sequence: AAATGTGATATTGGTCTTAAAT Locus tag: Sputw3181_2423 Name: Swoo_2741 Funciton: Alkyl hydroperoxide reductase subunit C-like protein
	Sputw3181_2423	Swoo_2741	Alkyl hydroperoxide reductase subunit C-like protein
Position: -97 Score: 4.2 Sequence: CATTGTGAAGCGTATCATGTAA Locus tag: Sputw3181_3632 Name: SO4138 Funciton: hypothetical protein
	Sputw3181_3632	SO4138	hypothetical protein
Position: -213 Score: 3.9 Sequence: TTTTGTGATTAGAATCTCAGCG Locus tag: Sputw3181_0188 Name: ccmA Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA Locus tag: Sputw3181_0187 Name: ccmB Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit Locus tag: Sputw3181_0186 Name: ccmC Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE Locus tag: Sputw3181_0185 Name: ccmD Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE Locus tag: Sputw3181_0184 Name: ccmE Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
	Sputw3181_0188	ccmA	ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
	Sputw3181_0187	ccmB	ABC transporter involved in cytochrome c biogenesis, CcmB subunit
	Sputw3181_0186	ccmC	cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
	Sputw3181_0185	ccmD	cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
	Sputw3181_0184	ccmE	cytochrome c-type biogenesis protein CcmE, heme chaperone
Position: -229 Score: 4 Sequence: CAATTTGATGTGGTTCCAATAA Position: -129 Score: 3.7 Sequence: CGCTGAGATTCTAATCACAAAA Locus tag: Sputw3181_0189 Name: scyA Funciton: cytochrome c-type protein
	Sputw3181_0189	scyA	cytochrome c-type protein
Position: -259 Score: 4.2 Sequence: ATGTGTGACATGGATCTAGTTT Locus tag: Sputw3181_0721 Name: argR Funciton: arginine pathway regulatory protein ArgR, repressor of arg regulon
	Sputw3181_0721	argR	arginine pathway regulatory protein ArgR, repressor of arg regulon
Position: -178 Score: 4.3 Sequence: AATTGAGAACTAGTTCACTTTT Locus tag: Sputw3181_3978 Name: prlC Funciton: Oligopeptidase A (EC 3.4.24.70)
	Sputw3181_3978	prlC	Oligopeptidase A (EC 3.4.24.70)
Position: -75 Score: 4.2 Sequence: AGTCGTGATTGTGCTCACACCA Locus tag: Sputw3181_1650 Name: SO2858 Funciton: hypothetical protein Locus tag: Sputw3181_1651 Name: SO2857 Funciton: sodium solute symporter family protein Locus tag: Sputw3181_1652 Name: SO2856 Funciton: predicted signal-transduction protein containing cAMP-binding and CBS domains Locus tag: Sputw3181_1653 Name: SO2855 Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
	Sputw3181_1650	SO2858	hypothetical protein
	Sputw3181_1651	SO2857	sodium solute symporter family protein
	Sputw3181_1652	SO2856	predicted signal-transduction protein containing cAMP-binding and CBS domains
	Sputw3181_1653	SO2855	DNA polymerase III epsilon subunit (EC 2.7.7.7)
Position: -141 Score: 4.1 Sequence: GAGTGTGACCTGATTCATACTT Locus tag: Sputw3181_0534 Name: acnB Funciton: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99)
	Sputw3181_0534	acnB	aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99)
Position: -94 Score: 4.3 Sequence: TTACATGATACGCTTCACAATG Locus tag: Sputw3181_3633 Name: Sputcn32_0539 Funciton: mechanosensitive ion channel Locus tag: Sputw3181_3634 Name: SO4139 Funciton: tetratricopeptide repeat family protein
	Sputw3181_3633	Sputcn32_0539	mechanosensitive ion channel
	Sputw3181_3634	SO4139	tetratricopeptide repeat family protein
Position: -207 Score: 4.5 Sequence: TTTTGTGAGCAAGCTAAAATTA Position: -135 Score: 3.9 Sequence: AATTGATATTTAAATCACCTAG Locus tag: Sputw3181_0907 Name: hemG Funciton: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-) Locus tag: Sputw3181_0908 Name: SO3719 Funciton: hypothetical protein
	Sputw3181_0907	hemG	protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
	Sputw3181_0908	SO3719	hypothetical protein
Position: -204 Score: 4.3 Sequence: TAGTGTGACGCTTGTCCCAATA Locus tag: Sputw3181_1366 Name: cydA Funciton: cytochrome d ubiquinol oxidase, subunit I, CydA Locus tag: Sputw3181_1367 Name: cydB Funciton: cytochrome d ubiquinol oxidase, subunit II, CydB
	Sputw3181_1366	cydA	cytochrome d ubiquinol oxidase, subunit I, CydA
	Sputw3181_1367	cydB	cytochrome d ubiquinol oxidase, subunit II, CydB
Position: -230 Score: 4.4 Sequence: AAGTTAGATCTGGTTCACACTT Position: -92 Score: 4.1 Sequence: TTCTGTGATCAAGTTAACCTTC Locus tag: Sputw3181_3629 Name: udp Funciton: Uridine phosphorylase (EC 2.4.2.3)
	Sputw3181_3629	udp	Uridine phosphorylase (EC 2.4.2.3)
Position: -114 Score: 4.5 Sequence: AATAGTGTTGTTGTTCACACTT Locus tag: Sputw3181_3487 Name: narQ Funciton: Nitrate/nitrite sensor protein (EC 2.7.3.-) Locus tag: Sputw3181_3488 Name: narP Funciton: Nitrate/nitrite response regulator protein
	Sputw3181_3487	narQ	Nitrate/nitrite sensor protein (EC 2.7.3.-)
	Sputw3181_3488	narP	Nitrate/nitrite response regulator protein
Position: -86 Score: 4.3 Sequence: TATAGTGATTTCAATCACAACC Locus tag: Sputw3181_3755 Name: ilvC Funciton: Ketol-acid reductoisomerase (EC 1.1.1.86)
	Sputw3181_3755	ilvC	Ketol-acid reductoisomerase (EC 1.1.1.86)
Position: -169 Score: 4.7 Sequence: TTTTGTGAATCGGTTAACAAAA Locus tag: Sputw3181_0838 Name: cydD Funciton: Transport ATP-binding protein CydD Locus tag: Sputw3181_0839 Name: cydC Funciton: Transport ATP-binding protein CydC Locus tag: Sputw3181_0840 Name: cyaB Funciton: adenylate cyclase CyaB, putative
	Sputw3181_0838	cydD	Transport ATP-binding protein CydD
	Sputw3181_0839	cydC	Transport ATP-binding protein CydC
	Sputw3181_0840	cyaB	adenylate cyclase CyaB, putative
Position: -242 Score: 4 Sequence: TTTTGTGAATTAGAGTAAAAAT Locus tag: Sputw3181_0611 Name: SO0544 Funciton: sensory box histidine kinase Locus tag: Sputw3181_0612 Name: SO0544.1 Funciton: response regulator receiver protein
	Sputw3181_0611	SO0544	sensory box histidine kinase
	Sputw3181_0612	SO0544.1	response regulator receiver protein
Position: -95 Score: 4 Sequence: TCTTGTGAATTGAGTCACAGAG Locus tag: Sputw3181_2545 Name: SO2806 Funciton: hypothetical protein
	Sputw3181_2545	SO2806	hypothetical protein
Position: -88 Score: 4.2 Sequence: ATTTTTACTCTAATTCACAAAA Locus tag: Sputw3181_0610 Name: SO0543 Funciton: hypothetical protein
	Sputw3181_0610	SO0543	hypothetical protein
Position: -155 Score: 4.6 Sequence: CATTGGGATTTTTATCACATAA Locus tag: Sputw3181_2621 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Sputw3181_2620 Name: feoB Funciton: Ferrous iron transport protein B
	Sputw3181_2621	feoA	Ferrous iron transport protein A
	Sputw3181_2620	feoB	Ferrous iron transport protein B
Position: -127 Score: 4.5 Sequence: AATAGTGAGCGATATCACGATT Locus tag: Sputw3181_2819 Name: SO1539 Funciton: Probable acylaminoacyl-peptidase (EC 3.4.19.1)
	Sputw3181_2819	SO1539	Probable acylaminoacyl-peptidase (EC 3.4.19.1)
Position: -270 Score: 4.2 Sequence: TTTAGTGATATTAGTCAACTAA Locus tag: Sputw3181_3521 Name: sel1 Funciton: Sel1 domain protein repeat-containing protein precursor
	Sputw3181_3521	sel1	Sel1 domain protein repeat-containing protein precursor
Position: -95 Score: 4.3 Sequence: AAATATTACTCCGATCACATTA Locus tag: Sputw3181_0043 Name: cytcB Funciton: diheme cytochrome c4
	Sputw3181_0043	cytcB	diheme cytochrome c4
Position: -91 Score: 5.4 Sequence: AAATGTGATGCAGATCTCATTT Position: -51 Score: 3.8 Sequence: AAGTGTTAACATAAGCACACTT Locus tag: Sputw3181_3725 Name: cyaA Funciton: Adenylate cyclase (EC 4.6.1.1)
	Sputw3181_3725	cyaA	Adenylate cyclase (EC 4.6.1.1)
Position: -60 Score: 4.4 Sequence: ATGTTAGATTTTGATCACATTT Position: -30 Score: 3.8 Sequence: TAATGGGTTCTTGCTCAAACAT Locus tag: Sputw3181_1539 Name: putP Funciton: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter
	Sputw3181_1539	putP	proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter
Position: -90 Score: 4.2 Sequence: ACTTGGGATTAGTTTCACATTA Locus tag: Sputw3181_3897 Name: Sbal_0179 Funciton: transcriptional regulator, LysR family Locus tag: Sputw3181_3898 Name: menD Funciton: 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) Locus tag: Sputw3181_3899 Name: SO4574 Funciton: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) Locus tag: Sputw3181_3900 Name: menC Funciton: O-succinylbenzoate-CoA synthase (EC 4.2.1.-) Locus tag: Sputw3181_3901 Name: SO4576 Funciton: O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26)
	Sputw3181_3897	Sbal_0179	transcriptional regulator, LysR family
	Sputw3181_3898	menD	2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9)
	Sputw3181_3899	SO4574	2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20)
	Sputw3181_3900	menC	O-succinylbenzoate-CoA synthase (EC 4.2.1.-)
	Sputw3181_3901	SO4576	O-succinylbenzoic acid--CoA ligase (EC 6.2.1.26)
Position: -234 Score: 4 Sequence: TCATGTGATCAAGCCTACATTT Position: -95 Score: 4.1 Sequence: AATTTGGATGTAGGGCACATTT Locus tag: Sputw3181_3114 Name: phk Funciton: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9)
	Sputw3181_3114	phk	Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9)
Position: -193 Score: 4.7 Sequence: TTTATTGATGGCGATCACAATT Locus tag: Sputw3181_2233 Name: SO2535 Funciton: Predicted glutamine amidotransferase
	Sputw3181_2233	SO2535	Predicted glutamine amidotransferase
Position: -95 Score: 4.3 Sequence: AAATATTACTCCGATCACATTA Locus tag: Sputw3181_0043 Name: cytcB Funciton: Cytochrome c4
	Sputw3181_0043	cytcB	Cytochrome c4
Position: -48 Score: 4.5 Sequence: GTTTGTTATCTATATCACACAA Locus tag: Sputw3181_0090 Name: Sbal_2136 Funciton: putative OMR family iron-siderophore receptor precursor
	Sputw3181_0090	Sbal_2136	putative OMR family iron-siderophore receptor precursor
Position: -96 Score: 4.6 Sequence: TAATGTGATCGGAGTAATATTT Locus tag: Sputw3181_0044 Name: engB Funciton: GTP-binding protein EngB
	Sputw3181_0044	engB	GTP-binding protein EngB
Position: -153 Score: 4.5 Sequence: AAAAGTGAACTAGTTCTCAATT Locus tag: Sputw3181_3979 Name: null Funciton: hypothetical protein
	Sputw3181_3979		hypothetical protein
Position: -66 Score: 4.1 Sequence: AATTGATAACAAGATCACATAA Locus tag: Sputw3181_2354 Name: hmgA Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
	Sputw3181_2354	hmgA	Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Position: -101 Score: 4.7 Sequence: TGTATTGATCCAGATCACAAAT Locus tag: Sputw3181_3024 Name: cyaC Funciton: Adenylate cyclase (EC 4.6.1.1)
	Sputw3181_3024	cyaC	Adenylate cyclase (EC 4.6.1.1)
Position: -234 Score: 4.8 Sequence: TTAAGTGATCTAGCTCACTTAA Locus tag: Sputw3181_2420 Name: SO2753 Funciton: prolyl endopeptidase (EC 3.4.21.26)
	Sputw3181_2420	SO2753	prolyl endopeptidase (EC 3.4.21.26)
Position: -129 Score: 4.3 Sequence: CAGCGTGATTGCGATCGCATTT Locus tag: Sputw3181_3236 Name: nqrA-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-) Locus tag: Sputw3181_3235 Name: nqrB-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-) Locus tag: Sputw3181_3234 Name: nqrC-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-) Locus tag: Sputw3181_3233 Name: nqrD-1 Funciton: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-) Locus tag: Sputw3181_3232 Name: nqrE-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-) Locus tag: Sputw3181_3231 Name: nqrF-2 Funciton: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
	Sputw3181_3236	nqrA-2	Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
	Sputw3181_3235	nqrB-2	Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
	Sputw3181_3234	nqrC-2	Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
	Sputw3181_3233	nqrD-1	Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
	Sputw3181_3232	nqrE-2	Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
	Sputw3181_3231	nqrF-2	Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
Position: -147 Score: 4.3 Sequence: ATTTGTTACTCTGCGCACATTT Locus tag: Sputw3181_0647 Name: SO0584 Funciton: methyl-accepting chemotaxis protein
	Sputw3181_0647	SO0584	methyl-accepting chemotaxis protein
Position: -172 Score: 4.4 Sequence: AAACATGATCTGCTTAACAAAA Locus tag: Sputw3181_0400 Name: SO4520 Funciton: Oxygen-independent coproporphyrinogen III oxidase, putative
	Sputw3181_0400	SO4520	Oxygen-independent coproporphyrinogen III oxidase, putative
Position: -191 Score: 4.3 Sequence: AATTGCAACCTTGCTCACAATT Locus tag: Sputw3181_1661 Name: Sputcn32_2347 Funciton: methyl-accepting chemotaxis sensory transducer
	Sputw3181_1661	Sputcn32_2347	methyl-accepting chemotaxis sensory transducer
Position: -171 Score: 4.2 Sequence: ATCTGTGACAGTCCTCACCCAA Locus tag: Sputw3181_0242 Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
	Sputw3181_0242	etfD	Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Position: -173 Score: 4.1 Sequence: AAGTGTGCTTATGTTAACACTT Position: -133 Score: 5.2 Sequence: AAATGAGATCTGCATCACATTT Locus tag: Sputw3181_3726 Name: hemC Funciton: Porphobilinogen deaminase (EC 2.5.1.61) Locus tag: Sputw3181_3727 Name: hemD Funciton: Uroporphyrinogen-III synthase (EC 4.2.1.75) Locus tag: Sputw3181_3728 Name: hemX Funciton: Homolog of E. coli HemX protein Locus tag: Sputw3181_3729 Name: hemY Funciton: HemY domain-containing protein
	Sputw3181_3726	hemC	Porphobilinogen deaminase (EC 2.5.1.61)
	Sputw3181_3727	hemD	Uroporphyrinogen-III synthase (EC 4.2.1.75)
	Sputw3181_3728	hemX	Homolog of E. coli HemX protein
	Sputw3181_3729	hemY	HemY domain-containing protein
Position: -175 Score: 4.2 Sequence: ATTAGTGATCGCTCCCACAGAA Locus tag: Sputw3181_0373 Name: SO4240 Funciton: tetratricopeptide domain protein precursor
	Sputw3181_0373	SO4240	tetratricopeptide domain protein precursor
Position: -225 Score: 4.5 Sequence: TTAGGTGATTCATCTCAAAAAA Locus tag: Sputw3181_3109 Name: rpsT Funciton: SSU ribosomal protein S20p
	Sputw3181_3109	rpsT	SSU ribosomal protein S20p
Position: -185 Score: 4.4 Sequence: TTGTGTGACACGAATCAAGTTT Locus tag: Sputw3181_3399 Name: SO3890 Funciton: methyl-accepting chemotaxis protein
	Sputw3181_3399	SO3890	methyl-accepting chemotaxis protein
Position: -261 Score: 3.9 Sequence: TTTTGTTTTTGTGATAACAATT Position: -255 Score: 3.7 Sequence: TTTTGTGATAACAATTTAAGTT Locus tag: Sputw3181_0204 Name: frdA Funciton: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: Sputw3181_0203 Name: frdB Funciton: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
	Sputw3181_0204	frdA	succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
	Sputw3181_0203	frdB	succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
Position: -67 Score: 4.1 Sequence: ATTTGTGAGCGATATTAACTTT Locus tag: Sputw3181_0499 Name: fdrC Funciton: fumarate reductase cytochrome b subunit Locus tag: Sputw3181_0500 Name: frdA Funciton: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: Sputw3181_0501 Name: frdB Funciton: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
	Sputw3181_0499	fdrC	fumarate reductase cytochrome b subunit
	Sputw3181_0500	frdA	succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
	Sputw3181_0501	frdB	succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
Position: -49 Score: 4.5 Sequence: TTTTTTGAGATGAATCACCTAA Locus tag: Sputw3181_3108 Name: mviN Funciton: proposed peptidoglycan lipid II flippase MurJ Locus tag: Sputw3181_3107 Name: ribF Funciton: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2) Locus tag: Sputw3181_3106 Name: ileS Funciton: isoleucyl-tRNA synthetase (EC 6.1.1.5) Locus tag: Sputw3181_3105 Name: lspA Funciton: lipoprotein signal peptidase (EC 3.4.23.36) Locus tag: Sputw3181_3104 Name: fkbP-2 Funciton: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8) Locus tag: Sputw3181_3103 Name: lytB Funciton: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) Locus tag: Sputw3181_3102 Name: pilV Funciton: type IV fimbrial biogenesis protein PilV Locus tag: Sputw3181_3101 Name: pilW Funciton: type IV fimbrial biogenesis protein PilW Locus tag: Sputw3181_3100 Name: pilX Funciton: type IV fimbrial biogenesis protein PilX Locus tag: Sputw3181_3099 Name: pilY1 Funciton: type IV fimbrial biogenesis protein PilY1 Locus tag: Sputw3181_3098 Name: pilE Funciton: type IV pilus biogenesis protein PilE
	Sputw3181_3108	mviN	proposed peptidoglycan lipid II flippase MurJ
	Sputw3181_3107	ribF	riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
	Sputw3181_3106	ileS	isoleucyl-tRNA synthetase (EC 6.1.1.5)
	Sputw3181_3105	lspA	lipoprotein signal peptidase (EC 3.4.23.36)
	Sputw3181_3104	fkbP-2	FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
	Sputw3181_3103	lytB	4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
	Sputw3181_3102	pilV	type IV fimbrial biogenesis protein PilV
	Sputw3181_3101	pilW	type IV fimbrial biogenesis protein PilW
	Sputw3181_3100	pilX	type IV fimbrial biogenesis protein PilX
	Sputw3181_3099	pilY1	type IV fimbrial biogenesis protein PilY1
	Sputw3181_3098	pilE	type IV pilus biogenesis protein PilE
Position: -111 Score: 4.7 Sequence: TATTGTGATCAGTATCAAACAC Locus tag: Sputw3181_0528 Name: lpdA Funciton: Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
	Sputw3181_0528	lpdA	Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
Position: -318 Score: 4.6 Sequence: GCGTGTGATCTATATCACATAA Locus tag: Sputw3181_2068 Name: null Funciton: TonB-dependent receptor
	Sputw3181_2068		TonB-dependent receptor
Position: -278 Score: 4.1 Sequence: TTTTGTTAAGCAGATCATGTTT Locus tag: Sputw3181_0399 Name: SO4519 Funciton: sodium-dependent transporter
	Sputw3181_0399	SO4519	sodium-dependent transporter
Position: -154 Score: 5.1 Sequence: TTATGTGATGATGATCAAAATT Locus tag: Sputw3181_2264 Name: fadD1 Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
	Sputw3181_2264	fadD1	Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Position: -102 Score: 4.3 Sequence: TATTTTGACTAAGGTCAAAATT Locus tag: Sputw3181_0637 Name: SO0572 Funciton: enoyl-CoA hydratase (EC 4.2.1.17)
	Sputw3181_0637	SO0572	enoyl-CoA hydratase (EC 4.2.1.17)
Position: -316 Score: 3.9 Sequence: AAGTATGAATCAGGTCACACTC Locus tag: Sputw3181_0533 Name: yniC Funciton: 2-deoxyglucose-6-phosphate hydrolase YniC
	Sputw3181_0533	yniC	2-deoxyglucose-6-phosphate hydrolase YniC
Position: -260 Score: 4.4 Sequence: ATTTTTAACCTGCGTCACATTT Locus tag: Sputw3181_2977 Name: Sbal_3098 Funciton: 83 kDa decaheme outer membrane cytochrome c
	Sputw3181_2977	Sbal_3098	83 kDa decaheme outer membrane cytochrome c
Position: -328 Score: 4.3 Sequence: TAATGTGATCTTATTCGTTATT Position: -132 Score: 4.3 Sequence: TAATGTGCTCTAGCTCTGATTT Locus tag: Sputw3181_0577 Name: mccA Funciton: cytochrome c, putative
	Sputw3181_0577	mccA	cytochrome c, putative
Position: -242 Score: 4.8 Sequence: AAACGAGATCTAAATCACAAAA Locus tag: Sputw3181_1273 Name: SO3421 Funciton: b-type cytochrome, putative
	Sputw3181_1273	SO3421	b-type cytochrome, putative
Position: -317 Score: 4.9 Sequence: AAATGCGATATAGATCACAAAC Locus tag: Sputw3181_3395 Name: SO3895 Funciton: HesA/MoeB/ThiF family protein related to EC-YgdL
	Sputw3181_3395	SO3895	HesA/MoeB/ThiF family protein related to EC-YgdL
Position: -293 Score: 4.3 Sequence: AATAGTGATTTTTATTGCAAAT Position: -224 Score: 4.3 Sequence: GTTTGTGATGTAGATCGCTAAA Locus tag: Sputw3181_3027 Name: SO1326 Funciton: COG1242: Predicted Fe-S oxidoreductase
	Sputw3181_3027	SO1326	COG1242: Predicted Fe-S oxidoreductase
Position: -142 Score: 4.1 Sequence: AACTGGTATTTTGATCACATTT Locus tag: Sputw3181_3529 Name: astC Funciton: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81) Locus tag: Sputw3181_3528 Name: astA Funciton: Arginine N-succinyltransferase (EC 2.3.1.109) Locus tag: Sputw3181_3527 Name: astD Funciton: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71) Locus tag: Sputw3181_3526 Name: SO0620 Funciton: FIG008480: hypothetical protein
	Sputw3181_3529	astC	Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
	Sputw3181_3528	astA	Arginine N-succinyltransferase (EC 2.3.1.109)
	Sputw3181_3527	astD	Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
	Sputw3181_3526	SO0620	FIG008480: hypothetical protein
Position: -309 Score: 4.4 Sequence: ATAAGTGATCTTGATCAATATT Locus tag: Sputw3181_0133 Name: SO4606 Funciton: cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: Sputw3181_0132 Name: SO4607 Funciton: cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: Sputw3181_0131 Name: coxG Funciton: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: Sputw3181_0130 Name: SO4609 Funciton: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
	Sputw3181_0133	SO4606	cytochrome c oxidase polypeptide II (EC 1.9.3.1)
	Sputw3181_0132	SO4607	cytochrome c oxidase polypeptide I (EC 1.9.3.1)
	Sputw3181_0131	coxG	cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
	Sputw3181_0130	SO4609	cytochrome c oxidase polypeptide III (EC 1.9.3.1)
Position: -195 Score: 4.6 Sequence: AAAAGTGATTTTTATCACTAAA Locus tag: Sputw3181_0378 Name: SO4232 Funciton: long-chain fatty acid transport protein Locus tag: Sputw3181_0379 Name: glpK Funciton: glycerol kinase (EC 2.7.1.30)
	Sputw3181_0378	SO4232	long-chain fatty acid transport protein
	Sputw3181_0379	glpK	glycerol kinase (EC 2.7.1.30)
Position: -124 Score: 4.3 Sequence: TAAGGTGATAACCCTCGCAAAT Locus tag: Sputw3181_2990 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: Sputw3181_2989 Name: hcr Funciton: Flavodoxin reductases (ferredoxin-NADPH reductases) family 1
	Sputw3181_2990	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	Sputw3181_2989	hcr	Flavodoxin reductases (ferredoxin-NADPH reductases) family 1
Position: -185 Score: 4 Sequence: AAGTGTTACGCCTATCCCAAAT Locus tag: Sputw3181_0951 Name: SO3699.1 Funciton: hypothetical protein
	Sputw3181_0951	SO3699.1	hypothetical protein
Position: -198 Score: 4.2 Sequence: TTATGTGATTTTGACAACAACA Position: -157 Score: 4.4 Sequence: AAATGTGAATTTTTGCATATAT Locus tag: Sputw3181_3628 Name: SO4131 Funciton: nucleoside-binding outer membrane protein
	Sputw3181_3628	SO4131	nucleoside-binding outer membrane protein
Position: -178 Score: 4.1 Sequence: TTATGTGAGCTGGCTTGTATTT Locus tag: Sputw3181_3999 Name: hutC Funciton: histidine utilization repressor Locus tag: Sputw3181_3998 Name: hutU Funciton: urocanate hydratase (EC 4.2.1.49) Locus tag: Sputw3181_3997 Name: hutH Funciton: histidine ammonia-lyase (EC 4.3.1.3)
	Sputw3181_3999	hutC	histidine utilization repressor
	Sputw3181_3998	hutU	urocanate hydratase (EC 4.2.1.49)
	Sputw3181_3997	hutH	histidine ammonia-lyase (EC 4.3.1.3)
Position: -167 Score: 3.7 Sequence: AAATTAGATCTGCGTCATGTTA Position: -107 Score: 4 Sequence: ATTCTTGATATACATCAATAAT Locus tag: Sputw3181_1924 Name: hyaA Funciton: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1) Locus tag: Sputw3181_1923 Name: hyaB Funciton: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1) Locus tag: Sputw3181_1922 Name: hydC Funciton: Ni,Fe-hydrogenase I cytochrome b subunit Locus tag: Sputw3181_1921 Name: hyaD Funciton: Hydrogenase maturation protease (EC 3.4.24.-) Locus tag: Sputw3181_1920 Name: hyaE Funciton: NiFe hydrogenase assembly chaperone, HyaE Locus tag: Sputw3181_1919 Name: hyaF Funciton: NiFe hydrogenase assembly protein, HypF
	Sputw3181_1924	hyaA	Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
	Sputw3181_1923	hyaB	Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
	Sputw3181_1922	hydC	Ni,Fe-hydrogenase I cytochrome b subunit
	Sputw3181_1921	hyaD	Hydrogenase maturation protease (EC 3.4.24.-)
	Sputw3181_1920	hyaE	NiFe hydrogenase assembly chaperone, HyaE
	Sputw3181_1919	hyaF	NiFe hydrogenase assembly protein, HypF
Position: -99 Score: 4.2 Sequence: AAGTGTGATACTGGTCAATAAA Locus tag: Sputw3181_3896 Name: null Funciton: hypothetical protein Locus tag: Sputw3181_3895 Name: nrfB Funciton: Cytochrome c-type protein NrfB precursor Locus tag: Sputw3181_3894 Name: nrfC Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein Locus tag: Sputw3181_3893 Name: nrfD-2 Funciton: nitrite reductase, quinol dehydrogenase component, NrfD
	Sputw3181_3896		hypothetical protein
	Sputw3181_3895	nrfB	Cytochrome c-type protein NrfB precursor
	Sputw3181_3894	nrfC	4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
	Sputw3181_3893	nrfD-2	nitrite reductase, quinol dehydrogenase component, NrfD
Position: -193 Score: 4 Sequence: TATTGTGAAATCACGCAGAAAA Locus tag: Sputw3181_0542 Name: purH Funciton: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) Locus tag: Sputw3181_0541 Name: purD Funciton: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
	Sputw3181_0542	purH	IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
	Sputw3181_0541	purD	Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
Position: -148 Score: 4.8 Sequence: TTATGTGATCTTGTTATCAATT Locus tag: Sputw3181_2353 Name: hmgR Funciton: Tyrosine degradation transcriptional regulator, LysR family
	Sputw3181_2353	hmgR	Tyrosine degradation transcriptional regulator, LysR family
Position: -211 Score: 4.2 Sequence: ATAAATGCTGCGTATCACATAA Locus tag: Sputw3181_2709 Name: ompW Funciton: outer membrane protein W precursor
	Sputw3181_2709	ompW	outer membrane protein W precursor
Position: -210 Score: 3.7 Sequence: CTCTGTGCAGTGTATCACAAAG Locus tag: Sputw3181_0013 Name: fadB Funciton: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3) Locus tag: Sputw3181_0012 Name: fadA Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
	Sputw3181_0013	fadB	enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
	Sputw3181_0012	fadA	3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
Position: -171 Score: 4.2 Sequence: TTTTTTGACATTGCTCAAGTAT Locus tag: Sputw3181_2046 Name: ccoN Funciton: Cbb3-type cytochrome c oxidase, subunit I, CcoN Locus tag: Sputw3181_2047 Name: ccoO Funciton: Cbb3-type cytochrome c oxidase, subunit II, CcoO Locus tag: Sputw3181_2048 Name: ccoQ Funciton: Cbb3-type cytochrome c oxidase, subunit IV, CcoQ Locus tag: Sputw3181_2049 Name: ccoP Funciton: Cbb3-type cytochrome c oxidase, subunit III, CcoP
	Sputw3181_2046	ccoN	Cbb3-type cytochrome c oxidase, subunit I, CcoN
	Sputw3181_2047	ccoO	Cbb3-type cytochrome c oxidase, subunit II, CcoO
	Sputw3181_2048	ccoQ	Cbb3-type cytochrome c oxidase, subunit IV, CcoQ
	Sputw3181_2049	ccoP	Cbb3-type cytochrome c oxidase, subunit III, CcoP
Position: -75 Score: 4.7 Sequence: AAGTGTGAGGGAGTTAACAAAA Locus tag: Sputw3181_2715 Name: phhA Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1) Locus tag: Sputw3181_2714 Name: phhB Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
	Sputw3181_2715	phhA	Phenylalanine-4-hydroxylase (EC 1.14.16.1)
	Sputw3181_2714	phhB	Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
Position: -229 Score: 5 Sequence: AAATGTGATTTGTGTCACGCTA Locus tag: Sputw3181_2712 Name: fahA Funciton: Fumarylacetoacetate hydrolase family protein Locus tag: Sputw3181_2711 Name: maiA Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
	Sputw3181_2712	fahA	Fumarylacetoacetate hydrolase family protein
	Sputw3181_2711	maiA	Maleylacetoacetate isomerase (EC 5.2.1.2)
Position: -298 Score: 3.8 Sequence: AGTTGTTAAGTGCCTCCCAAAT Locus tag: Sputw3181_1632 Name: Spea_1673 Funciton: hypothetical protein
	Sputw3181_1632	Spea_1673	hypothetical protein
Position: -81 Score: 4 Sequence: ATTTGCAATCATGATCACACAG Locus tag: Sputw3181_3123 Name: SO3553 Funciton: putative sulfate permease Locus tag: Sputw3181_3124 Name: purE Funciton: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21) Locus tag: Sputw3181_3125 Name: purK Funciton: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21) Locus tag: Sputw3181_3126 Name: SO3556 Funciton: cyclic nucleotide phosphodiesterase, putative
	Sputw3181_3123	SO3553	putative sulfate permease
	Sputw3181_3124	purE	phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
	Sputw3181_3125	purK	phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
	Sputw3181_3126	SO3556	cyclic nucleotide phosphodiesterase, putative
Position: -216 Score: 4.2 Sequence: TTTTGTGAAGCACTGCAAAGAT Locus tag: Sputw3181_0556 Name: shew_3181 Funciton: twin-arginine translocation pathway signal precursor Locus tag: Sputw3181_0555 Name: shew_3182 Funciton: tetraheme cytochrome c
	Sputw3181_0556	shew_3181	twin-arginine translocation pathway signal precursor
	Sputw3181_0555	shew_3182	tetraheme cytochrome c
Position: -144 Score: 4.3 Sequence: TTTTGTGATCTTCTTCTAAGAG Position: -67 Score: 4.1 Sequence: ATTTGTGAGCGATATTAACTTT Locus tag: Sputw3181_0498 Name: frdC1 Funciton: Fumarate reductase cytochrome b subunit Locus tag: Sputw3181_0499 Name: fdrC2 Funciton: Fumarate reductase cytochrome b subunit Locus tag: Sputw3181_0500 Name: frdA Funciton: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: Sputw3181_0501 Name: frdB Funciton: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
	Sputw3181_0498	frdC1	Fumarate reductase cytochrome b subunit
	Sputw3181_0499	fdrC2	Fumarate reductase cytochrome b subunit
	Sputw3181_0500	frdA	Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
	Sputw3181_0501	frdB	Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
Position: -77 Score: 5.1 Sequence: TTTTGTGATTTAGATCTCGTTT Locus tag: Sputw3181_1272 Name: yfiA-2 Funciton: Ribosome hibernation protein YfiA
	Sputw3181_1272	yfiA-2	Ribosome hibernation protein YfiA
Position: -154 Score: 4 Sequence: AACTGAGATCGGGATCACATGA Locus tag: Sputw3181_2618 Name: SO1787 Funciton: probable membrane protein YPO2362
	Sputw3181_2618	SO1787	probable membrane protein YPO2362
Position: -111 Score: 4.4 Sequence: AAATGTGACGCAGGTTAAAAAT Locus tag: Sputw3181_2976 Name: Sputcn32_1188 Funciton: iron-sulfur cluster-binding protein Locus tag: Sputw3181_2975 Name: Sputcn32_1189 Funciton: hypothetical protein
	Sputw3181_2976	Sputcn32_1188	iron-sulfur cluster-binding protein
	Sputw3181_2975	Sputcn32_1189	hypothetical protein
Position: -201 Score: 4.5 Sequence: ATTTGCAATATTCATCACATTT Locus tag: Sputw3181_2721 Name: mtrF Funciton: decaheme cytochrome c MtrF
	Sputw3181_2721	mtrF	decaheme cytochrome c MtrF
Position: -119 Score: 3.8 Sequence: TAGCTTGATCAAAAACACAGTT Locus tag: Sputw3181_3164 Name: purT Funciton: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-)
	Sputw3181_3164	purT	phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-)
Position: -144 Score: 4.6 Sequence: CAATGTGATATAAGTCACTTAA Locus tag: Sputw3181_2270 Name: hemB-1 Funciton: porphobilinogen synthase (EC 4.2.1.24)
	Sputw3181_2270	hemB-1	porphobilinogen synthase (EC 4.2.1.24)
Position: -94 Score: 4.3 Sequence: TTACATGATACGCTTCACAATG Locus tag: Sputw3181_3633 Name: kefA Funciton: mechanosensitive ion channel
	Sputw3181_3633	kefA	mechanosensitive ion channel
Position: -144 Score: 4.4 Sequence: TAATGTGCGACACAGCACATAA Locus tag: Sputw3181_3478 Name: SO0737 Funciton: outer membrane receptor proteins, mostly Fe transport
	Sputw3181_3478	SO0737	outer membrane receptor proteins, mostly Fe transport
Position: -174 Score: 3.5 Sequence: TTAGTTGACTAATATCACTAAA Locus tag: Sputw3181_3522 Name: crp Funciton: Cyclic AMP receptor protein Crp
	Sputw3181_3522	crp	Cyclic AMP receptor protein Crp
Position: -171 Score: 4.5 Sequence: AATAGTGATAAAGATCGCGTTT Locus tag: Sputw3181_1519 Name: null Funciton: hypothetical protein
	Sputw3181_1519		hypothetical protein
Position: -90 Score: 4.6 Sequence: TAATTTGACCTAGATCAAAGTT Locus tag: Sputw3181_3624 Name: null Funciton: hypothetical protein
	Sputw3181_3624		hypothetical protein
Position: -131 Score: 3.8 Sequence: TATGGTGAAATCGGTCAAATAC Position: -82 Score: 4.2 Sequence: AAACGCGAGCTAACTCGCATTT Locus tag: Sputw3181_2531 Name: cdd Funciton: cytidine deaminase (EC 3.5.4.5)
	Sputw3181_2531	cdd	cytidine deaminase (EC 3.5.4.5)
Position: -213 Score: 4.6 Sequence: TTATGTGAAGCAGATCGCCATT Locus tag: Sputw3181_3220 Name: Spea_3089 Funciton: hypothetical protein
	Sputw3181_3220	Spea_3089	hypothetical protein
Position: -156 Score: 4.5 Sequence: ATTTGTGATGTGAATCATTGTT Locus tag: Sputw3181_2337 Name: ydhD Funciton: Probable monothiol glutaredoxin ydhD
	Sputw3181_2337	ydhD	Probable monothiol glutaredoxin ydhD
Position: -131 Score: 4 Sequence: AAGTTTGAAGTAGATCATCAAA Position: -35 Score: 4.1 Sequence: AATTGCGATAGATCACGCATTT Locus tag: Sputw3181_3865 Name: SO4503 Funciton: formate dehydrogenase chain D (EC 1.2.1.2) Locus tag: Sputw3181_3864 Name: SO4502 Funciton: conserved domain protein
	Sputw3181_3865	SO4503	formate dehydrogenase chain D (EC 1.2.1.2)
	Sputw3181_3864	SO4502	conserved domain protein
Position: -190 Score: 3.5 Sequence: TAGAAAGATCCAAGTCACACAT Locus tag: Sputw3181_2623 Name: mtrC Funciton: surface localized decaheme cytochrome c lipoprotein, MtrC Locus tag: Sputw3181_2624 Name: mtrA Funciton: periplasmic decaheme cytochrome c, MtrA Locus tag: Sputw3181_2625 Name: mtrB Funciton: outer membrane protein, MtrB
	Sputw3181_2623	mtrC	surface localized decaheme cytochrome c lipoprotein, MtrC
	Sputw3181_2624	mtrA	periplasmic decaheme cytochrome c, MtrA
	Sputw3181_2625	mtrB	outer membrane protein, MtrB
Position: -145 Score: 4.9 Sequence: TTCTTTGATGTAACTCACATTT Locus tag: Sputw3181_1287 Name: yfiA-1 Funciton: ribosomal subunit interface protein
	Sputw3181_1287	yfiA-1	ribosomal subunit interface protein
Position: -201 Score: 4.5 Sequence: ATTTGCAATATTCATCACATTT Locus tag: Sputw3181_2721 Name: mtrF Funciton: decaheme cytochrome c MtrF
	Sputw3181_2721	mtrF	decaheme cytochrome c MtrF
Position: -261 Score: 4.7 Sequence: CTAAGTGATCGAGATCACAGAT Position: -179 Score: 4 Sequence: CAAGATGATCTAGATCATATTA Locus tag: Sputw3181_2834 Name: lldP Funciton: L-lactate permease Locus tag: Sputw3181_2835 Name: dldD Funciton: D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing
	Sputw3181_2834	lldP	L-lactate permease
	Sputw3181_2835	dldD	D-lactate dehydrogenase, Fe-S protein, FAD/FMN-containing
Position: -388 Score: 4.4 Sequence: TACTGTGATCTTGCTAACCCAA Position: -253 Score: 3.5 Sequence: AAATGGATTTAAATTCACATAA Locus tag: Sputw3181_3294 Name: SO0939 Funciton: split-soret diheme cytochrome c Locus tag: Sputw3181_3295 Name: null Funciton: hypothetical protein
	Sputw3181_3294	SO0939	split-soret diheme cytochrome c
	Sputw3181_3295		hypothetical protein
Position: -66 Score: 3.8 Sequence: TGCCGTGATTTATCTCCCAGTT Locus tag: Sputw3181_1735 Name: sdhC Funciton: Succinate dehydrogenase cytochrome b-556 subunit Locus tag: Sputw3181_1736 Name: SO1927.1 Funciton: Succinate dehydrogenase hydrophobic membrane anchor protein Locus tag: Sputw3181_1737 Name: sdhA Funciton: succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: Sputw3181_1738 Name: sdhB Funciton: succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) Locus tag: Sputw3181_1739 Name: sucA Funciton: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) Locus tag: Sputw3181_1740 Name: sucB Funciton: dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) Locus tag: Sputw3181_1741 Name: sucC Funciton: succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) Locus tag: Sputw3181_1742 Name: sucD Funciton: succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
	Sputw3181_1735	sdhC	Succinate dehydrogenase cytochrome b-556 subunit
	Sputw3181_1736	SO1927.1	Succinate dehydrogenase hydrophobic membrane anchor protein
	Sputw3181_1737	sdhA	succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
	Sputw3181_1738	sdhB	succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
	Sputw3181_1739	sucA	2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2)
	Sputw3181_1740	sucB	dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61)
	Sputw3181_1741	sucC	succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5)
	Sputw3181_1742	sucD	succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
Position: -225 Score: 4.2 Sequence: ATTTAAGACCAATATCACATTT Locus tag: Sputw3181_2424 Name: SO2757 Funciton: Histidine permease YuiF
	Sputw3181_2424	SO2757	Histidine permease YuiF
Position: -116 Score: 4.4 Sequence: TAATGTGATTGGTATAATATAC Locus tag: Sputw3181_3351 Name: SO3811 Funciton: lipoprotein, putative Locus tag: Sputw3181_3352 Name: ppiA Funciton: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8) Locus tag: Sputw3181_3353 Name: SO3813 Funciton: hypothetical protein Locus tag: Sputw3181_3354 Name: ampG Funciton: AmpG permease
	Sputw3181_3351	SO3811	lipoprotein, putative
	Sputw3181_3352	ppiA	peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
	Sputw3181_3353	SO3813	hypothetical protein
	Sputw3181_3354	ampG	AmpG permease
Position: -306 Score: 4.1 Sequence: AAGTGTGCCATCGATTACAATT Locus tag: Sputw3181_3916 Name: cymA Funciton: membrane anchored tetraheme cytochrome c, CymA
	Sputw3181_3916	cymA	membrane anchored tetraheme cytochrome c, CymA
Position: -159 Score: 4.2 Sequence: AAGTGTGGTTTGTATCACTATT Locus tag: Sputw3181_0683 Name: SO4018 Funciton: hypothetical protein
	Sputw3181_0683	SO4018	hypothetical protein
Position: -315 Score: 4.5 Sequence: AATTGTGACTTACCCCTCATTA Locus tag: Sputw3181_1285 Name: SO3406 Funciton: FIG024006: iron uptake protein Locus tag: Sputw3181_1284 Name: SO3407 Funciton: FIG138928: iron-regulated membrane protein Locus tag: Sputw3181_1283 Name: SO3408 Funciton: FIG016502: iron uptake protein
	Sputw3181_1285	SO3406	FIG024006: iron uptake protein
	Sputw3181_1284	SO3407	FIG138928: iron-regulated membrane protein
	Sputw3181_1283	SO3408	FIG016502: iron uptake protein
Position: -302 Score: 4.2 Sequence: CTTTGTGATACACTGCACAGAG Locus tag: Sputw3181_0014 Name: pepQ Funciton: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9) Locus tag: Sputw3181_0015 Name: SO0023 Funciton: FIG000605: protein co-occurring with transport systems (COG1739) Locus tag: Sputw3181_0016 Name: trkH-1 Funciton: potassium uptake protein TrkH Locus tag: Sputw3181_0017 Name: hemG Funciton: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
	Sputw3181_0014	pepQ	Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
	Sputw3181_0015	SO0023	FIG000605: protein co-occurring with transport systems (COG1739)
	Sputw3181_0016	trkH-1	potassium uptake protein TrkH
	Sputw3181_0017	hemG	protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
Position: -91 Score: 4.3 Sequence: AACAATGATTCACATCACAAAT Locus tag: Sputw3181_2338 Name: sodB Funciton: superoxide dismutase [Fe] (EC 1.15.1.1)
	Sputw3181_2338	sodB	superoxide dismutase [Fe] (EC 1.15.1.1)
Position: -46 Score: 4 Sequence: AAACTAGATCCATGTCACACAT Locus tag: Sputw3181_0722 Name: mdh Funciton: malate dehydrogenase (EC 1.1.1.37)
	Sputw3181_0722	mdh	malate dehydrogenase (EC 1.1.1.37)
Position: -89 Score: 4.7 Sequence: AATATTGATCTAAGTCACAATT Locus tag: Sputw3181_3630 Name: SO4134 Funciton: Protein of unknown function DUF465
	Sputw3181_3630	SO4134	Protein of unknown function DUF465
Position: -72 Score: 4.6 Sequence: AATTGTGATCGCCATCAATAAA Locus tag: Sputw3181_2234 Name: fadE2 Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
	Sputw3181_2234	fadE2	Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Position: -75 Score: 5.3 Sequence: AAATGTGATCTATCTTACATTT Locus tag: Sputw3181_1028 Name: lipB Funciton: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase Locus tag: Sputw3181_1027 Name: lipA Funciton: Lipoate synthase
	Sputw3181_1028	lipB	Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase
	Sputw3181_1027	lipA	Lipoate synthase
Position: -97 Score: 4.6 Sequence: AAGTGTGATCTGATTCTAACTT Locus tag: Sputw3181_1547 Name: SO3090 Funciton: MoxR-like ATPase in aerotolerance operon Locus tag: Sputw3181_1546 Name: SO3091 Funciton: Conserved hypothetical protein Locus tag: Sputw3181_1545 Name: null Funciton: hypothetical protein Locus tag: Sputw3181_1544 Name: SO3093 Funciton: von Willebrand factor type A domain protein Locus tag: Sputw3181_1543 Name: SO3094 Funciton: TPR domain protein in aerotolerance operon Locus tag: Sputw3181_1542 Name: SO3095 Funciton: hypothetical protein
	Sputw3181_1547	SO3090	MoxR-like ATPase in aerotolerance operon
	Sputw3181_1546	SO3091	Conserved hypothetical protein
	Sputw3181_1545		hypothetical protein
	Sputw3181_1544	SO3093	von Willebrand factor type A domain protein
	Sputw3181_1543	SO3094	TPR domain protein in aerotolerance operon
	Sputw3181_1542	SO3095	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Crp in Shewanella sp W3-18-1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --