Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Shewmr4_2117 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella sp MR-7
Position: -56
Score: 4.31241
Sequence: AACTGTGATTAATCTCACTCTA
Locus tag: Shewmr7_0939
Name: SO1064
Funciton: FOG: WD40 repeat
Locus tag: Shewmr7_0938
Name: slyX
Funciton: protein SlyX
Locus tag: Shewmr7_0937
Name: def-2
Funciton: peptide deformylase (EC 3.5.1.88)
Locus tag: Shewmr7_0936
Name: SO1061
Funciton: TPR domain protein
Locus tag: Shewmr7_0935
Name: spaP
Funciton: Putative lipoprotein
Locus tag: Shewmr7_0934
Name: null
Funciton: hypothetical protein
Locus tag: Shewmr7_0933
Name: Shewmr4_2117
Funciton: transposase
Locus tag: Shewmr7_0932
Name: SO1059
Funciton: membrane alanine aminopeptidase N (EC 3.4.11.2)
SO1064-slyX-def-2-SO1061-spaP-Shewmr7_0934-Shewmr4_2117-SO1059 -56 4.3 AACTGTGATTAATCTCACTCTA Shewmr7_0939
© 2009-2020 RegPrecise