Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing swp_3409 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella piezotolerans WP3
Position: -177
Score: 4.05538
Sequence: TGATGTGATAAAAAGCACTCAT
Locus tag: swp_3409
Name: null
Funciton: hypothetical protein swp_3409
Locus tag: swp_3408
Name: yfiA-1
Funciton: ribosomal subunit interface protein
swp_3409-yfiA-1 -177 4.1 TGATGTGATAAAAAGCACTCAT swp_3409
© 2009-2020 RegPrecise