Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SO3091 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -137
Score: 4.23195
Sequence: AAGTGTGACCCGATTCTAACTT
Locus tag: Sama_2169
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Sama_2170
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Sama_2171
Name: null
Funciton: hypothetical protein
Locus tag: Sama_2172
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Sama_2173
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Sama_2174
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Sama_2171-SO3093-SO3094-SO3095 -137 4.2 AAGTGTGACCCGATTCTAACTT Sama_2169
Shewanella baltica OS155
Position: -148
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: Sbal_2762
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Sbal_2763
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Sbal_2764
Name: null
Funciton: hypothetical protein
Locus tag: Sbal_2765
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Sbal_2766
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Sbal_2767
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Sbal_2764-SO3093-SO3094-SO3095 -148 4.6 AAGTGTGATCTGATTCTAACTT Sbal_2762
Shewanella denitrificans OS217
Position: -157
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: Sden_1528
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Sden_1527
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Sden_1526
Name: null
Funciton: hypothetical protein
Locus tag: Sden_1525
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Sden_1524
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Sden_1523
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Sden_1526-SO3093-SO3094-SO3095 -157 4.6 AAGTGTGATCTGATTCTAACTT Sden_1528
Shewanella frigidimarina NCIMB 400
Position: -167
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: Sfri_2678
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Sfri_2679
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Sfri_2680
Name: null
Funciton: hypothetical protein
Locus tag: Sfri_2681
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Sfri_2682
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Sfri_2683
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Sfri_2680-SO3093-SO3094-SO3095 -167 4.6 AAGTGTGATCTGATTCTAACTT Sfri_2678
Shewanella halifaxensis HAW-EB4
Position: -319
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: Shal_2672
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Shal_2673
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Shal_2674
Name: null
Funciton: hypothetical protein
Locus tag: Shal_2675
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Shal_2676
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Shal_2677
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Shal_2674-SO3093-SO3094-SO3095 -319 4.6 AAGTGTGATCTGATTCTAACTT Shal_2672
Shewanella loihica PV-4
Position: -296
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: Shew_2427
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Shew_2428
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Shew_2429
Name: null
Funciton: hypothetical protein
Locus tag: Shew_2430
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Shew_2431
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Shew_2432
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Shew_2429-SO3093-SO3094-SO3095 -296 4.6 AAGTGTGATCTGATTCTAACTT Shew_2427
Shewanella oneidensis MR-1
Position: -165
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: SO3090
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: SO3091
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: SO3092
Name: null
Funciton: hypothetical protein
Locus tag: SO3093
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: SO3094
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: SO3095
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-SO3092-SO3093-SO3094-SO3095 -165 4.6 AAGTGTGATCTGATTCTAACTT SO3090
Shewanella pealeana ATCC 700345
Position: -306
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: Spea_2600
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Spea_2601
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Spea_2602
Name: null
Funciton: hypothetical protein
Locus tag: Spea_2603
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Spea_2604
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Spea_2605
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Spea_2602-SO3093-SO3094-SO3095 -306 4.6 AAGTGTGATCTGATTCTAACTT Spea_2600
Shewanella piezotolerans WP3
Position: -97
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: swp_3141
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: swp_3143
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: swp_3144
Name: null
Funciton: hypothetical protein
Locus tag: swp_3145
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: swp_3146
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: swp_3148
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-swp_3144-SO3093-SO3094-SO3095 -97 4.6 AAGTGTGATCTGATTCTAACTT swp_3141
Shewanella putrefaciens CN-32
Position: -97
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: Sputcn32_2461
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Sputcn32_2462
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Sputcn32_2463
Name: null
Funciton: hypothetical protein
Locus tag: Sputcn32_2464
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Sputcn32_2465
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Sputcn32_2466
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Sputcn32_2463-SO3093-SO3094-SO3095 -97 4.6 AAGTGTGATCTGATTCTAACTT Sputcn32_2461
Shewanella sediminis HAW-EB3
Position: -316
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: Ssed_1627
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Ssed_1626
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Ssed_1625
Name: null
Funciton: hypothetical protein
Locus tag: Ssed_1624
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Ssed_1623
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Ssed_1622
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Ssed_1625-SO3093-SO3094-SO3095 -316 4.6 AAGTGTGATCTGATTCTAACTT Ssed_1627
Shewanella sp ANA-3
Position: -160
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: Shewana3_1459
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Shewana3_1458
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Shewana3_1457
Name: null
Funciton: hypothetical protein
Locus tag: Shewana3_1456
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Shewana3_1455
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Shewana3_1454
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Shewana3_1457-SO3093-SO3094-SO3095 -160 4.6 AAGTGTGATCTGATTCTAACTT Shewana3_1459
Shewanella sp MR-4
Position: -160
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: Shewmr4_1406
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Shewmr4_1405
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Shewmr4_1404
Name: null
Funciton: hypothetical protein
Locus tag: Shewmr4_1403
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Shewmr4_1402
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Shewmr4_1401
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Shewmr4_1404-SO3093-SO3094-SO3095 -160 4.6 AAGTGTGATCTGATTCTAACTT Shewmr4_1406
Shewanella sp MR-7
Position: -160
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: Shewmr7_1471
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Shewmr7_1470
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Shewmr7_1469
Name: null
Funciton: hypothetical protein
Locus tag: Shewmr7_1468
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Shewmr7_1467
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Shewmr7_1466
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Shewmr7_1469-SO3093-SO3094-SO3095 -160 4.6 AAGTGTGATCTGATTCTAACTT Shewmr7_1471
Shewanella sp W3-18-1
Position: -97
Score: 4.57773
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: Sputw3181_1547
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Sputw3181_1546
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Sputw3181_1545
Name: null
Funciton: hypothetical protein
Locus tag: Sputw3181_1544
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Sputw3181_1543
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Sputw3181_1542
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Sputw3181_1545-SO3093-SO3094-SO3095 -97 4.6 AAGTGTGATCTGATTCTAACTT Sputw3181_1547
Shewanella woodyi ATCC 51908
Position: -306
Score: 4.78219
Sequence: AAATGTGATCTGATTCTAACTT
Locus tag: Swoo_3028
Name: SO3090
Funciton: MoxR-like ATPase in aerotolerance operon
Locus tag: Swoo_3029
Name: SO3091
Funciton: Conserved hypothetical protein
Locus tag: Swoo_3030
Name: null
Funciton: hypothetical protein
Locus tag: Swoo_3031
Name: SO3093
Funciton: von Willebrand factor type A domain protein
Locus tag: Swoo_3032
Name: SO3094
Funciton: TPR domain protein in aerotolerance operon
Locus tag: Swoo_3033
Name: SO3095
Funciton: hypothetical protein
SO3090-SO3091-Swoo_3030-SO3093-SO3094-SO3095 -306 4.8 AAATGTGATCTGATTCTAACTT Swoo_3028