Orthologous regulated operons containing cyaB gene

Properties
Regulog:	Crp - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria

Built upon 2713 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella baltica OS155
Position: -170 Score: 4.32667 Sequence: TTTTGTGAGTCTGCTAGCAAAA Locus tag: Sbal_3463 Name: cydD Funciton: Transport ATP-binding protein CydD Locus tag: Sbal_3462 Name: cydC Funciton: Transport ATP-binding protein CydC Locus tag: Sbal_3461 Name: cyaB Funciton: adenylate cyclase CyaB, putative
cydD-cydC-cyaB	-170	4.3	TTTTGTGAGTCTGCTAGCAAAA	Sbal_3463
Shewanella oneidensis MR-1
Position: -191 Score: 4.36443 Sequence: TTTATTGATCAGCATCGCATTT Locus tag: SO3780 Name: cydD Funciton: Transport ATP-binding protein CydD Locus tag: SO3779 Name: cydC Funciton: Transport ATP-binding protein CydC Locus tag: SO3778 Name: cyaB Funciton: adenylate cyclase CyaB, putative
cydD-cydC-cyaB	-191	4.4	TTTATTGATCAGCATCGCATTT	SO3780
Shewanella putrefaciens CN-32
Position: -169 Score: 4.74203 Sequence: TTTTGTGAATCGGTTAACAAAA Locus tag: Sputcn32_3106 Name: cydD Funciton: Transport ATP-binding protein CydD Locus tag: Sputcn32_3105 Name: cydC Funciton: Transport ATP-binding protein CydC Locus tag: Sputcn32_3104 Name: cyaB Funciton: adenylate cyclase CyaB, putative
cydD-cydC-cyaB	-169	4.7	TTTTGTGAATCGGTTAACAAAA	Sputcn32_3106
Shewanella sp ANA-3
Position: -187 Score: 4.44609 Sequence: TTTATTGATCTTTATCTCATTT Position: -167 Score: 4.54454 Sequence: TTTTGTGAATAGGCTAACAAAA Locus tag: Shewana3_0812 Name: cydD Funciton: Transport ATP-binding protein CydD Locus tag: Shewana3_0813 Name: cydC Funciton: Transport ATP-binding protein CydC Locus tag: Shewana3_0814 Name: cyaB Funciton: adenylate cyclase CyaB, putative
cydD-cydC-cyaB	-187	4.4	TTTATTGATCTTTATCTCATTT	Shewana3_0812
	-167	4.5	TTTTGTGAATAGGCTAACAAAA
Shewanella sp MR-4
Position: -187 Score: 4.44609 Sequence: TTTATTGATCTTTATCTCATTT Position: -167 Score: 4.54454 Sequence: TTTTGTGAATAGGCTAACAAAA Locus tag: Shewmr4_3127 Name: cydD Funciton: Transport ATP-binding protein CydD Locus tag: Shewmr4_3126 Name: cydC Funciton: Transport ATP-binding protein CydC Locus tag: Shewmr4_3125 Name: cyaB Funciton: adenylate cyclase CyaB, putative
cydD-cydC-cyaB	-187	4.4	TTTATTGATCTTTATCTCATTT	Shewmr4_3127
	-167	4.5	TTTTGTGAATAGGCTAACAAAA
Shewanella sp MR-7
Position: -187 Score: 4.44609 Sequence: TTTATTGATCTTTATCTCATTT Position: -167 Score: 4.54454 Sequence: TTTTGTGAATAGGCTAACAAAA Locus tag: Shewmr7_0840 Name: cydD Funciton: Transport ATP-binding protein CydD Locus tag: Shewmr7_0841 Name: cydC Funciton: Transport ATP-binding protein CydC Locus tag: Shewmr7_0842 Name: cyaB Funciton: adenylate cyclase CyaB, putative
cydD-cydC-cyaB	-187	4.4	TTTATTGATCTTTATCTCATTT	Shewmr7_0840
	-167	4.5	TTTTGTGAATAGGCTAACAAAA
Shewanella sp W3-18-1
Position: -169 Score: 4.74203 Sequence: TTTTGTGAATCGGTTAACAAAA Locus tag: Sputw3181_0838 Name: cydD Funciton: Transport ATP-binding protein CydD Locus tag: Sputw3181_0839 Name: cydC Funciton: Transport ATP-binding protein CydC Locus tag: Sputw3181_0840 Name: cyaB Funciton: adenylate cyclase CyaB, putative
cydD-cydC-cyaB	-169	4.7	TTTTGTGAATCGGTTAACAAAA	Sputw3181_0838

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing cyaB gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --