Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sama_1065 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -82
Score: 4.12356
Sequence: AAATTTGCCAAAGCTCACACAT
Locus tag: Sama_1067
Name: SO3553
Funciton: putative sulfate permease
Locus tag: Sama_1066
Name: null
Funciton: hypothetical protein
Locus tag: Sama_1065
Name: null
Funciton: L-sorbosone dehydrogenase
Locus tag: Sama_1064
Name: purE
Funciton: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
Locus tag: Sama_1063
Name: purK
Funciton: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
Locus tag: Sama_1062
Name: SO3556
Funciton: cyclic nucleotide phosphodiesterase, putative
SO3553-Sama_1066-Sama_1065-purE-purK-SO3556 -82 4.1 AAATTTGCCAAAGCTCACACAT Sama_1067