Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SO0737 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella putrefaciens CN-32
Position: -144
Score: 4.38275
Sequence: TAATGTGCGACACAGCACATAA
Locus tag: Sputcn32_0692
Name: SO0737
Funciton: outer membrane receptor proteins, mostly Fe transport
SO0737 -144 4.4 TAATGTGCGACACAGCACATAA Sputcn32_0692
Shewanella sp W3-18-1
Position: -144
Score: 4.38275
Sequence: TAATGTGCGACACAGCACATAA
Locus tag: Sputw3181_3478
Name: SO0737
Funciton: outer membrane receptor proteins, mostly Fe transport
SO0737 -144 4.4 TAATGTGCGACACAGCACATAA Sputw3181_3478
© 2009-2020 RegPrecise