Regulog Fur - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - FUR
- By TF family - FUR
- By effector - Iron ion, (Fe2+)
- By pathway - Iron homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 58 | 32 |
| Shewanella putrefaciens CN-32 | 67 | 39 |
| Shewanella sp W3-18-1 | 62 | 37 |
| Shewanella sp ANA-3 | 65 | 36 |
| Shewanella sp MR-4 | 58 | 35 |
| Shewanella sp MR-7 | 58 | 35 |
| Shewanella baltica OS155 | 60 | 36 |
| Shewanella denitrificans OS217 | 58 | 22 |
| Shewanella frigidimarina NCIMB 400 | 39 | 24 |
| Shewanella amazonensis SB2B | 43 | 24 |
| Shewanella loihica PV-4 | 34 | 21 |
| Shewanella pealeana ATCC 700345 | 46 | 26 |
| Shewanella halifaxensis HAW-EB4 | 42 | 24 |
| Shewanella piezotolerans WP3 | 70 | 33 |
| Shewanella sediminis HAW-EB3 | 35 | 23 |
| Shewanella woodyi ATCC 51908 | 48 | 29 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| tonB |
*
Shewanella oneidensis MR-1 Site: position = -97 score = 5.72154 sequence = AAATAGAAATCATTATCATTT Gene: SO3670: TonB mediated energy transduction system, energy transducer component, TonB |
*
Shewanella putrefaciens CN-32 Site: position = -75 score = 6.0511 sequence = AAATGGTAATCATTATCATTT Gene: Sputcn32_0965: TonB mediated energy transduction system, energy transducer component, TonB |
*
Shewanella sp W3-18-1 Site: position = -75 score = 6.0511 sequence = AAATGGTAATCATTATCATTT Gene: Sputw3181_3202: TonB mediated energy transduction system, energy transducer component, TonB |
*
Shewanella sp ANA-3 Site: position = -98 score = 6.01763 sequence = AAATGGAAATCATTATCATTT Gene: Shewana3_3236: TonB mediated energy transduction system, energy transducer component, TonB |
|
|
*
Shewanella baltica OS155 Site: position = -63 score = 6.10539 sequence = AAATGCAAATCATTATCATTT Gene: Sbal_0951: TonB mediated energy transduction system, energy transducer component, TonB |
*
Shewanella denitrificans OS217 Site: position = -66 score = 6.468 sequence = AAATGAAAATCATTATCATTT Gene: Sden_0789: TonB mediated energy transduction system, energy transducer component, TonB |
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -206 score = 6.468 sequence = AAATGAAAATCATTATCATTT Gene: Spea_3328: TonB mediated energy transduction system, energy transducer component, TonB |
*
Shewanella halifaxensis HAW-EB4 Site: position = -207 score = 6.468 sequence = AAATGAAAATCATTATCATTT Gene: Shal_3400: TonB mediated energy transduction system, energy transducer component, TonB |
*
Shewanella piezotolerans WP3 Site: position = -183 score = 6.468 sequence = AAATGAAAATCATTATCATTT Gene: swp_3979: TonB mediated energy transduction system, energy transducer component, TonB |
|
*
Shewanella woodyi ATCC 51908 Site: position = -80 score = 6.468 sequence = AAATGAAAATCATTATCATTT Gene: Swoo_4005: TonB mediated energy transduction system, energy transducer component, TonB |
TonB mediated energy transduction system, energy transducer component, TonB |
| exbB |
Gene: SO3671: TonB mediated energy transduction system, inner membrane component, ExbB |
*
Shewanella putrefaciens CN-32 Site: position = -31 score = 5.18715 sequence = AAATGATAATTATCATGATTA Gene: Sputcn32_0964: TonB mediated energy transduction system, inner membrane component, ExbB |
*
Shewanella sp W3-18-1 Site: position = -31 score = 5.18715 sequence = AAATGATAATTATCATGATTA Gene: Sputw3181_3203: TonB mediated energy transduction system, inner membrane component, ExbB |
Gene: Shewana3_3237: TonB mediated energy transduction system, inner membrane component, ExbB |
|
|
Gene: Sbal_0950: TonB mediated energy transduction system, inner membrane component, ExbB |
Gene: Sden_0788: TonB mediated energy transduction system, inner membrane component, ExbB |
|
|
|
Gene: Spea_3329: TonB mediated energy transduction system, inner membrane component, ExbB |
Gene: Shal_3401: TonB mediated energy transduction system, inner membrane component, ExbB |
Gene: swp_3980: TonB mediated energy transduction system, inner membrane component, ExbB |
|
Gene: Swoo_4006: TonB mediated energy transduction system, inner membrane component, ExbB |
TonB mediated energy transduction system, inner membrane component, ExbB |
| exbD |
Gene: SO3672: TonB mediated energy transduction system, inner membrane component, ExbD |
Gene: Sputcn32_0963: TonB mediated energy transduction system, inner membrane component, ExbD |
2
Shewanella sp W3-18-1 Gene: Sputw3181_3213: TonB mediated energy transduction system, inner membrane component, ExbD Gene: Sputw3181_3204: TonB mediated energy transduction system, inner membrane component, ExbD |
Gene: Shewana3_3238: TonB mediated energy transduction system, inner membrane component, ExbD |
|
|
Gene: Sbal_0949: TonB mediated energy transduction system, inner membrane component, ExbD |
Gene: Sden_0787: TonB mediated energy transduction system, inner membrane component, ExbD |
|
|
|
Gene: Spea_3330: TonB mediated energy transduction system, inner membrane component, ExbD |
Gene: Shal_3402: TonB mediated energy transduction system, inner membrane component, ExbD |
Gene: swp_3981: TonB mediated energy transduction system, inner membrane component, ExbD |
|
Gene: Swoo_4007: TonB mediated energy transduction system, inner membrane component, ExbD |
TonB mediated energy transduction system, inner membrane component, ExbD |
| hmuB |
Gene: SO3673: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB |
Gene: Sputcn32_0962: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB |
Gene: Sputw3181_3214: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB |
Gene: Shewana3_3239: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB |
|
|
Gene: Sbal_0948: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB |
Gene: Sden_0786: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB |
|
|
|
Gene: Spea_3331: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB |
Gene: Shal_3403: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB |
Gene: swp_3982: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB |
|
Gene: Swoo_4008: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB |
ABC hemin transporter, periplasmic ligand-binding subunit, HmuB |
| hmuC |
Gene: SO3674: ABC hemin transporter, inner membrane subunit, HmuC |
Gene: Sputcn32_0961: ABC hemin transporter, inner membrane subunit, HmuC |
Gene: Sputw3181_3215: ABC hemin transporter, inner membrane subunit, HmuC |
Gene: Shewana3_3240: ABC hemin transporter, inner membrane subunit, HmuC |
|
|
Gene: Sbal_0947: ABC hemin transporter, inner membrane subunit, HmuC |
Gene: Sden_0785: ABC hemin transporter, inner membrane subunit, HmuC |
|
|
|
Gene: Spea_3332: ABC hemin transporter, inner membrane subunit, HmuC |
Gene: Shal_3404: ABC hemin transporter, inner membrane subunit, HmuC |
Gene: swp_3983: ABC hemin transporter, inner membrane subunit, HmuC |
|
Gene: Swoo_4009: ABC hemin transporter, inner membrane subunit, HmuC |
ABC hemin transporter, inner membrane subunit, HmuC |
| hmuD |
Gene: SO_3675: ABC hemin transporter, ATPase subunit, HmuD |
Gene: Sputcn32_0960: ABC hemin transporter, ATPase subunit, HmuD |
Gene: Sputw3181_3216: ABC hemin transporter, ATPase subunit, HmuD |
Gene: Shewana3_3241: ABC hemin transporter, ATPase subunit, HmuD |
|
|
Gene: Sbal_0946: ABC hemin transporter, ATPase subunit, HmuD |
Gene: Sden_0784: ABC hemin transporter, ATPase subunit, HmuD |
|
|
|
Gene: Spea_3333: ABC hemin transporter, ATPase subunit, HmuD |
Gene: Shal_3405: ABC hemin transporter, ATPase subunit, HmuD |
Gene: swp_3984: ABC hemin transporter, ATPase subunit, HmuD |
|
Gene: Swoo_4010: ABC hemin transporter, ATPase subunit, HmuD |
ABC hemin transporter, ATPase subunit, HmuD |
| CRON 2. | |||||||||||||||||
| Shewmr4_0531 |
|
|
|
|
*
Shewanella sp MR-4 Site: position = -145 score = 5.68847 sequence = AAATGATAATTATTTACATTA Gene: Shewmr4_0531: TonB-dependent siderophore receptor |
*
Shewanella sp MR-7 Site: position = -145 score = 5.68847 sequence = AAATGATAATTATTTACATTA Gene: Shewmr7_3500: TonB-dependent siderophore receptor |
|
|
|
|
|
|
|
|
|
|
TonB-dependent siderophore receptor |
| CRON 3. | |||||||||||||||||
| Shewmr4_0304 |
|
|
|
*
Shewanella sp ANA-3 Site: position = -194 score = 5.62142 sequence = AATTAATAACAATTCTCAATT Gene: Shewana3_0299: TonB-dependent siderophore receptor |
*
Shewanella sp MR-4 Site: position = -193 score = 5.05746 sequence = AATTAAGAACGATTCTCGATT Gene: Shewmr4_0304: TonB-dependent siderophore receptor |
*
Shewanella sp MR-7 Site: position = -192 score = 5.05746 sequence = AATTAAGAACGATTCTCGATT Gene: Shewmr7_3720: TonB-dependent siderophore receptor |
|
|
|
|
|
|
|
|
|
|
TonB-dependent siderophore receptor |
| CRON 4. | |||||||||||||||||
| Sputcn32_3636 |
|
*
Shewanella putrefaciens CN-32 Site: position = -77 score = 5.30052 sequence = TAATGTTAATCATTATCATTC Gene: Sputcn32_3636: TonB-dependent receptor |
*
Shewanella sp W3-18-1 Site: position = -77 score = 5.30052 sequence = TAATGTTAATCATTATCATTC Gene: Sputw3181_3776: TonB-dependent receptor |
|
|
|
|
|
|
|
|
|
|
|
|
|
TonB-dependent receptor |
| CRON 5. | |||||||||||||||||
| Sputcn32_3671 |
|
*
Shewanella putrefaciens CN-32 Site: position = -54 score = 5.65639 sequence = AATTGATAACTATTCTCATTG Gene: Sputcn32_3671: TonB-dependent receptor |
*
Shewanella sp W3-18-1 Site: position = -53 score = 5.65639 sequence = AATTGATAACTATTCTCATTG Gene: Sputw3181_3812: TonB-dependent receptor |
|
|
|
|
|
|
|
|
|
|
|
|
|
TonB-dependent receptor |
| Sputcn32_3670 |
|
Gene: Sputcn32_3670: Transcriptional regulator, TetR family |
Gene: Sputw3181_3811: Transcriptional regulator, TetR family |
|
|
|
|
|
|
|
|
|
|
|
|
|
Transcriptional regulator, TetR family |
| Sputcn32_3669 |
|
Gene: Sputcn32_3669: Ferric siderophore ABC transporter, permease protein |
Gene: Sputw3181_3810: Ferric siderophore ABC transporter, permease protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Ferric siderophore ABC transporter, permease protein |
| Sputcn32_3668 |
|
Gene: Sputcn32_3668: Ferric siderophore ABC transporter, permease protein |
Gene: Sputw3181_3809: Ferric siderophore ABC transporter, permease protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Ferric siderophore ABC transporter, permease protein |
| Sputcn32_3667 |
|
Gene: Sputcn32_3667: Ferric siderophore ABC transporter, ATP-binding protein |
Gene: Sputw3181_3808: Ferric siderophore ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Ferric siderophore ABC transporter, ATP-binding protein |
| Sputcn32_3666 |
|
Gene: Sputcn32_3666: Putative iron transport protein |
Gene: Sputw3181_3807: Putative iron transport protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Putative iron transport protein |
| CRON 6. | |||||||||||||||||
| Sputcn32_1590 |
|
*
Shewanella putrefaciens CN-32 Site: position = -101 score = 5.96727 sequence = AAATGAGAATTATTGTCATCT Gene: Sputcn32_1590: TonB-dependent siderophore receptor |
*
Shewanella sp W3-18-1 Site: position = -101 score = 5.96727 sequence = AAATGAGAATTATTGTCATCT Gene: Sputw3181_2432: TonB-dependent siderophore receptor |
*
Shewanella sp ANA-3 Site: position = -99 score = 5.96727 sequence = AAATGAGAATTATTGTCATCT Gene: Shewana3_2551: TonB-dependent siderophore receptor |
*
Shewanella sp MR-4 Site: position = -98 score = 6.20627 sequence = AAATGAGAATTATTGTCATTT Gene: Shewmr4_2386: TonB-dependent siderophore receptor |
*
Shewanella sp MR-7 Site: position = -98 score = 5.54419 sequence = AAATGAGAATTATTGTCACCT Gene: Shewmr7_2458: TonB-dependent siderophore receptor |
Gene: Sbal_1729: TonB-dependent siderophore receptor |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -75 score = 5.71032 sequence = AAATGAGAATAGTTTCCATTA Gene: Sfri_0391: TonB-dependent siderophore receptor |
|
|
|
|
|
|
|
TonB-dependent siderophore receptor |
| CRON 7. | |||||||||||||||||
| Sputcn32_1841 |
|
*
Shewanella putrefaciens CN-32 Site: position = -85 score = 5.16415 sequence = TAATACGAATTGTTATCAATA Site: position = -59 score = 5.73917 sequence = TATTGATAATTGTTTTCAATT Gene: Sputcn32_1841: TonB-dependent siderophore receptor |
*
Shewanella sp W3-18-1 Site: position = -85 score = 5.16415 sequence = TAATACGAATTGTTATCAATA Site: position = -59 score = 5.73917 sequence = TATTGATAATTGTTTTCAATT Gene: Sputw3181_2168: TonB-dependent siderophore receptor |
|
|
|
|
|
|
|
|
|
|
|
|
|
TonB-dependent siderophore receptor |
| CRON 8. | |||||||||||||||||
| Sputcn32_3863 |
|
*
Shewanella putrefaciens CN-32 Site: position = -21 score = 5.286 sequence = AAATGAAAACTATTCGTAATA Gene: Sputcn32_3863: TonB-dependent siderophore receptor |
*
Shewanella sp W3-18-1 Site: position = -21 score = 5.286 sequence = AAATGAAAACTATTCGTAATA Gene: Sputw3181_0090: TonB-dependent siderophore receptor |
*
Shewanella sp ANA-3 Site: position = -63 score = 5.24651 sequence = AAATGCAAATCGTTCTCAATG Gene: Shewana3_0952: TonB-dependent siderophore receptor |
*
Shewanella sp MR-4 Site: position = -57 score = 5.5683 sequence = AAATGCAAATCGTTCTCAATA Gene: Shewmr4_0950: TonB-dependent siderophore receptor |
*
Shewanella sp MR-7 Site: position = -57 score = 5.5683 sequence = AAATGCAAATCGTTCTCAATA Gene: Shewmr7_0988: TonB-dependent siderophore receptor |
*
Shewanella baltica OS155 Site: position = -63 score = 4.78537 sequence = AAATAAAAGTGATTCGCAATA Gene: Sbal_2136: TonB-dependent siderophore receptor |
|
|
|
|
|
|
|
|
|
TonB-dependent siderophore receptor |
| CRON 9. | |||||||||||||||||
| Sputcn32_1826 |
|
*
Shewanella putrefaciens CN-32 Site: position = -48 score = 5.10801 sequence = CATTAAGAATAATTATCATTC Gene: Sputcn32_1826: TonB-dependent receptor |
*
Shewanella sp W3-18-1 Site: position = -48 score = 5.10801 sequence = CATTAAGAATAATTATCATTC Gene: Sputw3181_2183: TonB-dependent receptor |
*
Shewanella sp ANA-3 Site: position = -47 score = 5.20657 sequence = ATTTAAGAATAATTATCATTC Gene: Shewana3_1861: TonB-dependent receptor |
*
Shewanella sp MR-4 Site: position = -47 score = 5.20657 sequence = ATTTAAGAATAATTATCATTC Gene: Shewmr4_1806: TonB-dependent receptor |
*
Shewanella sp MR-7 Site: position = -47 score = 5.20657 sequence = ATTTAAGAATAATTATCATTC Gene: Shewmr7_2171: TonB-dependent receptor |
*
Shewanella baltica OS155 Site: position = -47 score = 5.20657 sequence = ATTTAAGAATAATTATCATTC Gene: Sbal_2423: TonB-dependent receptor |
|
|
|
|
|
|
|
|
|
TonB-dependent receptor |
| CRON 10. | |||||||||||||||||
| IucABC |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -62 score = 5.89912 sequence = TAATGGGAATAATTATCATTT Gene: Swoo_0585: Aerobactin synthetase , IucABC |
Aerobactin synthetase , IucABC |
| IucD |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: Swoo_0586: lysine N6-hydroxylase, IucD |
lysine N6-hydroxylase, IucD |
| SO4423.1 |
*
Shewanella oneidensis MR-1 Site: position = -98 score = 5.41089 sequence = TAATAAAAATCGTTACCATTT Gene: SO4423.1: TonB-dependent ferric achromobactin receptor |
*
Shewanella putrefaciens CN-32 Site: position = -97 score = 5.61765 sequence = TAACGAAAATCGTTATCATTT Gene: Sputcn32_0401: TonB-dependent ferric achromobactin receptor |
*
Shewanella sp W3-18-1 Site: position = -97 score = 5.61765 sequence = TAACGAAAATCGTTATCATTT Gene: Sputw3181_0255: TonB-dependent ferric achromobactin receptor |
*
Shewanella sp ANA-3 Site: position = -98 score = 5.53949 sequence = CAATAAAAATCGTTATCATTT Gene: Shewana3_0286: TonB-dependent ferric achromobactin receptor |
*
Shewanella sp MR-4 Site: position = -98 score = 5.53949 sequence = CAATAAAAATCGTTATCATTT Gene: Shewmr4_0286: TonB-dependent ferric achromobactin receptor |
*
Shewanella sp MR-7 Site: position = -98 score = 5.53949 sequence = CAATAAAAATCGTTATCATTT Gene: Shewmr7_3733: TonB-dependent ferric achromobactin receptor |
*
Shewanella baltica OS155 Site: position = -100 score = 5.60897 sequence = GAATAAAAATCGTTATCATTT Gene: Sbal_0298: TonB-dependent ferric achromobactin receptor |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -54 score = 5.85542 sequence = TAATGATAATGAATATCATTA Gene: Sfri_0392: TonB-dependent ferric achromobactin receptor |
*
Shewanella amazonensis SB2B Site: position = -54 score = 5.01423 sequence = CATTGAGAGTAATTATCATTA Gene: Sama_1394: TonB-dependent ferric achromobactin receptor |
*
Shewanella loihica PV-4 Site: position = -72 score = 4.9028 sequence = ATATGATAATCTATATCATTC Gene: Shew_1688: TonB-dependent ferric achromobactin receptor |
*
Shewanella pealeana ATCC 700345 Site: position = -108 score = 5.30306 sequence = AAACACTAATCATTATCATTT Gene: Spea_0977: TonB-dependent ferric achromobactin receptor |
|
*
Shewanella piezotolerans WP3 Site: position = -108 score = 5.18857 sequence = CAACAATAATCATTATCATTT Gene: swp_1134: TonB-dependent ferric achromobactin receptor |
*
Shewanella sediminis HAW-EB3 Site: position = -51 score = 4.93337 sequence = AATCGAGAATGGTTATCATCC Gene: Ssed_1496: TonB-dependent ferric achromobactin receptor |
Gene: Swoo_0587: TonB-dependent ferric achromobactin receptor |
TonB-dependent ferric achromobactin receptor |
| CRON 11. | |||||||||||||||||
| Sden_3064 |
|
*
Shewanella putrefaciens CN-32 Site: position = -91 score = 5.12315 sequence = AAATAACAATAACTATCATTA Gene: Sputcn32_0603: TonB-dependent receptor |
*
Shewanella sp W3-18-1 Site: position = -91 score = 5.12315 sequence = AAATAACAATAACTATCATTA Gene: Sputw3181_3569: TonB-dependent receptor |
|
|
|
|
*
Shewanella denitrificans OS217 Site: position = -122 score = 6.20539 sequence = AAATAATAATGATTATCATTT Gene: Sden_3064: TonB-dependent receptor |
*2
Shewanella frigidimarina NCIMB 400 Site: position = -195 score = 5.00536 sequence = GATTGATAACGAATCTCAATA Site: position = -168 score = 5.46857 sequence = GAGTGATAATTATTATCAATT Site: position = -91 score = 5.61222 sequence = TAATGATAATCATTAGCAATA Gene: Sfri_2549: TonB-dependent receptor Site: position = -90 score = 5.72154 sequence = AAATGATAATGATTTCTATTT Gene: Sfri_3717: TonB-dependent receptor |
*
Shewanella amazonensis SB2B Site: position = -65 score = 6.03039 sequence = TAATGATAATTATTTTTATTT Gene: Sama_3412: TonB-dependent receptor |
*
Shewanella loihica PV-4 Site: position = -136 score = 5.88532 sequence = AAATGATAACCATTCCCATTT Gene: Shew_3097: TonB-dependent receptor |
|
|
|
|
|
TonB-dependent receptor |
| piuB |
|
|
|
|
|
|
|
Gene: Sden_3065: Uncharacterized iron-regulated membrane protein, PiuB |
|
Gene: Sama_3413: Uncharacterized iron-regulated membrane protein, PiuB |
*
Shewanella loihica PV-4 Site: position = -108 score = 5.57299 sequence = GAATGAAATTAATTCTCATTA Gene: Shew_1181: Uncharacterized iron-regulated membrane protein, PiuB |
|
|
|
|
|
Uncharacterized iron-regulated membrane protein, PiuB |
| CRON 12. | |||||||||||||||||
| COG3182 |
|
*
Shewanella putrefaciens CN-32 Site: position = -90 score = 5.73917 sequence = AATTGAAAACAATTATCAATA Site: position = -64 score = 5.16415 sequence = TATTGATAACAATTCGTATTA Gene: Sputcn32_1842: PepSY-associated TM helix domain-containing protein |
*
Shewanella sp W3-18-1 Site: position = -90 score = 5.73917 sequence = AATTGAAAACAATTATCAATA Site: position = -64 score = 5.16415 sequence = TATTGATAACAATTCGTATTA Gene: Sputw3181_2167: PepSY-associated TM helix domain-containing protein |
*
Shewanella sp ANA-3 Site: position = -66 score = 5.46024 sequence = TATTGATAACAATTCGCATTA Gene: Shewana3_2196: PepSY-associated TM helix domain-containing protein |
*
Shewanella sp MR-4 Site: position = -65 score = 5.46024 sequence = TATTGATAACAATTCGCATTA Gene: Shewmr4_2076: PepSY-associated TM helix domain-containing protein |
*
Shewanella sp MR-7 Site: position = -65 score = 5.46024 sequence = TATTGATAACAATTCGCATTA Gene: Shewmr7_1899: PepSY-associated TM helix domain-containing protein |
*
Shewanella baltica OS155 Site: position = -64 score = 5.43722 sequence = TATTGATAACAATTTGCATTA Gene: Sbal_2134: PepSY-associated TM helix domain-containing protein |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -184 score = 5.61222 sequence = TATTGCTAATGATTATCATTA Site: position = -107 score = 5.46857 sequence = AATTGATAATAATTATCACTC Site: position = -80 score = 5.00536 sequence = TATTGAGATTCGTTATCAATC Gene: Sfri_2548: PepSY-associated TM helix domain-containing protein |
|
|
|
|
|
|
|
PepSY-associated TM helix domain-containing protein |
| Sfri_2547 |
|
Gene: Sputcn32_1843: Conserved hypothetical protein |
Gene: Sputw3181_2166: Conserved hypothetical protein |
Gene: Shewana3_2195: Conserved hypothetical protein |
Gene: Shewmr4_2075: Conserved hypothetical protein |
Gene: Shewmr7_1900: Conserved hypothetical protein |
Gene: Sbal_2135: Conserved hypothetical protein |
|
Gene: Sfri_2547: Conserved hypothetical protein |
|
|
|
|
|
|
|
Conserved hypothetical protein |
| CRON 13. | |||||||||||||||||
| Sfri_0202 |
|
|
|
|
|
|
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -48 score = 5.95007 sequence = TAATGCAAATCATTATCATTT Gene: Sfri_0202: Conserved hypothetical protein |
|
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -124 score = 5.30114 sequence = AAATGATAATGATTGCTATTA Site: position = -44 score = 5.65398 sequence = AAATACAAATCGTTATCATTT Gene: swp_4138: Conserved hypothetical protein |
|
*
Shewanella woodyi ATCC 51908 Site: position = -25 score = 5.44456 sequence = AAATGATAATTATTTGTATAT Gene: Swoo_1505: Conserved hypothetical protein |
Conserved hypothetical protein |
| Sfri_0203 |
|
|
|
|
|
|
|
|
Gene: Sfri_0203: Hypothetical protein |
|
|
|
|
Gene: swp_4137: Hypothetical protein |
|
*
Shewanella woodyi ATCC 51908 Site: position = -350 score = 5.44456 sequence = AAATGATAATTATTTGTATAT Gene: Swoo_1506: Hypothetical protein |
Hypothetical protein |
| puiB |
|
|
|
|
|
|
|
|
Gene: Sfri_0204: Uncharacterized iron-regulated membrane protein, PiuB |
|
|
|
|
Gene: swp_4136: Uncharacterized iron-regulated membrane protein, PiuB |
|
Gene: Swoo_1507: Uncharacterized iron-regulated membrane protein, PiuB |
Uncharacterized iron-regulated membrane protein, PiuB |
| CRON 14. | |||||||||||||||||
| Sfri_0810 |
|
|
|
|
|
|
|
*
Shewanella denitrificans OS217 Site: position = -74 score = 5.80854 sequence = TAATGCAAATTGTTATCATTT Gene: Sden_0721: Hypothetical protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -78 score = 5.60177 sequence = TAATGCGAATCGTTATCAATT Gene: Sfri_0810: Hypothetical protein |
|
*
Shewanella loihica PV-4 Site: position = -77 score = 5.95341 sequence = TAATGCAAATTATTCTCATTT Gene: Shew_0675: Hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -100 score = 5.66422 sequence = TAATGTAAATCATTCTCATTT Gene: Spea_0670: Hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -100 score = 5.66422 sequence = TAATGTAAATCATTCTCATTT Gene: Shal_3528: Hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -86 score = 5.78429 sequence = TAATGCAAATCGTTCTCATTT Gene: swp_4049: Hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -76 score = 5.12559 sequence = TAATGCAAACGATTCGTATTT Gene: Ssed_3793: Hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -79 score = 5.78429 sequence = TAATGAAAACGATTCGCATTT Gene: Swoo_0790: Hypothetical protein |
Hypothetical protein |
| Sfri_0811 |
|
|
|
|
|
|
|
Gene: Sden_0722: Imelysin peptidase family lipoprotein |
Gene: Sfri_0811: Imelysin peptidase family lipoprotein |
|
Gene: Shew_0676: Imelysin peptidase family lipoprotein |
Gene: Spea_0671: Imelysin peptidase family lipoprotein |
Gene: Shal_3527: Imelysin peptidase family lipoprotein |
Gene: swp_4048: Imelysin peptidase family lipoprotein |
Gene: Ssed_3792: Imelysin peptidase family lipoprotein |
Gene: Swoo_0791: Imelysin peptidase family lipoprotein |
Imelysin peptidase family lipoprotein |
| Sfri_0812 |
|
|
|
|
|
|
|
Gene: Sden_0723: Protein of unknown function DUF1111 |
Gene: Sfri_0812: Protein of unknown function DUF1111 |
|
Gene: Shew_0677: Protein of unknown function DUF1111 |
Gene: Spea_0672: Protein of unknown function DUF1111 |
Gene: Shal_3526: Protein of unknown function DUF1111 |
Gene: swp_4047: Protein of unknown function DUF1111 |
Gene: Ssed_3791: Protein of unknown function DUF1111 |
Gene: Swoo_0792: Protein of unknown function DUF1111 |
Protein of unknown function DUF1111 |
| CRON 15. | |||||||||||||||||
| Sfri_4035 |
|
|
|
|
|
|
*
Shewanella baltica OS155 Site: position = -93 score = 5.43547 sequence = AAATGCGAATTGTTTGCATTA Gene: Sbal_2014: Conserved hypothetical signal peptide protein, possibly porin |
*
Shewanella denitrificans OS217 Site: position = -91 score = 5.13938 sequence = AAATACGAATAGTTTGCATTA Gene: Sden_0638: Conserved hypothetical signal peptide protein, possibly porin |
*
Shewanella frigidimarina NCIMB 400 Site: position = -106 score = 5.63942 sequence = TAATGATAATGGTTTGCATTA Gene: Sfri_4035: Conserved hypothetical signal peptide protein, possibly porin |
*
Shewanella amazonensis SB2B Site: position = -84 score = 5.09989 sequence = CAATGCGAATCGTTTGCATTT Gene: Sama_0589: Conserved hypothetical signal peptide protein, possibly porin |
*
Shewanella loihica PV-4 Site: position = -84 score = 5.65321 sequence = TAATGATAATAGTTTGCATTA Gene: Shew_3120: Conserved hypothetical signal peptide protein, possibly porin |
*
Shewanella pealeana ATCC 700345 Site: position = -82 score = 5.63942 sequence = TAATGATAACGATTTGCATTA Gene: Spea_0712: Conserved hypothetical signal peptide protein, possibly porin |
|
*
Shewanella piezotolerans WP3 Site: position = -81 score = 5.95341 sequence = AAATGAGAATAATTTGCATTA Gene: swp_4367: Conserved hypothetical signal peptide protein, possibly porin |
*
Shewanella sediminis HAW-EB3 Site: position = -83 score = 5.63942 sequence = AAATGATAACCGTTTGCATTA Gene: Ssed_3889: Conserved hypothetical signal peptide protein, possibly porin |
*
Shewanella woodyi ATCC 51908 Site: position = -83 score = 5.40091 sequence = GAATGATAACAATTTGCATTA Gene: Swoo_3788: Conserved hypothetical signal peptide protein, possibly porin |
Conserved hypothetical signal peptide protein, possibly porin |
| Sbal_2015 |
|
|
|
|
|
|
Gene: Sbal_2015: FMN-binding domain-containing protein |
Gene: Sden_0639: FMN-binding domain-containing protein |
Gene: Sfri_4034: FMN-binding domain-containing protein |
Gene: Sama_0588: FMN-binding domain-containing protein |
Gene: Shew_3121: FMN-binding domain-containing protein |
Gene: Spea_0711: FMN-binding domain-containing protein |
Gene: Shal_0765: FMN-binding domain-containing protein |
Gene: swp_4368: FMN-binding domain-containing protein |
Gene: Ssed_3890: FMN-binding domain-containing protein |
Gene: Swoo_3789: FMN-binding domain-containing protein |
FMN-binding domain-containing protein |
| COG3182 |
|
|
|
|
|
|
Gene: Sbal_2016: PepSY-associated TM helix domain-containing protein |
Gene: Sden_0640: PepSY-associated TM helix domain-containing protein |
Gene: Sfri_4033: PepSY-associated TM helix domain-containing protein |
Gene: Sama_0587: PepSY-associated TM helix domain-containing protein |
Gene: Shew_3122: PepSY-associated TM helix domain-containing protein |
2
Shewanella pealeana ATCC 700345 Gene: Spea_0709: PepSY-associated TM helix domain-containing protein Gene: Spea_0710: PepSY-associated TM helix domain-containing protein |
|
2
Shewanella piezotolerans WP3 Gene: swp_4378: PepSY-associated TM helix domain-containing protein Gene: swp_4369: PepSY-associated TM helix domain-containing protein |
Gene: Ssed_3891: PepSY-associated TM helix domain-containing protein |
Gene: Swoo_3790: PepSY-associated TM helix domain-containing protein |
PepSY-associated TM helix domain-containing protein |
| CRON 16. | |||||||||||||||||
| Sfri_2008 |
|
*
Shewanella putrefaciens CN-32 Site: position = -63 score = 5.90495 sequence = TGTTGATAATAATTATCATTT Gene: Sputcn32_1997: Hypothetical protein |
|
|
*
Shewanella sp MR-4 Site: position = -59 score = 5.73917 sequence = TGTTGATAACTATTCTCATTT Gene: Shewmr4_2003: Hypothetical protein |
*
Shewanella sp MR-7 Site: position = -59 score = 5.73917 sequence = TGTTGATAACTATTCTCATTT Gene: Shewmr7_1972: Hypothetical protein |
*2
Shewanella baltica OS155 Site: position = -63 score = 5.5943 sequence = TGTTGATAACAGTTATCATTT Site: position = -165 score = 4.72252 sequence = AAATAAAAATAATGATCACAT Gene: Sbal_2198: Hypothetical protein Site: position = -63 score = 5.5943 sequence = TGTTGATAACAGTTATCATTT Site: position = -165 score = 4.72252 sequence = AAATAAAAATAATGATCACAT Gene: Sbal_4484: Hypothetical protein |
*
Shewanella denitrificans OS217 Site: position = -36 score = 6.00614 sequence = AAATAAAAACCATTCTCATTT Gene: Sden_1854: Hypothetical protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -116 score = 5.97818 sequence = AATTGATAACTATTCTCATTA Gene: Sfri_2008: Hypothetical protein |
*
Shewanella amazonensis SB2B Site: position = -52 score = 5.97095 sequence = ATATGATAACTATTCTCATTT Gene: Sama_1788: Hypothetical protein |
|
*
Shewanella pealeana ATCC 700345 Site: position = -117 score = 6.13016 sequence = TATTGATAATCATTATCATTT Gene: Spea_2212: Hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -62 score = 5.8807 sequence = TGTTGATAATCATTCTCATTT Gene: Shal_2195: Hypothetical protein |
|
*
Shewanella sediminis HAW-EB3 Site: position = -64 score = 5.79792 sequence = CATTGATAATCATTCTCATTT Gene: Ssed_2208: Hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -62 score = 5.8807 sequence = AGTTGATAACCATTCTCATTT Gene: Swoo_2428: Hypothetical protein |
Hypothetical protein |
| CRON 17. | |||||||||||||||||
| Sputcn32_0603 |
|
*
Shewanella putrefaciens CN-32 Site: position = -91 score = 5.12315 sequence = AAATAACAATAACTATCATTA Gene: Sputcn32_0603: TonB-dependent siderophore receptor |
*
Shewanella sp W3-18-1 Site: position = -91 score = 5.12315 sequence = AAATAACAATAACTATCATTA Gene: Sputw3181_3569: TonB-dependent siderophore receptor |
|
|
|
|
*
Shewanella denitrificans OS217 Site: position = -122 score = 6.20539 sequence = AAATAATAATGATTATCATTT Gene: Sden_3064: TonB-dependent siderophore receptor |
*2
Shewanella frigidimarina NCIMB 400 Site: position = -91 score = 5.61222 sequence = TAATGATAATCATTAGCAATA Site: position = -195 score = 5.00536 sequence = GATTGATAACGAATCTCAATA Site: position = -168 score = 5.46857 sequence = GAGTGATAATTATTATCAATT Gene: Sfri_2549: TonB-dependent siderophore receptor Site: position = -90 score = 5.72154 sequence = AAATGATAATGATTTCTATTT Gene: Sfri_3717: TonB-dependent siderophore receptor |
*
Shewanella amazonensis SB2B Site: position = -65 score = 6.03039 sequence = TAATGATAATTATTTTTATTT Gene: Sama_3412: TonB-dependent siderophore receptor |
*
Shewanella loihica PV-4 Site: position = -136 score = 5.88532 sequence = AAATGATAACCATTCCCATTT Gene: Shew_3097: TonB-dependent siderophore receptor |
|
|
|
|
|
TonB-dependent siderophore receptor |
| piuB |
|
|
|
|
|
|
|
Gene: Sden_3065: Iron-uptake factor PiuB |
|
Gene: Sama_3413: Iron-uptake factor PiuB |
*
Shewanella loihica PV-4 Site: position = -108 score = 5.57299 sequence = GAATGAAATTAATTCTCATTA Gene: Shew_1181: Iron-uptake factor PiuB |
|
|
|
|
|
Iron-uptake factor PiuB |
| CRON 18. | |||||||||||||||||
| Sbal_0657 |
|
*
Shewanella putrefaciens CN-32 Site: position = -101 score = 5.82024 sequence = TAACGATAATTATTATCATTT Gene: Sputcn32_3181: Hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -101 score = 5.82024 sequence = TAACGATAATTATTATCATTT Gene: Sputw3181_0762: Hypothetical protein |
|
|
|
*
Shewanella baltica OS155 Site: position = -101 score = 5.82024 sequence = TAACGATAATTATTATCATTT Gene: Sbal_0657: Hypothetical protein |
Gene: Sden_0953: Hypothetical protein |
|
|
|
|
|
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -120 score = 5.80855 sequence = TATTGATAATAAATATCATTT Gene: Swoo_2460: Hypothetical protein |
Hypothetical protein |
| CRON 19. | |||||||||||||||||
| Sama_1866 |
|
|
|
|
|
|
|
|
|
*
Shewanella amazonensis SB2B Site: position = -40 score = 5.64353 sequence = TAATGCGAATCATTTTTATTT Gene: Sama_1866: Probable two-component system sensor kinase |
|
|
|
|
*
Shewanella sediminis HAW-EB3 Site: position = -38 score = 5.06688 sequence = TGGTGAGAACGATTATTATTA Gene: Ssed_2007: Probable two-component system sensor kinase |
*
Shewanella woodyi ATCC 51908 Site: position = -48 score = 5.61556 sequence = AATTGCGAACAATTATCATTA Gene: Swoo_2596: Probable two-component system sensor kinase |
Probable two-component system sensor kinase |
| CRON 20. | |||||||||||||||||
| Sama_0590 |
|
|
|
|
*
Shewanella sp MR-4 Site: position = -62 score = 4.96353 sequence = TAACGAGAATAATTCTTGTTT Gene: Shewmr4_0630: TonB-dependent receptor |
*
Shewanella sp MR-7 Site: position = -62 score = 4.96353 sequence = TAACGAGAATAATTCTTGTTT Gene: Shewmr7_3399: TonB-dependent receptor |
|
|
|
*
Shewanella amazonensis SB2B Site: position = -2 score = 5.90608 sequence = AAATGATAACTATTGTCATTA Gene: Sama_0590: TonB-dependent receptor |
|
*
Shewanella pealeana ATCC 700345 Site: position = -66 score = 5.54992 sequence = AAATGATAATCAATCCCATTA Gene: Spea_0713: TonB-dependent receptor |
*
Shewanella halifaxensis HAW-EB4 Site: position = -67 score = 5.63768 sequence = AAATGAGAATGAATAGCATTA Gene: Shal_0766: TonB-dependent receptor |
|
*
Shewanella sediminis HAW-EB3 Site: position = -84 score = 5.53821 sequence = AAATGATAACCACTCTCATTA Gene: Ssed_3888: TonB-dependent receptor |
*
Shewanella woodyi ATCC 51908 Site: position = -2 score = 5.54992 sequence = AAATGATAATCAATCCCATTA Gene: Swoo_3787: TonB-dependent receptor |
TonB-dependent receptor |
| CRON 21. | |||||||||||||||||
| mtrH |
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella halifaxensis HAW-EB4 Site: position = -65 score = 5.29842 sequence = AGGTGAGAATAATTCTCATAA Gene: Shal_2783: Surface localized decaheme cytochrome c lipoprotein, MtrH |
*
Shewanella piezotolerans WP3 Site: position = -67 score = 5.00148 sequence = AAATGAGATTTGTTCTCAAAC Gene: swp_3277: Surface localized decaheme cytochrome c lipoprotein, MtrH |
|
|
Surface localized decaheme cytochrome c lipoprotein, MtrH |
| CRON 22. | |||||||||||||||||
| adhC |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -80 score = 5.47984 sequence = AAATGAAATCAATTATAATTT Gene: Spea_3021: S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -78 score = 4.79046 sequence = AAATGGAATTAGTTATAATCT Gene: Shal_3111: S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284) |
*
Shewanella piezotolerans WP3 Site: position = -111 score = 4.55146 sequence = ATATTAGAGGGATTATCATTT Gene: swp_2093: S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284) |
|
Gene: Swoo_0375: S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284) |
S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284) |
| CRON 23. | |||||||||||||||||
| Sama_2875 |
|
|
|
|
|
|
|
|
|
*
Shewanella amazonensis SB2B Site: position = -68 score = 5.66805 sequence = AATTGAGAATTATTCTCAACA Gene: Sama_2875: TonB-dependent siderophore receptor |
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -94 score = 5.55909 sequence = TGTTGAGATTAATTATCATTT Gene: swp_0926: TonB-dependent siderophore receptor |
|
*
Shewanella woodyi ATCC 51908 Site: position = -81 score = 5.91417 sequence = AATTGATAATCGTTATCAATT Gene: Swoo_0946: TonB-dependent siderophore receptor |
TonB-dependent siderophore receptor |
| CRON 24. | |||||||||||||||||
| Sama_2655 |
|
|
|
*
Shewanella sp ANA-3 Site: position = -84 score = 4.93325 sequence = TAATGATAATGATTTGCGTTG Gene: Shewana3_0919: Conserved hypothetical protein |
*
Shewanella sp MR-4 Site: position = -84 score = 4.93325 sequence = TAATGATAATGATTTGCGTTG Gene: Shewmr4_0920: Conserved hypothetical protein |
*
Shewanella sp MR-7 Site: position = -84 score = 4.93325 sequence = TAATGATAATGATTTGCGTTG Gene: Shewmr7_0955: Conserved hypothetical protein |
*
Shewanella baltica OS155 Site: position = -83 score = 4.77793 sequence = TAATGATAACGATTTGCGTTG Gene: Sbal_0904: Conserved hypothetical protein |
|
|
*
Shewanella amazonensis SB2B Site: position = -84 score = 5.41954 sequence = TAATGCGAACTATTTTCATAT Gene: Sama_2655: Conserved hypothetical protein |
|
|
|
|
|
|
Conserved hypothetical protein |
| Sama_2656 |
|
|
|
Gene: Shewana3_0920: FMN-binding domain protein |
Gene: Shewmr4_0921: FMN-binding domain protein |
Gene: Shewmr7_0956: FMN-binding domain protein |
Gene: Sbal_0905: FMN-binding domain protein |
|
|
Gene: Sama_2656: FMN-binding domain protein |
|
|
|
|
|
|
FMN-binding domain protein |
| Sama_2657 |
Gene: SO1090: ApbE family protein, putative |
|
|
Gene: Shewana3_0921: ApbE family protein, putative |
Gene: Shewmr4_0922: ApbE family protein, putative |
Gene: Shewmr7_0957: ApbE family protein, putative |
Gene: Sbal_0906: ApbE family protein, putative |
|
|
Gene: Sama_2657: ApbE family protein, putative |
|
|
|
|
|
|
ApbE family protein, putative |
| Sama_2658 |
|
|
|
Gene: Shewana3_0922: Hypothetical protein |
Gene: Shewmr4_0923: Hypothetical protein |
Gene: Shewmr7_0958: Hypothetical protein |
Gene: Sbal_0907: Hypothetical protein |
|
|
Gene: Sama_2658: Hypothetical protein |
|
|
|
|
|
|
Hypothetical protein |
| CRON 25. | |||||||||||||||||
| Sputcn32_2703 |
*
Shewanella oneidensis MR-1 Site: position = -59 score = 4.67455 sequence = TTATGATAATGAACATTATTT Gene: SO3371: Cytochrome B561 |
*
Shewanella putrefaciens CN-32 Site: position = -60 score = 4.64108 sequence = TTATGATAATGGATATTGTTT Gene: Sputcn32_2703: Cytochrome B561 |
*
Shewanella sp W3-18-1 Site: position = -60 score = 4.64108 sequence = TTATGATAATGGATATTGTTT Gene: Sputw3181_1308: Cytochrome B561 |
*
Shewanella sp ANA-3 Site: position = -59 score = 5.02936 sequence = TTATGATAATGACTATTATTT Gene: Shewana3_1178: Cytochrome B561 |
*
Shewanella sp MR-4 Site: position = -59 score = 5.02936 sequence = TTATGATAATGACTATTATTT Gene: Shewmr4_1177: Cytochrome B561 |
*
Shewanella sp MR-7 Site: position = -59 score = 5.02936 sequence = TTATGATAATGACTATTATTT Gene: Shewmr7_1248: Cytochrome B561 |
*
Shewanella baltica OS155 Site: position = -61 score = 5.33612 sequence = TTATGATAATGAATATTATTT Gene: Sbal_3042: Cytochrome B561 |
Gene: Sden_2129: Cytochrome B561 |
Gene: Sfri_2876: Cytochrome B561 |
*
Shewanella amazonensis SB2B Site: position = -38 score = 5.36819 sequence = AGATGAAAACCATTCTCGTTA Gene: Sama_0949: Cytochrome B561 |
Gene: Shew_1120: Cytochrome B561 |
|
|
Gene: swp_3690: Cytochrome B561 |
Gene: Ssed_1216: Cytochrome B561 |
Gene: Swoo_1316: Cytochrome B561 |
Cytochrome B561 |
| yceI |
Gene: SO3370: Protein yceI precursor |
Gene: Sputcn32_2702: Protein yceI precursor |
Gene: Sputw3181_1309: Protein yceI precursor |
Gene: Shewana3_1179: Protein yceI precursor |
Gene: Shewmr4_1178: Protein yceI precursor |
Gene: Shewmr7_1249: Protein yceI precursor |
Gene: Sbal_3041: Protein yceI precursor |
Gene: Sden_2128: Protein yceI precursor |
Gene: Sfri_2875: Protein yceI precursor |
Gene: Sama_0950: Protein yceI precursor |
Gene: Shew_1121: Protein yceI precursor |
|
|
Gene: swp_3689: Protein yceI precursor |
Gene: Ssed_1217: Protein yceI precursor |
Gene: Swoo_1317: Protein yceI precursor |
Protein yceI precursor |
| CRON 26. | |||||||||||||||||
| SO3914 |
*
Shewanella oneidensis MR-1 Site: position = -108 score = 5.05585 sequence = AAATGATAATAATTATTGATC Gene: SO3914: TonB-dependent siderophore receptor |
|
|
*
Shewanella sp ANA-3 Site: position = -107 score = 5.46348 sequence = AAATGATAATAATTATTGATT Gene: Shewana3_0716: TonB-dependent siderophore receptor |
*
Shewanella sp MR-4 Site: position = -106 score = 5.46348 sequence = AAATGATAATAATTATTGATT Gene: Shewmr4_3245: TonB-dependent siderophore receptor |
*
Shewanella sp MR-7 Site: position = -106 score = 4.80191 sequence = AAATGATAATAATAATTGATT Gene: Shewmr7_0697: TonB-dependent siderophore receptor |
*
Shewanella baltica OS155 Site: position = -108 score = 4.90053 sequence = AAATGATAATAGTTATTGATC Gene: Sbal_3635: TonB-dependent siderophore receptor |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -103 score = 5.8093 sequence = AAATGATAATGATTTGTATTT Gene: Sfri_0611: TonB-dependent siderophore receptor |
|
|
|
|
|
|
|
TonB-dependent siderophore receptor |
| piuC |
Gene: SO3913: Iron-uptake factor PiuC |
|
|
Gene: Shewana3_0717: Iron-uptake factor PiuC |
Gene: Shewmr4_3244: Iron-uptake factor PiuC |
Gene: Shewmr7_0698: Iron-uptake factor PiuC |
Gene: Sbal_3634: Iron-uptake factor PiuC |
|
Gene: Sfri_0612: Iron-uptake factor PiuC |
|
|
|
|
|
|
|
Iron-uptake factor PiuC |
| CRON 27. | |||||||||||||||||
| SO0719 |
*
Shewanella oneidensis MR-1 Site: position = -40 score = 4.93049 sequence = AGGTAGGAACAATTCTCATTT Gene: SO0719: TonB-dependent receptor |
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -43 score = 5.83651 sequence = AAAAGAGAATAATTCTCATTT Gene: Spea_2929: TonB-dependent receptor |
*
Shewanella halifaxensis HAW-EB4 Site: position = -42 score = 5.83651 sequence = AAAGGAGAATAATTCTCATTT Gene: Shal_3020: TonB-dependent receptor |
|
*
Shewanella sediminis HAW-EB3 Site: position = -42 score = 5.53631 sequence = TAAGGATAATAATTCTCATTA Gene: Ssed_3638: TonB-dependent receptor |
|
TonB-dependent receptor |
| CRON 28. | |||||||||||||||||
| SO4700 |
*
Shewanella oneidensis MR-1 Site: position = -86 score = 5.30027 sequence = AAATCAAATCCATTCTCATTA Gene: SO4700: Hypothetical outer membrane protein |
Gene: Sputcn32_0086: Hypothetical outer membrane protein |
Gene: Sputw3181_3979: Hypothetical outer membrane protein |
*
Shewanella sp ANA-3 Site: position = -86 score = 4.84989 sequence = AAATCGAATCCATTCTCATTA Gene: Shewana3_4052: Hypothetical outer membrane protein |
*
Shewanella sp MR-4 Site: position = -27 score = 5.30027 sequence = AAATCAAATCCATTCTCATTA Gene: Shewmr4_3843: Hypothetical outer membrane protein |
*
Shewanella sp MR-7 Site: position = -27 score = 5.30027 sequence = AAATCAAATCCATTCTCATTA Gene: Shewmr7_3936: Hypothetical outer membrane protein |
*
Shewanella baltica OS155 Site: position = -86 score = 4.50107 sequence = AAATCGAATCAATTCGCATTA Gene: Sbal_0123: Hypothetical outer membrane protein |
*
Shewanella denitrificans OS217 Site: position = -123 score = 4.70527 sequence = AAATAAGACTGGTTTGTATTT Gene: Sden_3594: Hypothetical outer membrane protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -80 score = 5.30915 sequence = AAACGAGACTGATTATCATTT Gene: Sfri_3875: Hypothetical outer membrane protein |
|
*
Shewanella loihica PV-4 Site: position = -83 score = 5.31125 sequence = AAATGCAACCAATTCTCATTT Gene: Shew_3658: Hypothetical outer membrane protein |
*
Shewanella pealeana ATCC 700345 Site: position = 7 score = 5.04863 sequence = AAATACGAGCTATTATCATTT Gene: Spea_4066: Hypothetical outer membrane protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -87 score = 4.37326 sequence = AAATACGTCCCATTATCATTT Gene: Shal_0192: Hypothetical outer membrane protein |
*
Shewanella piezotolerans WP3 Site: position = -86 score = 5.01181 sequence = AAATACAACCGATTATCATTT Gene: swp_4927: Hypothetical outer membrane protein |
*
Shewanella sediminis HAW-EB3 Site: position = -97 score = 5.49149 sequence = AAATGGGAAGTGTTATCATTT Gene: Ssed_0144: Hypothetical outer membrane protein |
*
Shewanella woodyi ATCC 51908 Site: position = -85 score = 5.24635 sequence = AAATACAAAGCGTTATCATTT Gene: Swoo_0123: Hypothetical outer membrane protein |
Hypothetical outer membrane protein |
| CRON 29. | |||||||||||||||||
| SO2841 |
*
Shewanella oneidensis MR-1 Site: position = -60 score = 5.42629 sequence = GACTGATAATAGTTTTCATTT Gene: SO2841: Hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -59 score = 5.58161 sequence = GACTGATAATAATTTTCATTT Gene: Sputcn32_1534: Hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -59 score = 5.58161 sequence = GACTGATAATAATTTTCATTT Gene: Sputw3181_2565: Hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -71 score = 5.58161 sequence = GACTGATAATAATTTTCATTT Gene: Shewana3_2609: Hypothetical protein |
*
Shewanella sp MR-4 Site: position = -71 score = 5.58161 sequence = GACTGATAATAATTTTCATTT Gene: Shewmr4_2447: Hypothetical protein |
*
Shewanella sp MR-7 Site: position = -71 score = 5.58161 sequence = GACTGATAATAATTTTCATTT Gene: Shewmr7_2517: Hypothetical protein |
*
Shewanella baltica OS155 Site: position = -63 score = 5.42629 sequence = GACTGATAATAGTTTTCATTT Gene: Sbal_1657: Hypothetical protein |
|
|
*
Shewanella amazonensis SB2B Site: position = -60 score = 5.40204 sequence = GACTGAGAATGGTTTTCATTT Gene: Sama_1270: Hypothetical protein |
|
*
Shewanella pealeana ATCC 700345 Site: position = -104 score = 5.52067 sequence = GAACGATAATGATTTTCATTT Gene: Spea_2627: Hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -103 score = 5.77297 sequence = TAACGATAATGATTTTCATTT Gene: Shal_2698: Hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -56 score = 6.09669 sequence = AATTGATAACGATTTTCATTT Gene: swp_3175: Hypothetical protein |
|
|
Hypothetical protein |
| CRON 30. | |||||||||||||||||
| irgA |
*
Shewanella oneidensis MR-1 Site: position = -50 score = 6.11048 sequence = TATTGAAAATTATTATCATTT Gene: SO_4523: TonB-dependent receptor |
*
Shewanella putrefaciens CN-32 Site: position = -52 score = 5.94471 sequence = TATTGAAAATTGTTCTCATTT Gene: Sputcn32_3503: TonB-dependent receptor |
*
Shewanella sp W3-18-1 Site: position = -52 score = 5.94471 sequence = TATTGAAAATTGTTCTCATTT Gene: Sputw3181_0403: TonB-dependent receptor |
*
Shewanella sp ANA-3 Site: position = -49 score = 6.11048 sequence = TATTGAAAATTATTATCATTT Gene: Shewana3_3929: TonB-dependent receptor |
|
|
*
Shewanella baltica OS155 Site: position = -52 score = 5.94471 sequence = TATTGAAAATTGTTCTCATTT Gene: Sbal_0217: TonB-dependent receptor |
|
|
|
|
|
|
|
|
|
TonB-dependent receptor |
| CRON 31. | |||||||||||||||||
| viuA |
*
Shewanella oneidensis MR-1 Site: position = -100 score = 5.79475 sequence = AAATGATATTGGTTATCAATT Gene: SO4516: TonB-dependent receptor |
*
Shewanella putrefaciens CN-32 Site: position = -101 score = 5.59083 sequence = AAATGATAATCCTTCTCAGTT Gene: Sputcn32_0330: TonB-dependent receptor |
*
Shewanella sp W3-18-1 Site: position = -101 score = 5.59083 sequence = AAATGATAATCCTTCTCAGTT Gene: Sputw3181_3878: TonB-dependent receptor |
*
Shewanella sp ANA-3 Site: position = -99 score = 5.77174 sequence = AAATGATATTGGTTATCATCT Gene: Shewana3_3923: TonB-dependent receptor |
*
Shewanella sp MR-4 Site: position = -99 score = 6.01075 sequence = AAATGATATTGGTTATCATTT Gene: Shewmr4_3727: TonB-dependent receptor |
*
Shewanella sp MR-7 Site: position = -99 score = 6.01075 sequence = AAATGATATTGGTTATCATTT Gene: Shewmr7_3798: TonB-dependent receptor |
|
*
Shewanella denitrificans OS217 Site: position = -92 score = 5.23678 sequence = AAATGAGAGTGATTTGCAATT Gene: Sden_0621: TonB-dependent receptor |
|
|
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -104 score = 5.26396 sequence = AAATGTGAATGATTCGCAATT Gene: swp_0161: TonB-dependent receptor |
|
|
TonB-dependent receptor |
| CRON 32. | |||||||||||||||||
| SO3406 |
*
Shewanella oneidensis MR-1 Site: position = -273 score = 5.68896 sequence = AAATGATATTGTTTATCATTT Gene: SO3406: Conserved hypothetical protein |
*
Shewanella putrefaciens CN-32 Site: position = -196 score = 5.53364 sequence = AAATGATATCGTTTATCATTT Gene: Sputcn32_2727: Conserved hypothetical protein |
*
Shewanella sp W3-18-1 Site: position = -196 score = 5.53364 sequence = AAATGATATCGTTTATCATTT Gene: Sputw3181_1285: Conserved hypothetical protein |
*
Shewanella sp ANA-3 Site: position = -177 score = 5.68896 sequence = AAATGATATTGTTTATCATTT Gene: Shewana3_1149: Conserved hypothetical protein |
*
Shewanella sp MR-4 Site: position = -177 score = 5.68896 sequence = AAATGATATTGTTTATCATTT Gene: Shewmr4_1148: Conserved hypothetical protein |
*
Shewanella sp MR-7 Site: position = -177 score = 5.68896 sequence = AAATGATATTGTTTATCATTT Gene: Shewmr7_1219: Conserved hypothetical protein |
*
Shewanella baltica OS155 Site: position = -195 score = 5.53364 sequence = AAATGATATCGTTTATCATTT Gene: Sbal_1237: Conserved hypothetical protein |
*
Shewanella denitrificans OS217 Site: position = -75 score = 5.24099 sequence = GAATAAAAACAGTTCTCAATT Gene: Sden_2355: Conserved hypothetical protein |
|
*
Shewanella amazonensis SB2B Site: position = -72 score = 5.79792 sequence = AATTGAGAATGTTTATCATTT Gene: Sama_3409: Conserved hypothetical protein |
*
Shewanella loihica PV-4 Site: position = -63 score = 4.49479 sequence = GAATGAGAACCTATCTCAACA Gene: Shew_1240: Conserved hypothetical protein |
*
Shewanella pealeana ATCC 700345 Site: position = -82 score = 5.27096 sequence = GAATGAAAACAGTTATCAGTT Gene: Spea_1223: Conserved hypothetical protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -96 score = 5.07291 sequence = GAATGGAAACGGTTCTCAATT Gene: Shal_1257: Conserved hypothetical protein |
*
Shewanella piezotolerans WP3 Site: position = -91 score = 5.23765 sequence = GAATAAAAATGGTTATCAATA Gene: swp_3413: Conserved hypothetical protein |
*
Shewanella sediminis HAW-EB3 Site: position = -98 score = 5.08765 sequence = GAATGAAAACGGTTATCACCT Gene: Ssed_1345: Conserved hypothetical protein |
*
Shewanella woodyi ATCC 51908 Site: position = -96 score = 5.69549 sequence = AAATAAAAACCGTTCTCATTA Gene: Swoo_3307: Conserved hypothetical protein |
Conserved hypothetical protein |
| SO3407 |
Gene: SO3407: Iron-regulated membrane protein |
Gene: Sputcn32_2728: Iron-regulated membrane protein |
Gene: Sputw3181_1284: Iron-regulated membrane protein |
Gene: Shewana3_1148: Iron-regulated membrane protein |
Gene: Shewmr4_1147: Iron-regulated membrane protein |
Gene: Shewmr7_1218: Iron-regulated membrane protein |
Gene: Sbal_1236: Iron-regulated membrane protein |
Gene: Sden_2356: Iron-regulated membrane protein |
|
Gene: Sama_3410: Iron-regulated membrane protein |
Gene: Shew_1239: Iron-regulated membrane protein |
Gene: Spea_1222: Iron-regulated membrane protein |
Gene: Shal_1256: Iron-regulated membrane protein |
Gene: swp_3414: Iron-regulated membrane protein |
Gene: Ssed_1344: Iron-regulated membrane protein |
Gene: Swoo_3308: Iron-regulated membrane protein |
Iron-regulated membrane protein |
| SO3408 |
Gene: SO3408: Conserved hypothetical inner membrane protein |
Gene: Sputcn32_2729: Conserved hypothetical inner membrane protein |
Gene: Sputw3181_1283: Conserved hypothetical inner membrane protein |
Gene: Shewana3_1147: Conserved hypothetical inner membrane protein |
Gene: Shewmr4_1146: Conserved hypothetical inner membrane protein |
Gene: Shewmr7_1217: Conserved hypothetical inner membrane protein |
Gene: Sbal_1235: Conserved hypothetical inner membrane protein |
Gene: Sden_2357: Conserved hypothetical inner membrane protein |
|
Gene: Sama_3411: Conserved hypothetical inner membrane protein |
Gene: Shew_1238: Conserved hypothetical inner membrane protein |
Gene: Spea_1221: Conserved hypothetical inner membrane protein |
Gene: Shal_1255: Conserved hypothetical inner membrane protein |
Gene: swp_3415: Conserved hypothetical inner membrane protein |
Gene: Ssed_1343: Conserved hypothetical inner membrane protein |
Gene: Swoo_3309: Conserved hypothetical inner membrane protein |
Conserved hypothetical inner membrane protein |
| CRON 33. | |||||||||||||||||
| SO3025 |
*
Shewanella oneidensis MR-1 Site: position = -220 score = 5.76286 sequence = AAATGACAATAGTTGTCATTT Gene: SO3025: Periplasmic esterase |
|
|
*
Shewanella sp ANA-3 Site: position = -177 score = 5.8091 sequence = GAATGATAATAATTGTCATTT Gene: Shewana3_1514: Periplasmic esterase |
|
|
|
|
|
|
|
|
|
|
|
|
Periplasmic esterase |
| CRON 34. | |||||||||||||||||
| SO2039 |
*
Shewanella oneidensis MR-1 Site: position = -44 score = 5.5636 sequence = AAATGCGAATAATTAGCAATT Gene: SO2039: Signalling protein with EAL domain |
*
Shewanella putrefaciens CN-32 Site: position = -48 score = 4.87901 sequence = AAATGCAAATAATAAGCAATT Gene: Sputcn32_2106: Signalling protein with EAL domain |
*
Shewanella sp W3-18-1 Site: position = -48 score = 4.87901 sequence = AAATGCAAATAATAAGCAATT Gene: Sputw3181_1906: Signalling protein with EAL domain |
*
Shewanella sp ANA-3 Site: position = -44 score = 5.02389 sequence = AAATGCGAATAATTAGCGATT Gene: Shewana3_2237: Signalling protein with EAL domain |
*
Shewanella sp MR-4 Site: position = -42 score = 5.02389 sequence = AAATGCGAATAATTAGCGATT Gene: Shewmr4_2112: Signalling protein with EAL domain |
*
Shewanella sp MR-7 Site: position = -44 score = 5.5636 sequence = AAATGCGAATAATTAGCAATT Gene: Shewmr7_1862: Signalling protein with EAL domain |
*2
Shewanella baltica OS155 Site: position = -46 score = 5.32818 sequence = AAATGCGAATAATTAGTATTA Gene: Sbal_4560: Signalling protein with EAL domain Site: position = -46 score = 5.32818 sequence = AAATGCGAATAATTAGTATTA Gene: Sbal_2274: Signalling protein with EAL domain |
*
Shewanella denitrificans OS217 Site: position = -44 score = 5.24041 sequence = AAATAGGAATAATTAGCATTA Gene: Sden_1592: Signalling protein with EAL domain |
|
*
Shewanella amazonensis SB2B Site: position = -42 score = 5.46268 sequence = TAATGAGATTTATTTGCATTA Gene: Sama_1896: Signalling protein with EAL domain |
|
|
*
Shewanella halifaxensis HAW-EB4 Site: position = -35 score = 5.23706 sequence = TAATATAAACAATTATCATTT Gene: Shal_1861: Signalling protein with EAL domain |
*
Shewanella piezotolerans WP3 Site: position = 29 score = 5.56661 sequence = TAATGTTAATAATTATCATTA Gene: swp_2763: Signalling protein with EAL domain |
*
Shewanella sediminis HAW-EB3 Site: position = -56 score = 4.96502 sequence = TAATGTGAATAATTACTATTT Gene: Ssed_1968: Signalling protein with EAL domain |
Gene: Swoo_2622: Signalling protein with EAL domain |
Signalling protein with EAL domain |
| CRON 35. | |||||||||||||||||
| SO1755 |
*
Shewanella oneidensis MR-1 Site: position = -30 score = 5.31835 sequence = AATTGAAAATGATTTTCACTG Gene: SO1755: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
*
Shewanella putrefaciens CN-32 Site: position = -30 score = 4.7552 sequence = GATTGCAAATGATTTTCAATG Gene: Sputcn32_1454: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
*
Shewanella sp W3-18-1 Site: position = -30 score = 4.7552 sequence = GATTGCAAATGATTTTCAATG Gene: Sputw3181_2648: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
*
Shewanella sp ANA-3 Site: position = -30 score = 4.91073 sequence = GATTGAAAATGATTTTCACTG Gene: Shewana3_2707: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
*
Shewanella sp MR-4 Site: position = -30 score = 4.91073 sequence = GATTGAAAATGATTTTCACTG Gene: Shewmr4_2541: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
*
Shewanella sp MR-7 Site: position = -31 score = 4.91073 sequence = GATTGAAAATGATTTTCACTG Gene: Shewmr7_2608: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
*
Shewanella baltica OS155 Site: position = -30 score = 4.7552 sequence = GATTGCAAATGATTTTCAATG Gene: Sbal_1561: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
Gene: Sden_1966: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
*
Shewanella frigidimarina NCIMB 400 Site: position = -30 score = 5.40359 sequence = TATTGAAAATGATTATCAATG Gene: Sfri_2159: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
Gene: Sama_1189: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
Gene: Shew_2544: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
Gene: Spea_2727: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
Gene: Shal_2810: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
Gene: swp_3297: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
*
Shewanella sediminis HAW-EB3 Site: position = -67 score = 5.28327 sequence = AAATGAAAATCATTTGTAGTT Gene: Ssed_1517: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
*
Shewanella woodyi ATCC 51908 Site: position = -66 score = 5.17329 sequence = CAATGCTAATGATTTTCAACT Gene: Swoo_3151: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon |
| CRON 36. | |||||||||||||||||
| SO1580 |
*
Shewanella oneidensis MR-1 Site: position = -82 score = 5.45374 sequence = ATGTGAGAATTATTCTCATCT Gene: SO1580: TonB-dependent heme receptor |
*
Shewanella putrefaciens CN-32 Site: position = -84 score = 5.58796 sequence = AATTGAGAACTATTCTTATCT Gene: Sputcn32_1308: TonB-dependent heme receptor |
*
Shewanella sp W3-18-1 Site: position = -84 score = 5.58796 sequence = AATTGAGAACTATTCTTATCT Gene: Sputw3181_2795: TonB-dependent heme receptor |
*
Shewanella sp ANA-3 Site: position = -81 score = 5.59328 sequence = AGGTGAGAATTATTCTCATCT Gene: Shewana3_2862: TonB-dependent heme receptor |
|
|
*
Shewanella baltica OS155 Site: position = -84 score = 5.38087 sequence = AAGTGAGAACTATTCTTATCT Gene: Sbal_1397: TonB-dependent heme receptor |
*
Shewanella denitrificans OS217 Site: position = -172 score = 5.52135 sequence = AACTGATAATCATTCTCATTG Gene: Sden_2503: TonB-dependent heme receptor |
|
|
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -76 score = 5.67077 sequence = AAGTGATAATCATTATCATTC Gene: swp_0953: TonB-dependent heme receptor |
|
|
TonB-dependent heme receptor |
| CRON 37. | |||||||||||||||||
| SO3062 |
*
Shewanella oneidensis MR-1 Site: position = -67 score = 5.48972 sequence = TGTTGAGAACAATTCTCATCT Gene: SO3062: Hypothetical inner membrane protein |
*
Shewanella putrefaciens CN-32 Site: position = -55 score = 5.49893 sequence = AATTGAGAACCATTCTCAACA Gene: Sputcn32_2436: Hypothetical inner membrane protein |
|
*
Shewanella sp ANA-3 Site: position = -67 score = 5.80037 sequence = AGTTGAGAATAATTCTCATCT Gene: Shewana3_1485: Hypothetical inner membrane protein |
*
Shewanella sp MR-4 Site: position = -66 score = 6.02558 sequence = AATTGAGAATGATTCTCATCT Gene: Shewmr4_1432: Hypothetical inner membrane protein |
*
Shewanella sp MR-7 Site: position = -66 score = 5.80037 sequence = AGTTGAGAATTATTCTCATCT Gene: Shewmr7_1497: Hypothetical inner membrane protein |
*
Shewanella baltica OS155 Site: position = -50 score = 5.15012 sequence = AATTGCGAATAGTTCTCAACA Gene: Sbal_2737: Hypothetical inner membrane protein |
|
|
|
*
Shewanella loihica PV-4 Site: position = -55 score = 5.29184 sequence = TGTTGAGAATCATTCTCACTA Gene: Shew_2300: Hypothetical inner membrane protein |
*
Shewanella pealeana ATCC 700345 Site: position = -61 score = 5.41807 sequence = TGTTGAGAACAGTTCTCATTA Gene: Spea_1624: Hypothetical inner membrane protein |
|
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -70 score = 6.27837 sequence = AATTGAGAATAATTCTCATTT Gene: Swoo_2977: Hypothetical inner membrane protein |
Hypothetical inner membrane protein |
| CRON 38. | |||||||||||||||||
| SO0798 |
*
Shewanella oneidensis MR-1 Site: position = -62 score = 6.05341 sequence = AAATAATAACAATTCTCATTT Gene: SO0798: TonB-dependent outer membrane receptor |
*
Shewanella putrefaciens CN-32 Site: position = -62 score = 5.63199 sequence = AAATAATAACCATTCTCATTC Gene: Sputcn32_3191: TonB-dependent outer membrane receptor |
*
Shewanella sp W3-18-1 Site: position = -62 score = 5.63199 sequence = AAATAATAACCATTCTCATTC Gene: Sputw3181_0752: TonB-dependent outer membrane receptor |
|
*
Shewanella sp MR-4 Site: position = -62 score = 6.20873 sequence = AAATAATAATTATTCTCATTT Gene: Shewmr4_3318: TonB-dependent outer membrane receptor |
*
Shewanella sp MR-7 Site: position = -62 score = 6.20873 sequence = AAATAATAATTATTCTCATTT Gene: Shewmr7_0635: TonB-dependent outer membrane receptor |
|
|
|
|
|
|
|
|
|
|
TonB-dependent outer membrane receptor |
| SO0797 |
Gene: SO0797: Periplasmic thioredoxin-family protein |
Gene: Sputcn32_3192: Periplasmic thioredoxin-family protein |
Gene: Sputw3181_0751: Periplasmic thioredoxin-family protein |
|
Gene: Shewmr4_3319: Periplasmic thioredoxin-family protein |
Gene: Shewmr7_0634: Periplasmic thioredoxin-family protein |
|
|
|
|
|
|
|
|
|
|
Periplasmic thioredoxin-family protein |
| CRON 39. | |||||||||||||||||
| SO3344 |
*
Shewanella oneidensis MR-1 Site: position = -44 score = 6.00891 sequence = AAATGATAATGATTATCAGTT Gene: SO3344: Hypothetical inner membrane protein |
*
Shewanella putrefaciens CN-32 Site: position = -40 score = 6.04648 sequence = AGATGATAATGATTATCAATT Gene: Sputcn32_2679: Hypothetical inner membrane protein |
*
Shewanella sp W3-18-1 Site: position = -40 score = 6.04648 sequence = AGATGATAATGATTATCAATT Gene: Sputw3181_1332: Hypothetical inner membrane protein |
*
Shewanella sp ANA-3 Site: position = -44 score = 6.07839 sequence = AAATGATAATGATTATCACTT Gene: Shewana3_1202: Hypothetical inner membrane protein |
*
Shewanella sp MR-4 Site: position = -44 score = 6.07839 sequence = AAATGATAATGATTATCACTT Gene: Shewmr4_1201: Hypothetical inner membrane protein |
*
Shewanella sp MR-7 Site: position = -44 score = 6.07839 sequence = AAATGATAATGATTATCACTT Gene: Shewmr7_1272: Hypothetical inner membrane protein |
*
Shewanella baltica OS155 Site: position = -41 score = 6.04648 sequence = AGATGATAATGATTATCAATT Gene: Sbal_3017: Hypothetical inner membrane protein |
|
|
*
Shewanella amazonensis SB2B Site: position = -52 score = 5.92796 sequence = TATTGATAATAATTATCAATT Gene: Sama_2470: Hypothetical inner membrane protein |
*
Shewanella loihica PV-4 Site: position = -43 score = 6.28548 sequence = AAATGATAATGATTATCAATT Gene: Shew_1146: Hypothetical inner membrane protein |
*
Shewanella pealeana ATCC 700345 Site: position = -33 score = 6.13016 sequence = TAATGATAATGATTATCAATT Gene: Spea_1134: Hypothetical inner membrane protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -44 score = 6.06949 sequence = AATTGATAATGATTATCAATT Gene: Shal_1179: Hypothetical inner membrane protein |
*
Shewanella piezotolerans WP3 Site: position = -43 score = 6.13016 sequence = TAATGATAATGATTATCAATT Gene: swp_3598: Hypothetical inner membrane protein |
*
Shewanella sediminis HAW-EB3 Site: position = -41 score = 5.72253 sequence = TAATGATAATGATTATCAATC Gene: Ssed_1239: Hypothetical inner membrane protein |
*
Shewanella woodyi ATCC 51908 Site: position = -42 score = 6.00891 sequence = AAATGATAATGATTATCAGTT Gene: Swoo_1339: Hypothetical inner membrane protein |
Hypothetical inner membrane protein |
| CRON 40. | |||||||||||||||||
| ftn |
*
Shewanella oneidensis MR-1 Site: position = -133 score = 5.74412 sequence = AAATGAAAATCATTTTTATCA Gene: SO0139: Ferritin, Ftn |
*
Shewanella putrefaciens CN-32 Site: position = -131 score = 5.74412 sequence = AAATGAAAATCATTTTTATCA Gene: Sputcn32_0132: Ferritin, Ftn |
*
Shewanella sp W3-18-1 Site: position = -131 score = 5.74412 sequence = AAATGAAAATCATTTTTATCA Gene: Sputw3181_3940: Ferritin, Ftn |
*
Shewanella sp ANA-3 Site: position = -132 score = 5.74412 sequence = AAATGAAAATCATTTTTATCA Gene: Shewana3_0132: Ferritin, Ftn |
*
Shewanella sp MR-4 Site: position = -132 score = 5.3815 sequence = AAATGCAAATCATTTTTATCA Gene: Shewmr4_0133: Ferritin, Ftn |
*
Shewanella sp MR-7 Site: position = -132 score = 5.3815 sequence = AAATGCAAATCATTTTTATCA Gene: Shewmr7_0127: Ferritin, Ftn |
*
Shewanella baltica OS155 Site: position = -131 score = 5.74412 sequence = AAATGAAAATCATTTTTATCA Gene: Sbal_4222: Ferritin, Ftn |
|
|
*
Shewanella amazonensis SB2B Site: position = -113 score = 5.05053 sequence = TAATGATAAGTGTTACTATTT Gene: Sama_0141: Ferritin, Ftn |
*
Shewanella loihica PV-4 Site: position = -381 score = 5.42415 sequence = TAACGATAATTATTTGCATTT Gene: Shew_0042: Ferritin, Ftn |
*
Shewanella pealeana ATCC 700345 Site: position = -111 score = 6.01659 sequence = AAATGAAAACCATTATTATTT Gene: Spea_0129: Ferritin, Ftn |
*
Shewanella halifaxensis HAW-EB4 Site: position = -111 score = 6.01659 sequence = AAATGAAAACCATTATTATTT Gene: Shal_4189: Ferritin, Ftn |
*
Shewanella piezotolerans WP3 Site: position = -110 score = 6.01659 sequence = AAATGAAAACCATTATTATTT Gene: swp_0167: Ferritin, Ftn |
*
Shewanella sediminis HAW-EB3 Site: position = -107 score = 5.70124 sequence = TAATGATAATTATTAGTATTT Gene: Ssed_4374: Ferritin, Ftn |
*
Shewanella woodyi ATCC 51908 Site: position = -176 score = 5.65732 sequence = TAATGAGAATTATTTGTATTT Gene: Swoo_4766: Ferritin, Ftn |
Ferritin, Ftn |
| CRON 41. | |||||||||||||||||
| omcA2 |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -67 score = 5.31834 sequence = AAATGAGAGTTGTTCTCATAT Gene: Spea_2697: Surface localized decaheme cytochrome c lipoprotein, OmcA |
|
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -79 score = 4.5996 sequence = GAATAAGAATCACTCTTATCT Gene: Swoo_3124: Surface localized decaheme cytochrome c lipoprotein, OmcA |
Surface localized decaheme cytochrome c lipoprotein, OmcA |
| CRON 42. | |||||||||||||||||
| SO4740 |
*
Shewanella oneidensis MR-1 Site: position = -60 score = 5.95517 sequence = TAATGAGAATTGTTATCATCT Gene: SO4740: Conserved hypothetical inner membrane protein |
*
Shewanella putrefaciens CN-32 Site: position = -59 score = 5.95517 sequence = TAATGAGAATTGTTATCATCT Gene: Sputcn32_3921: Conserved hypothetical inner membrane protein |
*
Shewanella sp W3-18-1 Site: position = -59 score = 5.95517 sequence = TAATGAGAATTGTTATCATCT Gene: Sputw3181_4047: Conserved hypothetical inner membrane protein |
*
Shewanella sp ANA-3 Site: position = -60 score = 5.95517 sequence = TAATGAGAATTGTTATCATCT Gene: Shewana3_4124: Conserved hypothetical inner membrane protein |
*
Shewanella sp MR-4 Site: position = -60 score = 5.95517 sequence = TAATGAGAATTGTTATCATCT Gene: Shewmr4_3919: Conserved hypothetical inner membrane protein |
*
Shewanella sp MR-7 Site: position = -60 score = 5.95517 sequence = TAATGAGAATTGTTATCATCT Gene: Shewmr7_4011: Conserved hypothetical inner membrane protein |
*
Shewanella baltica OS155 Site: position = -59 score = 5.95517 sequence = TAATGAGAATTGTTATCATCT Gene: Sbal_4341: Conserved hypothetical inner membrane protein |
*
Shewanella denitrificans OS217 Site: position = -50 score = 5.97483 sequence = TATTGATAACGATTATCATTT Gene: Sden_3706: Conserved hypothetical inner membrane protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -46 score = 6.03885 sequence = TAATGAGAACTGTTATCATTT Gene: Sfri_4031: Conserved hypothetical inner membrane protein |
*
Shewanella amazonensis SB2B Site: position = -50 score = 5.93686 sequence = AAGTGATAACTATTATCATTT Gene: Sama_3636: Conserved hypothetical inner membrane protein |
*
Shewanella loihica PV-4 Site: position = -46 score = 6.51527 sequence = AAATGATAATAATTATCATTT Gene: Shew_3815: Conserved hypothetical inner membrane protein |
*
Shewanella pealeana ATCC 700345 Site: position = -47 score = 5.92807 sequence = AAATGAGAAGCGTTATCATTT Gene: Spea_4226: Conserved hypothetical inner membrane protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -47 score = 6.34615 sequence = AAATGATAACCATTATCATTT Gene: Shal_4274: Conserved hypothetical inner membrane protein |
*
Shewanella piezotolerans WP3 Site: position = -46 score = 6.10715 sequence = AAATGATAATCGTTATCATCT Gene: swp_5137: Conserved hypothetical inner membrane protein |
*
Shewanella sediminis HAW-EB3 Site: position = -47 score = 6.11049 sequence = AGATGAGAATAGTTATCATTT Gene: Ssed_4479: Conserved hypothetical inner membrane protein |
*
Shewanella woodyi ATCC 51908 Site: position = -50 score = 6.3357 sequence = AAATGAGAACCATTATCATTT Gene: Swoo_4887: Conserved hypothetical inner membrane protein |
Conserved hypothetical inner membrane protein |
| CRON 43. | |||||||||||||||||
| swp_4957 |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -84 score = 5.74799 sequence = GAATGAGAATCAATATCATTT Gene: swp_4957: Outer membrane receptor protein, mostly Fe transport |
|
|
Outer membrane receptor protein, mostly Fe transport |
| swp_4956 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: swp_4956: Probable zinc protease |
|
|
Probable zinc protease |
| swp_4955 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: swp_4955: ABC-type uncharacterized transport system, permease and ATPase components |
|
|
ABC-type uncharacterized transport system, permease and ATPase components |
| Sden_2158 |
|
|
|
|
|
|
|
Gene: Sden_2158: TonB mediate energy transduction system, conserved hypothetical periplasmic component |
|
|
|
|
|
Gene: swp_4954: TonB mediate energy transduction system, conserved hypothetical periplasmic component |
|
|
TonB mediate energy transduction system, conserved hypothetical periplasmic component |
| ttpc |
|
|
|
|
|
|
|
Gene: Sden_2157: TonB mediated energy transduction system, inner membrane component, TtpC |
|
|
|
|
|
Gene: swp_4953: TonB mediated energy transduction system, inner membrane component, TtpC |
|
|
TonB mediated energy transduction system, inner membrane component, TtpC |
| exbB |
|
|
|
|
|
|
|
Gene: Sden_2156: TonB mediated energy transduction system, inner membrane component, ExbB |
|
|
|
|
|
Gene: swp_4952: TonB mediated energy transduction system, inner membrane component, ExbB |
|
|
TonB mediated energy transduction system, inner membrane component, ExbB |
| exbD |
|
|
|
|
|
|
|
Gene: Sden_2155: TonB mediated energy transduction system, membrane anchored component, ExbD |
|
|
|
|
|
Gene: swp_4950: TonB mediated energy transduction system, membrane anchored component, ExbD |
|
|
TonB mediated energy transduction system, membrane anchored component, ExbD |
| swp_4949 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: swp_4949: Hypothetical protein |
|
|
Hypothetical protein |
| Sden_2154 |
|
|
|
|
|
|
|
Gene: Sden_2154: TonB mediated energy transduction system, energy transducer component, TonB |
|
|
|
|
|
Gene: swp_4948: TonB mediated energy transduction system, energy transducer component, TonB |
|
|
TonB mediated energy transduction system, energy transducer component, TonB |
| tprX |
|
|
|
|
|
|
|
Gene: Sden_2153: TPR repeat-containing protein |
|
|
|
|
|
Gene: swp_4947: TPR repeat-containing protein |
|
|
TPR repeat-containing protein |
| Sden_2159 |
|
|
|
|
|
|
|
*
Shewanella denitrificans OS217 Site: position = -58 score = 5.7843 sequence = TATTGAGATTCATTATCATTT Gene: Sden_2159: TonB-dependent receptor |
|
|
|
|
|
|
|
|
TonB-dependent receptor |
| SO1188 |
*
Shewanella oneidensis MR-1 Site: position = -185 score = 5.43001 sequence = TTTTGATAATAAATATCATTT Gene: SO1188: Inner membrane protein with PepSY TM helix |
*
Shewanella putrefaciens CN-32 Site: position = -93 score = 5.17771 sequence = GTTTGATAATAAATATCATTT Gene: Sputcn32_2850: Inner membrane protein with PepSY TM helix |
*
Shewanella sp W3-18-1 Site: position = -93 score = 5.17771 sequence = GTTTGATAATAAATATCATTT Gene: Sputw3181_1054: Inner membrane protein with PepSY TM helix |
*
Shewanella sp ANA-3 Site: position = -181 score = 5.56954 sequence = TGTTGATAATAAATATCATTT Gene: Shewana3_1014: Inner membrane protein with PepSY TM helix |
*
Shewanella sp MR-4 Site: position = -181 score = 5.56954 sequence = TGTTGATAATAAATATCATTT Gene: Shewmr4_1010: Inner membrane protein with PepSY TM helix |
*
Shewanella sp MR-7 Site: position = -181 score = 5.56954 sequence = TGTTGATAATAAATATCATTT Gene: Shewmr7_1075: Inner membrane protein with PepSY TM helix |
*
Shewanella baltica OS155 Site: position = -45 score = 5.40576 sequence = ATTTGATAATCGATCTCATTT Gene: Sbal_3255: Inner membrane protein with PepSY TM helix |
Gene: Sden_2152: Inner membrane protein with PepSY TM helix |
|
*
Shewanella amazonensis SB2B Site: position = -73 score = 4.8188 sequence = TGGTGAGAATTACTCTCAATT Gene: Sama_2808: Inner membrane protein with PepSY TM helix |
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -102 score = 4.28607 sequence = TGATCATAATTGTTTTAAATC Gene: swp_3069: Inner membrane protein with PepSY TM helix |
|
|
Inner membrane protein with PepSY TM helix |
| SO1189 |
Gene: SO1189: Putative exported protein |
Gene: Sputcn32_2849: Putative exported protein |
Gene: Sputw3181_1055: Putative exported protein |
Gene: Shewana3_1015: Putative exported protein |
Gene: Shewmr4_1011: Putative exported protein |
Gene: Shewmr7_1076: Putative exported protein |
Gene: Sbal_3254: Putative exported protein |
Gene: Sden_2151: Putative exported protein |
|
Gene: Sama_2809: Putative exported protein |
|
|
|
Gene: swp_3071: Putative exported protein |
|
|
Putative exported protein |
| SO1190 |
Gene: SO1190: putative exported protein |
Gene: Sputcn32_2848: putative exported protein |
Gene: Sputw3181_1056: putative exported protein |
Gene: Shewana3_1016: putative exported protein |
Gene: Shewmr4_1012: putative exported protein |
Gene: Shewmr7_1077: putative exported protein |
Gene: Sbal_3253: putative exported protein |
Gene: Sden_2150: putative exported protein |
|
Gene: Sama_2810: putative exported protein |
|
|
|
|
|
|
putative exported protein |
| CRON 44. | |||||||||||||||||
| omp |
|
|
|
|
|
|
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -102 score = 4.97258 sequence = GATTGATAATCGTTGTTATTA Gene: Sfri_3225: TonB-dependent siderophore receptor |
|
|
|
|
|
|
|
TonB-dependent siderophore receptor |
| SO0447 |
*
Shewanella oneidensis MR-1 Site: position = -146 score = 5.21078 sequence = TATTGCGAACTATTCTCATCA Gene: SO0447: Iron-regulated inner membrane protein |
*
Shewanella putrefaciens CN-32 Site: position = -184 score = 5.24425 sequence = TATTGCGAATTGTTATCAATA Gene: Sputcn32_3397: Iron-regulated inner membrane protein |
*
Shewanella sp W3-18-1 Site: position = -182 score = 5.24425 sequence = TATTGCGAATTGTTATCAATA Gene: Sputw3181_0546: Iron-regulated inner membrane protein |
*
Shewanella sp ANA-3 Site: position = -152 score = 5.05546 sequence = TATTGCGAACTGTTCTCATCA Gene: Shewana3_0445: Iron-regulated inner membrane protein |
*
Shewanella sp MR-4 Site: position = -153 score = 4.7877 sequence = TATTGCGAACTATTCTCACCA Gene: Shewmr4_0449: Iron-regulated inner membrane protein |
*
Shewanella sp MR-7 Site: position = -155 score = 4.7877 sequence = TATTGCGAACTATTCTCACCA Gene: Shewmr7_3580: Iron-regulated inner membrane protein |
|
*
Shewanella denitrificans OS217 Site: position = -72 score = 5.23678 sequence = AATTGCAAATCACTCTCATTT Gene: Sden_0620: Iron-regulated inner membrane protein |
Gene: Sfri_3224: Iron-regulated inner membrane protein |
|
|
|
|
|
|
|
Iron-regulated inner membrane protein |
| SO0448 |
Gene: SO0448: Iron-regulated inner membrane protein |
Gene: Sputcn32_3396: Iron-regulated inner membrane protein |
Gene: Sputw3181_0547: Iron-regulated inner membrane protein |
Gene: Shewana3_0446: Iron-regulated inner membrane protein |
Gene: Shewmr4_0450: Iron-regulated inner membrane protein |
Gene: Shewmr7_3579: Iron-regulated inner membrane protein |
|
Gene: Sden_0619: Iron-regulated inner membrane protein |
Gene: Sfri_3223: Iron-regulated inner membrane protein |
|
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -456 score = 5.26396 sequence = AATTGCGAATCATTCACATTT Gene: swp_0160: Iron-regulated inner membrane protein |
|
|
Iron-regulated inner membrane protein |
| SO0449 |
Gene: SO0449: Iron-regulated membrane protein |
Gene: Sputcn32_3395: Iron-regulated membrane protein |
Gene: Sputw3181_0548: Iron-regulated membrane protein |
Gene: Shewana3_0447: Iron-regulated membrane protein |
Gene: Shewmr4_0451: Iron-regulated membrane protein |
Gene: Shewmr7_3578: Iron-regulated membrane protein |
|
Gene: Sden_0618: Iron-regulated membrane protein |
Gene: Sfri_3222: Iron-regulated membrane protein |
|
|
|
|
Gene: swp_0159: Iron-regulated membrane protein |
|
|
Iron-regulated membrane protein |
| CRON 45. | |||||||||||||||||
| Spea_3339 |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -53 score = 5.76541 sequence = ATTTGATAATAATTATCATTA Gene: Spea_3339: Coproporphyrinogen III oxidase |
*
Shewanella halifaxensis HAW-EB4 Site: position = -54 score = 5.90694 sequence = ATTTGATAATGATTATCATTT Gene: Shal_3411: Coproporphyrinogen III oxidase |
*
Shewanella piezotolerans WP3 Site: position = -48 score = 5.89116 sequence = AGTTGATAATGATTATCATTA Gene: swp_3985: Coproporphyrinogen III oxidase |
|
|
Coproporphyrinogen III oxidase |
| CRON 46. | |||||||||||||||||
| hmuA |
*
Shewanella oneidensis MR-1 Site: position = -169 score = 5.72154 sequence = AAATGATAATGATTTCTATTT Gene: SO3669: TonB-dependent haem/haemoglobin receptor, HmuA |
*
Shewanella putrefaciens CN-32 Site: position = -178 score = 6.0511 sequence = AAATGATAATGATTACCATTT Gene: Sputcn32_0966: TonB-dependent haem/haemoglobin receptor, HmuA |
*
Shewanella sp W3-18-1 Site: position = -178 score = 6.0511 sequence = AAATGATAATGATTACCATTT Gene: Sputw3181_3201: TonB-dependent haem/haemoglobin receptor, HmuA |
*
Shewanella sp ANA-3 Site: position = -171 score = 6.01763 sequence = AAATGATAATGATTTCCATTT Gene: Shewana3_3235: TonB-dependent haem/haemoglobin receptor, HmuA |
|
|
*
Shewanella baltica OS155 Site: position = -284 score = 6.10539 sequence = AAATGATAATGATTTGCATTT Gene: Sbal_0952: TonB-dependent haem/haemoglobin receptor, HmuA |
*
Shewanella denitrificans OS217 Site: position = -133 score = 6.468 sequence = AAATGATAATGATTTTCATTT Gene: Sden_0790: TonB-dependent haem/haemoglobin receptor, HmuA |
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -143 score = 6.468 sequence = AAATGATAATGATTTTCATTT Gene: Spea_3327: TonB-dependent haem/haemoglobin receptor, HmuA |
*
Shewanella halifaxensis HAW-EB4 Site: position = -144 score = 6.468 sequence = AAATGATAATGATTTTCATTT Gene: Shal_3399: TonB-dependent haem/haemoglobin receptor, HmuA |
*
Shewanella piezotolerans WP3 Site: position = -143 score = 6.468 sequence = AAATGATAATGATTTTCATTT Gene: swp_3978: TonB-dependent haem/haemoglobin receptor, HmuA |
|
*
Shewanella woodyi ATCC 51908 Site: position = -113 score = 6.468 sequence = AAATGATAATGATTTTCATTT Gene: Swoo_4004: TonB-dependent haem/haemoglobin receptor, HmuA |
TonB-dependent haem/haemoglobin receptor, HmuA |
| huvX |
Gene: SO3668: Putative heme iron utilization protein |
Gene: Sputcn32_0967: Putative heme iron utilization protein |
Gene: Sputw3181_3200: Putative heme iron utilization protein |
Gene: Shewana3_3234: Putative heme iron utilization protein |
|
|
Gene: Sbal_0953: Putative heme iron utilization protein |
Gene: Sden_0791: Putative heme iron utilization protein |
|
|
|
Gene: Spea_3326: Putative heme iron utilization protein |
Gene: Shal_3398: Putative heme iron utilization protein |
Gene: swp_3976: Putative heme iron utilization protein |
|
Gene: Swoo_4003: Putative heme iron utilization protein |
Putative heme iron utilization protein |
| SO3667 |
Gene: SO3667: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein |
Gene: Sputcn32_0968: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein |
Gene: Sputw3181_3199: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein |
Gene: Shewana3_3233: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein |
|
|
Gene: Sbal_0954: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein |
Gene: Sden_0792: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein |
|
|
|
Gene: Spea_3325: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein |
Gene: Shal_3397: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein |
Gene: swp_3974: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein |
|
Gene: Swoo_4002: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein |
Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein |
| CRON 47. | |||||||||||||||||
| pubA |
*
Shewanella oneidensis MR-1 Site: position = -208 score = 5.70061 sequence = AGATGAGAACGATTTGCATTT Gene: SO3030: Putrescine monooxygenase, PubA |
*
Shewanella putrefaciens CN-32 Site: position = -219 score = 5.95007 sequence = AAATGATAACGATTTGCATTT Gene: Sputcn32_2411: Putrescine monooxygenase, PubA |
*
Shewanella sp W3-18-1 Site: position = -219 score = 5.95007 sequence = AAATGATAACGATTTGCATTT Gene: Sputw3181_1597: Putrescine monooxygenase, PubA |
*
Shewanella sp ANA-3 Site: position = -224 score = 6.09494 sequence = AAATGAGAATGATTTGCATTT Gene: Shewana3_1510: Putrescine monooxygenase, PubA |
*
Shewanella sp MR-4 Site: position = -222 score = 5.93961 sequence = AAATGAGAATGGTTTGCATTT Gene: Shewmr4_1454: Putrescine monooxygenase, PubA |
*
Shewanella sp MR-7 Site: position = -223 score = 5.93961 sequence = AAATGAGAATGGTTTGCATTT Gene: Shewmr7_1520: Putrescine monooxygenase, PubA |
*
Shewanella baltica OS155 Site: position = -232 score = 6.09494 sequence = AAATGAGAATGATTTGCATTT Gene: Sbal_2708: Putrescine monooxygenase, PubA |
|
|
|
|
|
|
|
|
|
Putrescine monooxygenase, PubA |
| pubB |
Gene: SO3031: N-hydroxyputrescine-succinyl CoA transferase, PubB |
Gene: Sputcn32_2412: N-hydroxyputrescine-succinyl CoA transferase, PubB |
Gene: Sputw3181_1596: N-hydroxyputrescine-succinyl CoA transferase, PubB |
Gene: Shewana3_1509: N-hydroxyputrescine-succinyl CoA transferase, PubB |
Gene: Shewmr4_1453: N-hydroxyputrescine-succinyl CoA transferase, PubB |
Gene: Shewmr7_1519: N-hydroxyputrescine-succinyl CoA transferase, PubB |
Gene: Sbal_2709: N-hydroxyputrescine-succinyl CoA transferase, PubB |
|
|
|
|
|
|
|
|
|
N-hydroxyputrescine-succinyl CoA transferase, PubB |
| pubC |
Gene: SO3032: NTP-dependent putrebactin synthetase, PubC |
Gene: Sputcn32_2413: NTP-dependent putrebactin synthetase, PubC |
Gene: Sputw3181_1595: NTP-dependent putrebactin synthetase, PubC |
Gene: Shewana3_1508: NTP-dependent putrebactin synthetase, PubC |
Gene: Shewmr4_1452: NTP-dependent putrebactin synthetase, PubC |
Gene: Shewmr7_1518: NTP-dependent putrebactin synthetase, PubC |
Gene: Sbal_2710: NTP-dependent putrebactin synthetase, PubC |
|
|
|
|
|
|
|
|
|
NTP-dependent putrebactin synthetase, PubC |
| putA |
Gene: SO3033: TonB-dependent ferric putrebactin siderophore receptor, PutA |
Gene: Sputcn32_2414: TonB-dependent ferric putrebactin siderophore receptor, PutA |
Gene: Sputw3181_1594: TonB-dependent ferric putrebactin siderophore receptor, PutA |
Gene: Shewana3_1507: TonB-dependent ferric putrebactin siderophore receptor, PutA |
Gene: Shewmr4_1451: TonB-dependent ferric putrebactin siderophore receptor, PutA |
Gene: Shewmr7_1517: TonB-dependent ferric putrebactin siderophore receptor, PutA |
Gene: Sbal_2711: TonB-dependent ferric putrebactin siderophore receptor, PutA |
|
|
|
|
|
|
|
|
|
TonB-dependent ferric putrebactin siderophore receptor, PutA |
| putB |
Gene: SO3034: Ferric putrebactin reductase, PutB |
Gene: Sputcn32_2415: Ferric putrebactin reductase, PutB |
Gene: Sputw3181_1593: Ferric putrebactin reductase, PutB |
Gene: Shewana3_1506: Ferric putrebactin reductase, PutB |
Gene: Shewmr4_1450: Ferric putrebactin reductase, PutB |
Gene: Shewmr7_1516: Ferric putrebactin reductase, PutB |
Gene: Sbal_2712: Ferric putrebactin reductase, PutB |
|
|
|
|
|
|
|
|
|
Ferric putrebactin reductase, PutB |
| CRON 48. | |||||||||||||||||
| mtrD |
*
Shewanella oneidensis MR-1 Site: position = -370 score = 5.41545 sequence = TAACGATAATAGTTTTCAATT Gene: SO1782: Periplasmic decaheme cytochrome c, MtrD |
|
|
*
Shewanella sp ANA-3 Site: position = -326 score = 5.41545 sequence = TAACGATAATAGTTTTCAATT Gene: Shewana3_2672: Periplasmic decaheme cytochrome c, MtrD |
*
Shewanella sp MR-4 Site: position = -326 score = 5.41545 sequence = TAACGATAATAGTTTTCAATT Gene: Shewmr4_2506: Periplasmic decaheme cytochrome c, MtrD |
*
Shewanella sp MR-7 Site: position = -326 score = 5.41545 sequence = TAACGATAATAGTTTTCAATT Gene: Shewmr7_2574: Periplasmic decaheme cytochrome c, MtrD |
*
Shewanella baltica OS155 Site: position = -335 score = 5.41545 sequence = TAACGATAATAGTTTTCAATT Gene: Sbal_1593: Periplasmic decaheme cytochrome c, MtrD |
|
|
*
Shewanella amazonensis SB2B Site: position = -297 score = 5.57077 sequence = TAACGATAATAATTTTCAATT Site: position = -150 score = 4.68402 sequence = AAATCAGACTAATTATTAATA Gene: Sama_1213: Periplasmic decaheme cytochrome c, MtrD |
*
Shewanella loihica PV-4 Site: position = -291 score = 5.7261 sequence = AAACGATAATAATTTTCAATT Site: position = -222 score = 5.82512 sequence = AAATGAGAACCATTTTCATTG Gene: Shew_2519: Periplasmic decaheme cytochrome c, MtrD |
*
Shewanella pealeana ATCC 700345 Site: position = -317 score = 5.7261 sequence = AAACGATAATAATTTTCAATT Site: position = -252 score = 5.07715 sequence = AATTAAGAATGGTTACTATTT Gene: Spea_2692: Periplasmic decaheme cytochrome c, MtrD |
*
Shewanella halifaxensis HAW-EB4 Site: position = -336 score = 5.7261 sequence = AAACGATAATAATTTTCAATT Gene: Shal_2778: Periplasmic decaheme cytochrome c, MtrD |
*
Shewanella piezotolerans WP3 Site: position = -339 score = 5.7261 sequence = AAACGATAATAATTTTCAATT Site: position = -239 score = 5.3036 sequence = AAATAGTAATGGTTATTATTT Gene: swp_3272: Periplasmic decaheme cytochrome c, MtrD |
*
Shewanella sediminis HAW-EB3 Site: position = -322 score = 5.56032 sequence = AAACGAGAATAGTTTTCAATT Site: position = -229 score = 4.8816 sequence = AGATGAGAATGATTATCGCTC Site: position = -110 score = 4.78379 sequence = AGATAAAAATGTTACTCATTT Gene: Ssed_1530: Periplasmic decaheme cytochrome c, MtrD |
|
Periplasmic decaheme cytochrome c, MtrD |
| mtrE |
Gene: SO1781: Outer membrane protein, MtrE |
|
|
Gene: Shewana3_2673: Outer membrane protein, MtrE |
Gene: Shewmr4_2507: Outer membrane protein, MtrE |
Gene: Shewmr7_2575: Outer membrane protein, MtrE |
Gene: Sbal_1592: Outer membrane protein, MtrE |
|
|
Gene: Sama_1212: Outer membrane protein, MtrE |
Gene: Shew_2520: Outer membrane protein, MtrE |
Gene: Spea_2693: Outer membrane protein, MtrE |
Gene: Shal_2779: Outer membrane protein, MtrE |
Gene: swp_3273: Outer membrane protein, MtrE |
Gene: Ssed_1529: Outer membrane protein, MtrE |
|
Outer membrane protein, MtrE |
| mtrF |
Gene: SO1780: Surface localized decaheme cytochrome c lipoprotein, MtrF |
|
|
Gene: Shewana3_2674: Surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Shewmr4_2508: Surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Shewmr7_2576: Surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Sbal_1591: Surface localized decaheme cytochrome c lipoprotein, MtrF |
|
|
Gene: Sama_1211: Surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Shew_2521: Surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Spea_2694: Surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Shal_2780: Surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: swp_3274: Surface localized decaheme cytochrome c lipoprotein, MtrF |
Gene: Ssed_1528: Surface localized decaheme cytochrome c lipoprotein, MtrF |
|
Surface localized decaheme cytochrome c lipoprotein, MtrF |
| omcA |
*
Shewanella oneidensis MR-1 Site: position = -64 score = 5.55222 sequence = TAATGAGATTTGTTCTTATTT Gene: SO1779: Surface localized decaheme cytochrome c lipoprotein, OmcA |
|
|
*
Shewanella sp ANA-3 Site: position = -64 score = 5.29992 sequence = TAATGAGATTTATTCTTATTC Gene: Shewana3_2675: Surface localized decaheme cytochrome c lipoprotein, OmcA |
*
Shewanella sp MR-4 Site: position = -64 score = 5.70755 sequence = TAATGAGATTTATTCTTATTT Gene: Shewmr4_2509: Surface localized decaheme cytochrome c lipoprotein, OmcA |
*
Shewanella sp MR-7 Site: position = -64 score = 5.70755 sequence = TAATGAGATTTATTCTTATTT Gene: Shewmr7_2577: Surface localized decaheme cytochrome c lipoprotein, OmcA |
*
Shewanella baltica OS155 Site: position = -64 score = 5.46855 sequence = TAATGAGATTTATTCTTATCT Gene: Sbal_1590: Surface localized decaheme cytochrome c lipoprotein, OmcA |
|
Gene: Sfri_2636: Surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: Sama_1210: Surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: Shew_2522: Surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: Spea_2695: Surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: Shal_2781: Surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: swp_3275: Surface localized decaheme cytochrome c lipoprotein, OmcA |
Gene: Ssed_1527: Surface localized decaheme cytochrome c lipoprotein, OmcA |
|
Surface localized decaheme cytochrome c lipoprotein, OmcA |
| CRON 49. | |||||||||||||||||
| feoA |
*
Shewanella oneidensis MR-1 Site: position = -121 score = 5.41545 sequence = AATTGAAAACTATTATCGTTA Gene: SO1783: Ferrous iron transport protein A |
*
Shewanella putrefaciens CN-32 Site: position = -123 score = 5.41545 sequence = AATTGAAAACTATTATCGTTA Gene: Sputcn32_1480: Ferrous iron transport protein A |
*
Shewanella sp W3-18-1 Site: position = -123 score = 5.41545 sequence = AATTGAAAACTATTATCGTTA Gene: Sputw3181_2621: Ferrous iron transport protein A |
*
Shewanella sp ANA-3 Site: position = -121 score = 5.41545 sequence = AATTGAAAACTATTATCGTTA Gene: Shewana3_2671: Ferrous iron transport protein A |
*
Shewanella sp MR-4 Site: position = -121 score = 5.41545 sequence = AATTGAAAACTATTATCGTTA Gene: Shewmr4_2505: Ferrous iron transport protein A |
*
Shewanella sp MR-7 Site: position = -121 score = 5.41545 sequence = AATTGAAAACTATTATCGTTA Gene: Shewmr7_2573: Ferrous iron transport protein A |
*
Shewanella baltica OS155 Site: position = -121 score = 5.41545 sequence = AATTGAAAACTATTATCGTTA Gene: Sbal_1594: Ferrous iron transport protein A |
*
Shewanella denitrificans OS217 Site: position = -116 score = 5.41545 sequence = AATTGAAAACTATTATCGTTA Gene: Sden_2415: Ferrous iron transport protein A |
*
Shewanella frigidimarina NCIMB 400 Site: position = -111 score = 5.12843 sequence = AACTGAAAACTATTCTCGTTA Gene: Sfri_2617: Ferrous iron transport protein A |
*
Shewanella amazonensis SB2B Site: position = -119 score = 5.57077 sequence = AATTGAAAATTATTATCGTTA Gene: Sama_1214: Ferrous iron transport protein A |
*
Shewanella loihica PV-4 Site: position = -123 score = 5.7261 sequence = AATTGAAAATTATTATCGTTT Site: position = -192 score = 5.82512 sequence = CAATGAAAATGGTTCTCATTT Gene: Shew_2518: Ferrous iron transport protein A |
*
Shewanella pealeana ATCC 700345 Site: position = -126 score = 5.7261 sequence = AATTGAAAATTATTATCGTTT Site: position = -191 score = 5.07715 sequence = AAATAGTAACCATTCTTAATT Gene: Spea_2691: Ferrous iron transport protein A |
*
Shewanella halifaxensis HAW-EB4 Site: position = -126 score = 5.7261 sequence = AATTGAAAATTATTATCGTTT Gene: Shal_2777: Ferrous iron transport protein A |
*
Shewanella piezotolerans WP3 Site: position = -125 score = 5.7261 sequence = AATTGAAAATTATTATCGTTT Site: position = -225 score = 5.3036 sequence = AAATAATAACCATTACTATTT Gene: swp_3271: Ferrous iron transport protein A |
*
Shewanella sediminis HAW-EB3 Site: position = -126 score = 5.56032 sequence = AATTGAAAACTATTCTCGTTT Site: position = -219 score = 4.8816 sequence = GAGCGATAATCATTCTCATCT Gene: Ssed_1531: Ferrous iron transport protein A |
*
Shewanella woodyi ATCC 51908 Site: position = -125 score = 5.57077 sequence = AATTGAAAACTATTATCGTTT Site: position = -218 score = 4.80034 sequence = TAGTGATAATCGTTCTCACAA Gene: Swoo_3123: Ferrous iron transport protein A |
Ferrous iron transport protein A |
| feoB |
Gene: SO1784: Ferrous iron transport protein B |
Gene: Sputcn32_1481: Ferrous iron transport protein B |
Gene: Sputw3181_2620: Ferrous iron transport protein B |
Gene: Shewana3_2670: Ferrous iron transport protein B |
Gene: Shewmr4_2504: Ferrous iron transport protein B |
Gene: Shewmr7_2572: Ferrous iron transport protein B |
Gene: Sbal_1595: Ferrous iron transport protein B |
Gene: Sden_2414: Ferrous iron transport protein B |
Gene: Sfri_2616: Ferrous iron transport protein B |
Gene: Sama_1215: Ferrous iron transport protein B |
Gene: Shew_2517: Ferrous iron transport protein B |
Gene: Spea_2690: Ferrous iron transport protein B |
Gene: Shal_2776: Ferrous iron transport protein B |
Gene: swp_3270: Ferrous iron transport protein B |
Gene: Ssed_1532: Ferrous iron transport protein B |
Gene: Swoo_3122: Ferrous iron transport protein B |
Ferrous iron transport protein B |
| CRON 50. | |||||||||||||||||
| omcA3 |
|
*
Shewanella putrefaciens CN-32 Site: position = -64 score = 5.70755 sequence = TAATGAGATTAATTCTTATTT Gene: Sputcn32_1479: Surface localized undecaheme cytochrome c lipoprotein, UndA |
*
Shewanella sp W3-18-1 Site: position = -64 score = 5.70755 sequence = TAATGAGATTAATTCTTATTT Gene: Sputw3181_2622: Surface localized undecaheme cytochrome c lipoprotein, UndA |
|
|
|
|
|
|
|
|
Gene: Spea_2696: Surface localized undecaheme cytochrome c lipoprotein, UndA |
Gene: Shal_2782: Surface localized undecaheme cytochrome c lipoprotein, UndA |
|
|
|
Surface localized undecaheme cytochrome c lipoprotein, UndA |
| CRON 51. | |||||||||||||||||
| SO1482 |
*
Shewanella oneidensis MR-1 Site: position = -49 score = 4.96337 sequence = GGATGGAAATCATTATCATTC Gene: SO1482: TonB-dependent receptor |
*
Shewanella putrefaciens CN-32 Site: position = -49 score = 4.65521 sequence = AAATACAAATCATTACTATTC Gene: Sputcn32_1237: TonB-dependent receptor |
*
Shewanella sp W3-18-1 Site: position = -49 score = 4.65521 sequence = AAATACAAATCATTACTATTC Gene: Sputw3181_2867: TonB-dependent receptor |
*
Shewanella sp ANA-3 Site: position = -48 score = 5.82138 sequence = AGATGAAAATCATTATCATTC Gene: Shewana3_2944: TonB-dependent receptor |
*
Shewanella sp MR-4 Site: position = -48 score = 5.82138 sequence = AGATGAAAATCATTATCATTC Gene: Shewmr4_2768: TonB-dependent receptor |
*
Shewanella sp MR-7 Site: position = -48 score = 5.82138 sequence = AGATGAAAATCATTATCATTC Gene: Shewmr7_2846: TonB-dependent receptor |
*
Shewanella baltica OS155 Site: position = -49 score = 4.9513 sequence = AAATGCAAATCATTACTATTC Gene: Sbal_1315: TonB-dependent receptor |
*
Shewanella denitrificans OS217 Site: position = -48 score = 5.2382 sequence = CTATGATAATCATTATCATTC Gene: Sden_1445: TonB-dependent receptor |
*
Shewanella frigidimarina NCIMB 400 Site: position = -52 score = 5.55998 sequence = TTATGATAATCATTATCATTC Gene: Sfri_2440: TonB-dependent receptor |
|
*
Shewanella loihica PV-4 Site: position = -51 score = 5.97483 sequence = TATTGATAATCGTTATCATTT Gene: Shew_2690: TonB-dependent receptor |
*
Shewanella pealeana ATCC 700345 Site: position = -51 score = 5.95182 sequence = TAATGATAATCGTTATCATCT Gene: Spea_2930: TonB-dependent receptor |
*
Shewanella halifaxensis HAW-EB4 Site: position = -51 score = 5.64528 sequence = TAATAAGAATCGTTATCATCT Gene: Shal_3021: TonB-dependent receptor |
*
Shewanella piezotolerans WP3 Site: position = -51 score = 5.7965 sequence = TAATGATAATGGTTATCATCA Gene: swp_3568: TonB-dependent receptor |
*
Shewanella sediminis HAW-EB3 Site: position = -49 score = 5.54244 sequence = AAATGCAAATCGTTATCATTC Gene: Ssed_3242: TonB-dependent receptor |
*
Shewanella woodyi ATCC 51908 Site: position = -51 score = 5.95182 sequence = TAATGATAATCGTTATCATCT Gene: Swoo_3375: TonB-dependent receptor |
TonB-dependent receptor |
| CRON 52. | |||||||||||||||||
| bfd |
*
Shewanella oneidensis MR-1 Site: position = -55 score = 5.31052 sequence = ATTTGATAAGCGTTTTCATTT Gene: SO0583: Bacterioferritin-associated ferredoxin |
*
Shewanella putrefaciens CN-32 Site: position = -54 score = 5.31052 sequence = ATTTGATAAGCGTTTTCATTT Gene: Sputcn32_3295: Bacterioferritin-associated ferredoxin |
*
Shewanella sp W3-18-1 Site: position = -54 score = 5.31052 sequence = ATTTGATAAGCGTTTTCATTT Gene: Sputw3181_0646: Bacterioferritin-associated ferredoxin |
*
Shewanella sp ANA-3 Site: position = -54 score = 5.31052 sequence = ATTTGATAAGCGTTTTCATTT Gene: Shewana3_0581: Bacterioferritin-associated ferredoxin |
*
Shewanella sp MR-4 Site: position = -54 score = 5.31052 sequence = ATTTGATAAGCGTTTTCATTT Gene: Shewmr4_0582: Bacterioferritin-associated ferredoxin |
*
Shewanella sp MR-7 Site: position = -54 score = 5.31052 sequence = ATTTGATAAGCGTTTTCATTT Gene: Shewmr7_3448: Bacterioferritin-associated ferredoxin |
*
Shewanella baltica OS155 Site: position = -53 score = 5.31052 sequence = ATTTGATAAGCGTTTTCATTT Gene: Sbal_0542: Bacterioferritin-associated ferredoxin |
*
Shewanella denitrificans OS217 Site: position = -99 score = 5.68025 sequence = CAATGATAACCGTTTTCATTT Gene: Sden_3217: Bacterioferritin-associated ferredoxin |
*
Shewanella frigidimarina NCIMB 400 Site: position = -76 score = 5.68025 sequence = CAATGATAACCGTTTTCATTT Gene: Sfri_3324: Bacterioferritin-associated ferredoxin |
*
Shewanella amazonensis SB2B Site: position = -59 score = 5.45649 sequence = TGATGAGAACGGTTTTTATTT Gene: Sama_3040: Bacterioferritin-associated ferredoxin |
*
Shewanella loihica PV-4 Site: position = -57 score = 5.40204 sequence = CAGTGAGAATCGTTTTCATTT Gene: Shew_0552: Bacterioferritin-associated ferredoxin |
*
Shewanella pealeana ATCC 700345 Site: position = -58 score = 5.76445 sequence = CATTGAGAATCATTTTCATTT Gene: Spea_3555: Bacterioferritin-associated ferredoxin |
*
Shewanella halifaxensis HAW-EB4 Site: position = -58 score = 5.48788 sequence = CACTGAGAATCATTTTCATTT Gene: Shal_3649: Bacterioferritin-associated ferredoxin |
*
Shewanella piezotolerans WP3 Site: position = -57 score = 5.60913 sequence = CATTGAGAATCGTTTTCATTT Site: position = -86 score = 5.33155 sequence = GATTGATAACTATTCTCATCA Gene: swp_0771: Bacterioferritin-associated ferredoxin |
*
Shewanella sediminis HAW-EB3 Site: position = -54 score = 5.76445 sequence = CATTGAGAATCATTTTCATTT Gene: Ssed_0782: Bacterioferritin-associated ferredoxin |
*
Shewanella woodyi ATCC 51908 Site: position = -56 score = 5.60913 sequence = CATTGAGAATCGTTTTCATTT Gene: Swoo_4187: Bacterioferritin-associated ferredoxin |
Bacterioferritin-associated ferredoxin |
| CRON 53. | |||||||||||||||||
| fbpA |
*
Shewanella oneidensis MR-1 Site: position = -76 score = 5.71206 sequence = AACTGATAACTATTATCATTA Gene: SO0744: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
*
Shewanella putrefaciens CN-32 Site: position = -74 score = 5.78154 sequence = AAGTGATAACTATTATCATTA Gene: Sputcn32_3227: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
*
Shewanella sp W3-18-1 Site: position = -74 score = 5.78154 sequence = AAGTGATAACTATTATCATTA Gene: Sputw3181_0714: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
*
Shewanella sp ANA-3 Site: position = -76 score = 5.71206 sequence = AACTGATAACTATTATCATTA Gene: Shewana3_3517: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
*
Shewanella sp MR-4 Site: position = -76 score = 5.71206 sequence = AACTGATAACTATTATCATTA Gene: Shewmr4_3347: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
*
Shewanella sp MR-7 Site: position = -76 score = 5.71206 sequence = AACTGATAACTATTATCATTA Gene: Shewmr7_0606: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
*2
Shewanella baltica OS155 Site: position = -76 score = 5.44596 sequence = AACTGATAAGCATTATCATTA Gene: Sbal_0812: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Gene: Sbal_0601: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -67 score = 5.91417 sequence = AATTGATAACCATTATCAATT Gene: Sfri_0636: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
*
Shewanella amazonensis SB2B Site: position = -57 score = 5.78154 sequence = TAGTGATAATAATTATCATTA Gene: Sama_0666: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
*
Shewanella loihica PV-4 Site: position = -41 score = 6.14395 sequence = AATTGATAATTATTATCATTA Gene: Shew_0861: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
*
Shewanella pealeana ATCC 700345 Site: position = -60 score = 5.79626 sequence = AATTGAGAATTATTATCAGTT Gene: Spea_0844: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
*
Shewanella halifaxensis HAW-EB4 Site: position = -64 score = 5.38864 sequence = AATTGAGAATTATTATCAGTC Gene: Shal_0897: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
*
Shewanella piezotolerans WP3 Site: position = -60 score = 5.24661 sequence = AATTGAGAACTATTATCAGCA Gene: swp_4107: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
*
Shewanella sediminis HAW-EB3 Site: position = -58 score = 5.73633 sequence = GATTGATAATAATTATCATTA Gene: Ssed_0945: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
*
Shewanella woodyi ATCC 51908 Site: position = -57 score = 5.42784 sequence = AATTGATAACTATTATCATCG Gene: Swoo_0996: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA |
| fbpB |
Gene: SO0743: ABC iron(III) transporter, inner membrane subunit, FbpB |
Gene: Sputcn32_3226: ABC iron(III) transporter, inner membrane subunit, FbpB |
Gene: Sputw3181_0715: ABC iron(III) transporter, inner membrane subunit, FbpB |
Gene: Shewana3_3516: ABC iron(III) transporter, inner membrane subunit, FbpB |
Gene: Shewmr4_3346: ABC iron(III) transporter, inner membrane subunit, FbpB |
Gene: Shewmr7_0607: ABC iron(III) transporter, inner membrane subunit, FbpB |
Gene: Sbal_0602: ABC iron(III) transporter, inner membrane subunit, FbpB |
|
Gene: Sfri_0637: ABC iron(III) transporter, inner membrane subunit, FbpB |
Gene: Sama_0667: ABC iron(III) transporter, inner membrane subunit, FbpB |
Gene: Shew_0862: ABC iron(III) transporter, inner membrane subunit, FbpB |
Gene: Spea_0845: ABC iron(III) transporter, inner membrane subunit, FbpB |
Gene: Shal_0898: ABC iron(III) transporter, inner membrane subunit, FbpB |
Gene: swp_4106: ABC iron(III) transporter, inner membrane subunit, FbpB |
*
Shewanella sediminis HAW-EB3 Site: position = -154 score = 5.27608 sequence = GAATTATAATCATTCTTATTT Gene: Ssed_0946: ABC iron(III) transporter, inner membrane subunit, FbpB |
*
Shewanella woodyi ATCC 51908 Site: position = -79 score = 5.50451 sequence = AATTAATAATCGTTTTTATTT Gene: Swoo_0997: ABC iron(III) transporter, inner membrane subunit, FbpB |
ABC iron(III) transporter, inner membrane subunit, FbpB |
| fbpC |
Gene: SO0742: ABC iron(III) transporter, ATPase subunit, FbpC |
Gene: Sputcn32_3225: ABC iron(III) transporter, ATPase subunit, FbpC |
Gene: Sputw3181_0716: ABC iron(III) transporter, ATPase subunit, FbpC |
Gene: Shewana3_3515: ABC iron(III) transporter, ATPase subunit, FbpC |
Gene: Shewmr4_3345: ABC iron(III) transporter, ATPase subunit, FbpC |
Gene: Shewmr7_0608: ABC iron(III) transporter, ATPase subunit, FbpC |
Gene: Sbal_0603: ABC iron(III) transporter, ATPase subunit, FbpC |
|
Gene: Sfri_0638: ABC iron(III) transporter, ATPase subunit, FbpC |
Gene: Sama_0668: ABC iron(III) transporter, ATPase subunit, FbpC |
Gene: Shew_0863: ABC iron(III) transporter, ATPase subunit, FbpC |
Gene: Spea_0846: ABC iron(III) transporter, ATPase subunit, FbpC |
Gene: Shal_0899: ABC iron(III) transporter, ATPase subunit, FbpC |
Gene: swp_4105: ABC iron(III) transporter, ATPase subunit, FbpC |
Gene: Ssed_0947: ABC iron(III) transporter, ATPase subunit, FbpC |
Gene: Swoo_0998: ABC iron(III) transporter, ATPase subunit, FbpC |
ABC iron(III) transporter, ATPase subunit, FbpC |
| CRON 54. | |||||||||||||||||
| bfr2 |
*
Shewanella oneidensis MR-1 Site: position = -125 score = 5.22805 sequence = TAATGAGAATGCTTTTAATTA Gene: SO1111: Bacterioferritin subunit 2 |
*
Shewanella putrefaciens CN-32 Site: position = -126 score = 5.47227 sequence = AAATGAGAATGGTTTTTATAA Gene: Sputcn32_0948: Bacterioferritin subunit 2 |
*
Shewanella sp W3-18-1 Site: position = -126 score = 5.47227 sequence = AAATGAGAATGGTTTTTATAA Gene: Sputw3181_3228: Bacterioferritin subunit 2 |
*
Shewanella sp ANA-3 Site: position = -125 score = 5.35951 sequence = TAATGAGAATGCTTTTTATCT Gene: Shewana3_0946: Bacterioferritin subunit 2 |
*
Shewanella sp MR-4 Site: position = -124 score = 5.35951 sequence = TAATGAGAATGCTTTTTATCT Gene: Shewmr4_0944: Bacterioferritin subunit 2 |
*
Shewanella sp MR-7 Site: position = -125 score = 5.35951 sequence = TAATGAGAATGCTTTTTATCT Gene: Shewmr7_0982: Bacterioferritin subunit 2 |
*
Shewanella baltica OS155 Site: position = -126 score = 5.34674 sequence = AAATGAGAATGGTTGTTATCA Gene: Sbal_0932: Bacterioferritin subunit 2 |
*
Shewanella denitrificans OS217 Site: position = -120 score = 5.61242 sequence = TAATGATAATGGTTATCACTA Gene: Sden_0990: Bacterioferritin subunit 2 |
*
Shewanella frigidimarina NCIMB 400 Site: position = -121 score = 5.98863 sequence = TAATGATAATAGTTATCAATT Gene: Sfri_0957: Bacterioferritin subunit 2 |
*
Shewanella amazonensis SB2B Site: position = -122 score = 4.71115 sequence = CAATAAGAATAATTAGCCTTT Gene: Sama_2530: Bacterioferritin subunit 2 |
*
Shewanella loihica PV-4 Site: position = -115 score = 4.75964 sequence = GAATGAGAACGATTTTCTTTG Gene: Shew_2873: Bacterioferritin subunit 2 |
*
Shewanella pealeana ATCC 700345 Site: position = -116 score = 5.36719 sequence = TAATGAGAATGGTTATCTTTA Gene: Spea_3095: Bacterioferritin subunit 2 |
*
Shewanella halifaxensis HAW-EB4 Site: position = -121 score = 4.34769 sequence = TAGTGATAATGAAAATCACTA Site: position = -88 score = 4.26603 sequence = TGTTGATATTTAACCTTATTT Gene: Shal_3179: Bacterioferritin subunit 2 |
*
Shewanella piezotolerans WP3 Site: position = -118 score = 5.54676 sequence = TAATGATAATAATTATCTTTA Gene: swp_1175: Bacterioferritin subunit 2 |
*
Shewanella sediminis HAW-EB3 Site: position = -137 score = 4.64906 sequence = TAATGGGAATGATTATCTCTA Gene: Ssed_2230: Bacterioferritin subunit 2 |
*
Shewanella woodyi ATCC 51908 Site: position = -167 score = 4.46472 sequence = AAATGATAATGCTTAATGTTA Gene: Swoo_3608: Bacterioferritin subunit 2 |
Bacterioferritin subunit 2 |
| bfr1 |
Gene: SO1112: Bacterioferritin subunit 1 |
Gene: Sputcn32_0949: Bacterioferritin subunit 1 |
Gene: Sputw3181_3227: Bacterioferritin subunit 1 |
Gene: Shewana3_0947: Bacterioferritin subunit 1 |
Gene: Shewmr4_0945: Bacterioferritin subunit 1 |
Gene: Shewmr7_0983: Bacterioferritin subunit 1 |
Gene: Sbal_0933: Bacterioferritin subunit 1 |
Gene: Sden_0991: Bacterioferritin subunit 1 |
Gene: Sfri_0958: Bacterioferritin subunit 1 |
Gene: Sama_2529: Bacterioferritin subunit 1 |
Gene: Shew_2872: Bacterioferritin subunit 1 |
Gene: Spea_3094: Bacterioferritin subunit 1 |
Gene: Shal_3178: Bacterioferritin subunit 1 |
Gene: swp_1176: Bacterioferritin subunit 1 |
Gene: Ssed_2231: Bacterioferritin subunit 1 |
Gene: Swoo_3607: Bacterioferritin subunit 1 |
Bacterioferritin subunit 1 |
| CRON 55. | |||||||||||||||||
| Swoo_1070 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -49 score = 6.16941 sequence = AAATGATATTAATTCTCATTT Gene: Swoo_1070: Hypothetical protein |
Hypothetical protein |
| CRON 56. | |||||||||||||||||
| SO2426 |
*
Shewanella oneidensis MR-1 Site: position = -2 score = 5.61591 sequence = AAATGATATTGATTCTCGTTT Gene: SO2426: Two component transcriptional regulator, Winged helix family |
*
Shewanella putrefaciens CN-32 Site: position = -2 score = 5.46058 sequence = AAATGATATCGATTCTCGTTT Gene: Sputcn32_1941: Two component transcriptional regulator, Winged helix family |
*
Shewanella sp W3-18-1 Site: position = -2 score = 5.46058 sequence = AAATGATATCGATTCTCGTTT Gene: Sputw3181_2064: Two component transcriptional regulator, Winged helix family |
*
Shewanella sp ANA-3 Site: position = -32 score = 5.61591 sequence = AAATGATATTGATTCTCGTTT Gene: Shewana3_1959: Two component transcriptional regulator, Winged helix family |
*
Shewanella sp MR-4 Site: position = -32 score = 5.61591 sequence = AAATGATATTGATTCTCGTTT Gene: Shewmr4_1904: Two component transcriptional regulator, Winged helix family |
*
Shewanella sp MR-7 Site: position = -32 score = 5.61591 sequence = AAATGATATTGATTCTCGTTT Gene: Shewmr7_2074: Two component transcriptional regulator, Winged helix family |
*
Shewanella baltica OS155 Site: position = -32 score = 5.1388 sequence = AAATGATATAGATTCTCGTTT Gene: Sbal_2050: Two component transcriptional regulator, Winged helix family |
*
Shewanella denitrificans OS217 Site: position = 10 score = 5.61765 sequence = TAATGAAAATGGTTATCGTTT Gene: Sden_1906: Two component transcriptional regulator, Winged helix family |
*
Shewanella frigidimarina NCIMB 400 Site: position = -32 score = 5.58512 sequence = TAATGGTAATCGTTATCATTA Gene: Sfri_2150: Two component transcriptional regulator, Winged helix family |
*
Shewanella amazonensis SB2B Site: position = -32 score = 4.8155 sequence = GAATAACAACCGTTCGCATTT Gene: Sama_1718: Two component transcriptional regulator, Winged helix family |
*
Shewanella loihica PV-4 Site: position = -31 score = 6.0493 sequence = TAATGATAACTATTATCATTA Gene: Shew_1936: Two component transcriptional regulator, Winged helix family |
*
Shewanella pealeana ATCC 700345 Site: position = -34 score = 5.31772 sequence = TAATGCGAATTATTCGTATTT Gene: Spea_2236: Two component transcriptional regulator, Winged helix family |
*
Shewanella halifaxensis HAW-EB4 Site: position = -34 score = 5.61783 sequence = AAATGAAAATGATTCGCATTG Gene: Shal_2220: Two component transcriptional regulator, Winged helix family |
*
Shewanella piezotolerans WP3 Site: position = -9 score = 5.50977 sequence = CAATGATAATTGTTCGCATTT Gene: swp_2595: Two component transcriptional regulator, Winged helix family |
*
Shewanella sediminis HAW-EB3 Site: position = -34 score = 5.53547 sequence = AAATGATAACAGTTCGTATTT Gene: Ssed_2316: Two component transcriptional regulator, Winged helix family |
*
Shewanella woodyi ATCC 51908 Site: position = -36 score = 5.37656 sequence = TGTTGATAATTGTTCGCATTT Gene: Swoo_2294: Two component transcriptional regulator, Winged helix family |
Two component transcriptional regulator, Winged helix family |
| CRON 57. | |||||||||||||||||
| SO4743 |
*
Shewanella oneidensis MR-1 Site: position = -116 score = 5.72385 sequence = AAATAAAAACAATTCTTATTT Gene: SO4743: TonB-dependent siderophore receptor |
*
Shewanella putrefaciens CN-32 Site: position = -68 score = 5.61231 sequence = AAATAAAAACACTTCTCATTT Gene: Sputcn32_3953: TonB-dependent siderophore receptor |
*
Shewanella sp W3-18-1 Site: position = -68 score = 5.61231 sequence = AAATAAAAACACTTCTCATTT Gene: Sputw3181_4050: TonB-dependent siderophore receptor |
*
Shewanella sp ANA-3 Site: position = -68 score = 5.72385 sequence = AAATAAAAACAATTCTTATTT Gene: Shewana3_4127: TonB-dependent siderophore receptor |
*
Shewanella sp MR-4 Site: position = -68 score = 5.72385 sequence = AAATAAAAACAATTCTTATTT Gene: Shewmr4_3922: TonB-dependent siderophore receptor |
*
Shewanella sp MR-7 Site: position = -68 score = 5.72385 sequence = AAATAAAAACAATTCTTATTT Gene: Shewmr7_4014: TonB-dependent siderophore receptor |
*
Shewanella baltica OS155 Site: position = -68 score = 5.61231 sequence = AAATAAAAACACTTCTCATTT Gene: Sbal_4363: TonB-dependent siderophore receptor |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -68 score = 5.44423 sequence = AAATGGAAACGCTTCTCATTT Gene: Sfri_4042: TonB-dependent siderophore receptor |
*
Shewanella amazonensis SB2B Site: position = -73 score = 5.92287 sequence = AAATGCTAATCATTATCAATT Gene: Sama_3641: TonB-dependent siderophore receptor |
*
Shewanella loihica PV-4 Site: position = -69 score = 6.01994 sequence = AAATAAAAACAATTCTCATTT Gene: Shew_3841: TonB-dependent siderophore receptor |
*
Shewanella pealeana ATCC 700345 Site: position = -69 score = 6.01994 sequence = AAATAAAAATAGTTCTCATTT Gene: Spea_4236: TonB-dependent siderophore receptor |
*
Shewanella halifaxensis HAW-EB4 Site: position = -68 score = 6.01994 sequence = AAATAAAAATAGTTCTCATTT Gene: Shal_4287: TonB-dependent siderophore receptor |
*
Shewanella piezotolerans WP3 Site: position = -68 score = 5.61231 sequence = GAATAAAAACAATTCTCATTT Gene: swp_5150: TonB-dependent siderophore receptor |
*
Shewanella sediminis HAW-EB3 Site: position = -66 score = 6.00614 sequence = AAATAAAAACGATTCTCATTT Gene: Ssed_4483: TonB-dependent siderophore receptor |
*
Shewanella woodyi ATCC 51908 Site: position = -67 score = 6.17526 sequence = AAATAAAAATAATTCTCATTT Gene: Swoo_4894: TonB-dependent siderophore receptor |
TonB-dependent siderophore receptor |
| CRON 58. | |||||||||||||||||
| swp_3303 |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -155 score = 5.18069 sequence = TATTGATAGCAATTCTCATTA Gene: swp_3303: TonB-dependent siderophore receptor |
|
|
TonB-dependent siderophore receptor |
| CRON 59. | |||||||||||||||||
| Sden_0590 |
|
|
|
|
|
|
|
*
Shewanella denitrificans OS217 Site: position = -63 score = 4.96211 sequence = TAATGAAAATCATTACCAGTC Site: position = -69 score = 5.34918 sequence = AAATGATAATGAAAATCATTA Gene: Sden_0590: Putative siderophore biosynthesis protein, related to cysteine synthase |
|
|
|
|
|
|
|
|
Putative siderophore biosynthesis protein, related to cysteine synthase |
| Sden_0589 |
|
|
|
|
|
|
|
Gene: Sden_0589: Putative siderophore biosynthesis protein, Ornithine cyclodeaminase (EC 4.3.1.12) |
|
|
|
|
|
|
|
|
Putative siderophore biosynthesis protein, Ornithine cyclodeaminase (EC 4.3.1.12) |
| pvsB |
|
|
|
|
|
|
|
Gene: Sden_0588: Vibrioferrin amide bond forming protein PvsB |
|
|
|
|
|
Gene: swp_0086: Vibrioferrin amide bond forming protein PvsB |
|
|
Vibrioferrin amide bond forming protein PvsB |
| Sden_0587 |
|
|
|
|
|
|
|
Gene: Sden_0587: Putative efflux transmembrane protein in siderophore biosynthesys operon |
|
|
|
|
|
|
|
|
Putative efflux transmembrane protein in siderophore biosynthesys operon |
| Sden_0586 |
|
|
|
|
|
|
|
Gene: Sden_0586: Siderophore synthetase superfamily, group A / Siderophore synthetase superfamily, group C |
|
|
|
|
|
|
|
|
Siderophore synthetase superfamily, group A / Siderophore synthetase superfamily, group C |
| Sden_0585 |
|
|
|
|
|
|
|
Gene: Sden_0585: Putative siderophore biosynthesis protein, HpcH/HpaI aldolase family |
|
|
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -206 score = 5.55366 sequence = AAATGATAATTATTACGATTT Site: position = -46 score = 5.04171 sequence = AAATGAGAACAATTGGCATCC Gene: swp_0084: Putative siderophore biosynthesis protein, HpcH/HpaI aldolase family |
|
|
Putative siderophore biosynthesis protein, HpcH/HpaI aldolase family |
| pvsE |
|
|
|
|
|
|
|
Gene: Sden_0584: Vibrioferrin biosynthesis protein, PvsE |
|
|
|
|
|
Gene: swp_0089: Vibrioferrin biosynthesis protein, PvsE |
|
|
Vibrioferrin biosynthesis protein, PvsE |
| Sden_0583 |
|
|
|
|
|
|
|
Gene: Sden_0583: ParB-like nuclease |
|
|
|
|
|
|
|
|
ParB-like nuclease |
| Sden_0582 |
|
|
|
|
|
|
|
Gene: Sden_0582: Outer membrane receptor proteins, likely involved in siderophore uptake |
|
|
|
|
|
|
|
|
Outer membrane receptor proteins, likely involved in siderophore uptake |
| pvsA |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -111 score = 5.55366 sequence = AAATCGTAATAATTATCATTT Site: position = -271 score = 5.04171 sequence = GGATGCCAATTGTTCTCATTT Gene: swp_0085: Vibrioferrin ligase/carboxylase protein PvsA |
|
|
Vibrioferrin ligase/carboxylase protein PvsA |
| pvsC |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: swp_0087: Vibrioferrin membrane-spanning transport protein PvsC |
|
|
Vibrioferrin membrane-spanning transport protein PvsC |
| pvsD |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: swp_0088: Vibrioferrin biosynthesis protein, PvsD |
|
|
Vibrioferrin biosynthesis protein, PvsD |
| Sfri_3851 |
|
|
|
|
|
|
|
*
Shewanella denitrificans OS217 Site: position = -101 score = 5.29185 sequence = AAACGCTAACAATTCTCATTA Gene: Sden_0609: TonB-dependent siderophore receptor |
*
Shewanella frigidimarina NCIMB 400 Site: position = -309 score = 5.75496 sequence = AAATGAGAATAATTATCAAAA Gene: Sfri_3851: TonB-dependent siderophore receptor |
|
|
|
|
Gene: swp_0083: TonB-dependent siderophore receptor |
|
|
TonB-dependent siderophore receptor |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |