Regulon of Fur in Shewanella sp MR-7

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr7_1716
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	58
- Operons	35
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 5.6 Sequence: GACTGATAATAATTTTCATTT Locus tag: Shewmr7_2517 Name: null Funciton: Hypothetical protein
	Shewmr7_2517		Hypothetical protein
Position: -32 Score: 5.6 Sequence: AAATGATATTGATTCTCGTTT Locus tag: Shewmr7_2074 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	Shewmr7_2074		Two component transcriptional regulator, Winged helix family
Position: -65 Score: 5.5 Sequence: TATTGATAACAATTCGCATTA Locus tag: Shewmr7_1899 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein Locus tag: Shewmr7_1900 Name: Sfri_2547 Funciton: Conserved hypothetical protein
	Shewmr7_1899	COG3182	PepSY-associated TM helix domain-containing protein
	Shewmr7_1900	Sfri_2547	Conserved hypothetical protein
Position: -98 Score: 5.5 Sequence: CAATAAAAATCGTTATCATTT Locus tag: Shewmr7_3733 Name: SO4423.1 Funciton: TonB-dependent ferric achromobactin receptor
	Shewmr7_3733	SO4423.1	TonB-dependent ferric achromobactin receptor
Position: -62 Score: 6.2 Sequence: AAATAATAATTATTCTCATTT Locus tag: Shewmr7_0635 Name: null Funciton: TonB-dependent outer membrane receptor Locus tag: Shewmr7_0634 Name: null Funciton: Periplasmic thioredoxin-family protein
	Shewmr7_0635		TonB-dependent outer membrane receptor
	Shewmr7_0634		Periplasmic thioredoxin-family protein
Position: -121 Score: 5.4 Sequence: AATTGAAAACTATTATCGTTA Locus tag: Shewmr7_2573 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Shewmr7_2572 Name: feoB Funciton: Ferrous iron transport protein B
	Shewmr7_2573	feoA	Ferrous iron transport protein A
	Shewmr7_2572	feoB	Ferrous iron transport protein B
Position: -223 Score: 5.9 Sequence: AAATGAGAATGGTTTGCATTT Locus tag: Shewmr7_1520 Name: pubA Funciton: Putrescine monooxygenase, PubA Locus tag: Shewmr7_1519 Name: pubB Funciton: N-hydroxyputrescine-succinyl CoA transferase, PubB Locus tag: Shewmr7_1518 Name: pubC Funciton: NTP-dependent putrebactin synthetase, PubC Locus tag: Shewmr7_1517 Name: putA Funciton: TonB-dependent ferric putrebactin siderophore receptor, PutA Locus tag: Shewmr7_1516 Name: putB Funciton: Ferric putrebactin reductase, PutB
	Shewmr7_1520	pubA	Putrescine monooxygenase, PubA
	Shewmr7_1519	pubB	N-hydroxyputrescine-succinyl CoA transferase, PubB
	Shewmr7_1518	pubC	NTP-dependent putrebactin synthetase, PubC
	Shewmr7_1517	putA	TonB-dependent ferric putrebactin siderophore receptor, PutA
	Shewmr7_1516	putB	Ferric putrebactin reductase, PutB
Position: -125 Score: 5.4 Sequence: TAATGAGAATGCTTTTTATCT Locus tag: Shewmr7_0982 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: Shewmr7_0983 Name: bfr1 Funciton: Bacterioferritin subunit 1
	Shewmr7_0982	bfr2	Bacterioferritin subunit 2
	Shewmr7_0983	bfr1	Bacterioferritin subunit 1
Position: -68 Score: 5.7 Sequence: AAATAAAAACAATTCTTATTT Locus tag: Shewmr7_4014 Name: null Funciton: TonB-dependent siderophore receptor
	Shewmr7_4014		TonB-dependent siderophore receptor
Position: -59 Score: 5.7 Sequence: TGTTGATAACTATTCTCATTT Locus tag: Shewmr7_1972 Name: Sfri_2008 Funciton: Hypothetical protein
	Shewmr7_1972	Sfri_2008	Hypothetical protein
Position: -106 Score: 4.8 Sequence: AAATGATAATAATAATTGATT Locus tag: Shewmr7_0697 Name: null Funciton: TonB-dependent siderophore receptor Locus tag: Shewmr7_0698 Name: piuC Funciton: Iron-uptake factor PiuC
	Shewmr7_0697		TonB-dependent siderophore receptor
	Shewmr7_0698	piuC	Iron-uptake factor PiuC
Position: -54 Score: 5.3 Sequence: ATTTGATAAGCGTTTTCATTT Locus tag: Shewmr7_3448 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	Shewmr7_3448	bfd	Bacterioferritin-associated ferredoxin
Position: -48 Score: 5.8 Sequence: AGATGAAAATCATTATCATTC Locus tag: Shewmr7_2846 Name: null Funciton: TonB-dependent receptor
	Shewmr7_2846		TonB-dependent receptor
Position: -31 Score: 4.9 Sequence: GATTGAAAATGATTTTCACTG Locus tag: Shewmr7_2608 Name: null Funciton: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
	Shewmr7_2608		Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
Position: -62 Score: 5 Sequence: TAACGAGAATAATTCTTGTTT Locus tag: Shewmr7_3399 Name: Sama_0590 Funciton: TonB-dependent receptor
	Shewmr7_3399	Sama_0590	TonB-dependent receptor
Position: -66 Score: 5.8 Sequence: AGTTGAGAATTATTCTCATCT Locus tag: Shewmr7_1497 Name: null Funciton: Hypothetical inner membrane protein
	Shewmr7_1497		Hypothetical inner membrane protein
Position: -145 Score: 5.7 Sequence: AAATGATAATTATTTACATTA Locus tag: Shewmr7_3500 Name: null Funciton: TonB-dependent siderophore receptor
	Shewmr7_3500		TonB-dependent siderophore receptor
Position: -192 Score: 5.1 Sequence: AATTAAGAACGATTCTCGATT Locus tag: Shewmr7_3720 Name: Shewmr4_0304 Funciton: TonB-dependent siderophore receptor
	Shewmr7_3720	Shewmr4_0304	TonB-dependent siderophore receptor
Position: -132 Score: 5.4 Sequence: AAATGCAAATCATTTTTATCA Locus tag: Shewmr7_0127 Name: ftn Funciton: Ferritin, Ftn
	Shewmr7_0127	ftn	Ferritin, Ftn
Position: -98 Score: 5.5 Sequence: AAATGAGAATTATTGTCACCT Locus tag: Shewmr7_2458 Name: null Funciton: TonB-dependent siderophore receptor
	Shewmr7_2458		TonB-dependent siderophore receptor
Position: -57 Score: 5.6 Sequence: AAATGCAAATCGTTCTCAATA Locus tag: Shewmr7_0988 Name: null Funciton: TonB-dependent siderophore receptor
	Shewmr7_0988		TonB-dependent siderophore receptor
Position: -64 Score: 5.7 Sequence: TAATGAGATTTATTCTTATTT Locus tag: Shewmr7_2577 Name: omcA Funciton: Surface localized decaheme cytochrome c lipoprotein, OmcA
	Shewmr7_2577	omcA	Surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -326 Score: 5.4 Sequence: TAACGATAATAGTTTTCAATT Locus tag: Shewmr7_2574 Name: mtrD Funciton: Periplasmic decaheme cytochrome c, MtrD Locus tag: Shewmr7_2575 Name: mtrE Funciton: Outer membrane protein, MtrE Locus tag: Shewmr7_2576 Name: mtrF Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrF
	Shewmr7_2574	mtrD	Periplasmic decaheme cytochrome c, MtrD
	Shewmr7_2575	mtrE	Outer membrane protein, MtrE
	Shewmr7_2576	mtrF	Surface localized decaheme cytochrome c lipoprotein, MtrF
Position: -60 Score: 6 Sequence: TAATGAGAATTGTTATCATCT Locus tag: Shewmr7_4011 Name: null Funciton: Conserved hypothetical inner membrane protein
	Shewmr7_4011		Conserved hypothetical inner membrane protein
Position: -155 Score: 4.8 Sequence: TATTGCGAACTATTCTCACCA Locus tag: Shewmr7_3580 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Shewmr7_3579 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Shewmr7_3578 Name: null Funciton: Iron-regulated membrane protein
	Shewmr7_3580		Iron-regulated inner membrane protein
	Shewmr7_3579		Iron-regulated inner membrane protein
	Shewmr7_3578		Iron-regulated membrane protein
Position: -181 Score: 5.6 Sequence: TGTTGATAATAAATATCATTT Locus tag: Shewmr7_1075 Name: null Funciton: Inner membrane protein with PepSY TM helix Locus tag: Shewmr7_1076 Name: null Funciton: Putative exported protein Locus tag: Shewmr7_1077 Name: null Funciton: putative exported protein
	Shewmr7_1075		Inner membrane protein with PepSY TM helix
	Shewmr7_1076		Putative exported protein
	Shewmr7_1077		putative exported protein
Position: -47 Score: 5.2 Sequence: ATTTAAGAATAATTATCATTC Locus tag: Shewmr7_2171 Name: null Funciton: TonB-dependent receptor
	Shewmr7_2171		TonB-dependent receptor
Position: -99 Score: 6 Sequence: AAATGATATTGGTTATCATTT Locus tag: Shewmr7_3798 Name: viuA Funciton: TonB-dependent receptor
	Shewmr7_3798	viuA	TonB-dependent receptor
Position: -177 Score: 5.7 Sequence: AAATGATATTGTTTATCATTT Locus tag: Shewmr7_1219 Name: null Funciton: Conserved hypothetical protein Locus tag: Shewmr7_1218 Name: null Funciton: Iron-regulated membrane protein Locus tag: Shewmr7_1217 Name: null Funciton: Conserved hypothetical inner membrane protein
	Shewmr7_1219		Conserved hypothetical protein
	Shewmr7_1218		Iron-regulated membrane protein
	Shewmr7_1217		Conserved hypothetical inner membrane protein
Position: -76 Score: 5.7 Sequence: AACTGATAACTATTATCATTA Locus tag: Shewmr7_0606 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Shewmr7_0607 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Shewmr7_0608 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
	Shewmr7_0606	fbpA	ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
	Shewmr7_0607	fbpB	ABC iron(III) transporter, inner membrane subunit, FbpB
	Shewmr7_0608	fbpC	ABC iron(III) transporter, ATPase subunit, FbpC
Position: -84 Score: 4.9 Sequence: TAATGATAATGATTTGCGTTG Locus tag: Shewmr7_0955 Name: Sama_2655 Funciton: Conserved hypothetical protein Locus tag: Shewmr7_0956 Name: Sama_2656 Funciton: FMN-binding domain protein Locus tag: Shewmr7_0957 Name: Sama_2657 Funciton: ApbE family protein, putative Locus tag: Shewmr7_0958 Name: Sama_2658 Funciton: Hypothetical protein
	Shewmr7_0955	Sama_2655	Conserved hypothetical protein
	Shewmr7_0956	Sama_2656	FMN-binding domain protein
	Shewmr7_0957	Sama_2657	ApbE family protein, putative
	Shewmr7_0958	Sama_2658	Hypothetical protein
Position: -44 Score: 6.1 Sequence: AAATGATAATGATTATCACTT Locus tag: Shewmr7_1272 Name: null Funciton: Hypothetical inner membrane protein
	Shewmr7_1272		Hypothetical inner membrane protein
Position: -59 Score: 5 Sequence: TTATGATAATGACTATTATTT Locus tag: Shewmr7_1248 Name: null Funciton: Cytochrome B561 Locus tag: Shewmr7_1249 Name: yceI Funciton: Protein yceI precursor
	Shewmr7_1248		Cytochrome B561
	Shewmr7_1249	yceI	Protein yceI precursor
Position: -27 Score: 5.3 Sequence: AAATCAAATCCATTCTCATTA Locus tag: Shewmr7_3936 Name: null Funciton: Hypothetical outer membrane protein
	Shewmr7_3936		Hypothetical outer membrane protein
Position: -44 Score: 5.6 Sequence: AAATGCGAATAATTAGCAATT Locus tag: Shewmr7_1862 Name: null Funciton: Signalling protein with EAL domain
	Shewmr7_1862		Signalling protein with EAL domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella sp MR-7

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --