Regulon of Fur in Shewanella sp W3-18-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputw3181_1745
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	62
- Operons	37
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 5.6 Sequence: AAATAATAACCATTCTCATTC Locus tag: Sputw3181_0752 Name: null Funciton: TonB-dependent outer membrane receptor Locus tag: Sputw3181_0751 Name: null Funciton: Periplasmic thioredoxin-family protein
	Sputw3181_0752		TonB-dependent outer membrane receptor
	Sputw3181_0751		Periplasmic thioredoxin-family protein
Position: -59 Score: 5.6 Sequence: GACTGATAATAATTTTCATTT Locus tag: Sputw3181_2565 Name: null Funciton: Hypothetical protein
	Sputw3181_2565		Hypothetical protein
Position: -2 Score: 5.5 Sequence: AAATGATATCGATTCTCGTTT Locus tag: Sputw3181_2064 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	Sputw3181_2064		Two component transcriptional regulator, Winged helix family
Position: -219 Score: 6 Sequence: AAATGATAACGATTTGCATTT Locus tag: Sputw3181_1597 Name: pubA Funciton: Putrescine monooxygenase, PubA Locus tag: Sputw3181_1596 Name: pubB Funciton: N-hydroxyputrescine-succinyl CoA transferase, PubB Locus tag: Sputw3181_1595 Name: pubC Funciton: NTP-dependent putrebactin synthetase, PubC Locus tag: Sputw3181_1594 Name: putA Funciton: TonB-dependent ferric putrebactin siderophore receptor, PutA Locus tag: Sputw3181_1593 Name: putB Funciton: Ferric putrebactin reductase, PutB
	Sputw3181_1597	pubA	Putrescine monooxygenase, PubA
	Sputw3181_1596	pubB	N-hydroxyputrescine-succinyl CoA transferase, PubB
	Sputw3181_1595	pubC	NTP-dependent putrebactin synthetase, PubC
	Sputw3181_1594	putA	TonB-dependent ferric putrebactin siderophore receptor, PutA
	Sputw3181_1593	putB	Ferric putrebactin reductase, PutB
Position: -68 Score: 5.6 Sequence: AAATAAAAACACTTCTCATTT Locus tag: Sputw3181_4050 Name: null Funciton: TonB-dependent siderophore receptor
	Sputw3181_4050		TonB-dependent siderophore receptor
Position: -126 Score: 5.5 Sequence: AAATGAGAATGGTTTTTATAA Locus tag: Sputw3181_3228 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: Sputw3181_3227 Name: bfr1 Funciton: Bacterioferritin subunit 1
	Sputw3181_3228	bfr2	Bacterioferritin subunit 2
	Sputw3181_3227	bfr1	Bacterioferritin subunit 1
Position: -64 Score: 5.7 Sequence: TAATGAGATTAATTCTTATTT Locus tag: Sputw3181_2622 Name: omcA3 Funciton: Surface localized undecaheme cytochrome c lipoprotein, UndA
	Sputw3181_2622	omcA3	Surface localized undecaheme cytochrome c lipoprotein, UndA
Position: -91 Score: 5.1 Sequence: AAATAACAATAACTATCATTA Locus tag: Sputw3181_3569 Name: Sden_3064 Funciton: TonB-dependent receptor
	Sputw3181_3569	Sden_3064	TonB-dependent receptor
Position: -48 Score: 4.9 Sequence: AAATGCAAATAATAAGCAATT Locus tag: Sputw3181_1906 Name: null Funciton: Signalling protein with EAL domain
	Sputw3181_1906		Signalling protein with EAL domain
Position: -30 Score: 4.8 Sequence: GATTGCAAATGATTTTCAATG Locus tag: Sputw3181_2648 Name: null Funciton: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
	Sputw3181_2648		Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
Position: -84 Score: 5.6 Sequence: AATTGAGAACTATTCTTATCT Locus tag: Sputw3181_2795 Name: null Funciton: TonB-dependent heme receptor
	Sputw3181_2795		TonB-dependent heme receptor
Position: -59 Score: 6 Sequence: TAATGAGAATTGTTATCATCT Locus tag: Sputw3181_4047 Name: null Funciton: Conserved hypothetical inner membrane protein
	Sputw3181_4047		Conserved hypothetical inner membrane protein
Position: -75 Score: 6.1 Sequence: AAATGGTAATCATTATCATTT Locus tag: Sputw3181_3202 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB
	Sputw3181_3202	tonB	TonB mediated energy transduction system, energy transducer component, TonB
Position: -31 Score: 5.2 Sequence: AAATGATAATTATCATGATTA Locus tag: Sputw3181_3203 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Sputw3181_3204 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
	Sputw3181_3203	exbB	TonB mediated energy transduction system, inner membrane component, ExbB
	Sputw3181_3204	exbD	TonB mediated energy transduction system, inner membrane component, ExbD
Position: -77 Score: 5.3 Sequence: TAATGTTAATCATTATCATTC Locus tag: Sputw3181_3776 Name: null Funciton: TonB-dependent receptor
	Sputw3181_3776		TonB-dependent receptor
Position: -53 Score: 5.7 Sequence: AATTGATAACTATTCTCATTG Locus tag: Sputw3181_3812 Name: null Funciton: TonB-dependent receptor Locus tag: Sputw3181_3811 Name: null Funciton: Transcriptional regulator, TetR family Locus tag: Sputw3181_3810 Name: null Funciton: Ferric siderophore ABC transporter, permease protein Locus tag: Sputw3181_3809 Name: null Funciton: Ferric siderophore ABC transporter, permease protein Locus tag: Sputw3181_3808 Name: null Funciton: Ferric siderophore ABC transporter, ATP-binding protein Locus tag: Sputw3181_3807 Name: null Funciton: Putative iron transport protein
	Sputw3181_3812		TonB-dependent receptor
	Sputw3181_3811		Transcriptional regulator, TetR family
	Sputw3181_3810		Ferric siderophore ABC transporter, permease protein
	Sputw3181_3809		Ferric siderophore ABC transporter, permease protein
	Sputw3181_3808		Ferric siderophore ABC transporter, ATP-binding protein
	Sputw3181_3807		Putative iron transport protein
Position: -101 Score: 6 Sequence: AAATGAGAATTATTGTCATCT Locus tag: Sputw3181_2432 Name: null Funciton: TonB-dependent siderophore receptor
	Sputw3181_2432		TonB-dependent siderophore receptor
Position: -101 Score: 5.8 Sequence: TAACGATAATTATTATCATTT Locus tag: Sputw3181_0762 Name: Sbal_0657 Funciton: Hypothetical protein
	Sputw3181_0762	Sbal_0657	Hypothetical protein
Position: -131 Score: 5.7 Sequence: AAATGAAAATCATTTTTATCA Locus tag: Sputw3181_3940 Name: ftn Funciton: Ferritin, Ftn
	Sputw3181_3940	ftn	Ferritin, Ftn
Position: -85 Score: 5.2 Sequence: TAATACGAATTGTTATCAATA Position: -59 Score: 5.7 Sequence: TATTGATAATTGTTTTCAATT Locus tag: Sputw3181_2168 Name: null Funciton: TonB-dependent siderophore receptor
	Sputw3181_2168		TonB-dependent siderophore receptor
Position: -21 Score: 5.3 Sequence: AAATGAAAACTATTCGTAATA Locus tag: Sputw3181_0090 Name: null Funciton: TonB-dependent siderophore receptor
	Sputw3181_0090		TonB-dependent siderophore receptor
Position: -123 Score: 5.4 Sequence: AATTGAAAACTATTATCGTTA Locus tag: Sputw3181_2621 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Sputw3181_2620 Name: feoB Funciton: Ferrous iron transport protein B
	Sputw3181_2621	feoA	Ferrous iron transport protein A
	Sputw3181_2620	feoB	Ferrous iron transport protein B
Position: -182 Score: 5.2 Sequence: TATTGCGAATTGTTATCAATA Locus tag: Sputw3181_0546 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Sputw3181_0547 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Sputw3181_0548 Name: null Funciton: Iron-regulated membrane protein
	Sputw3181_0546		Iron-regulated inner membrane protein
	Sputw3181_0547		Iron-regulated inner membrane protein
	Sputw3181_0548		Iron-regulated membrane protein
Position: -178 Score: 6.1 Sequence: AAATGATAATGATTACCATTT Locus tag: Sputw3181_3201 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Sputw3181_3200 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Sputw3181_3199 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
	Sputw3181_3201	hmuA	TonB-dependent haem/haemoglobin receptor, HmuA
	Sputw3181_3200	huvX	Putative heme iron utilization protein
	Sputw3181_3199		Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
Position: -93 Score: 5.2 Sequence: GTTTGATAATAAATATCATTT Locus tag: Sputw3181_1054 Name: null Funciton: Inner membrane protein with PepSY TM helix Locus tag: Sputw3181_1055 Name: null Funciton: Putative exported protein Locus tag: Sputw3181_1056 Name: null Funciton: putative exported protein
	Sputw3181_1054		Inner membrane protein with PepSY TM helix
	Sputw3181_1055		Putative exported protein
	Sputw3181_1056		putative exported protein
Position: -48 Score: 5.1 Sequence: CATTAAGAATAATTATCATTC Locus tag: Sputw3181_2183 Name: null Funciton: TonB-dependent receptor
	Sputw3181_2183		TonB-dependent receptor
Position: -74 Score: 5.8 Sequence: AAGTGATAACTATTATCATTA Locus tag: Sputw3181_0714 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Sputw3181_0715 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Sputw3181_0716 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
	Sputw3181_0714	fbpA	ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
	Sputw3181_0715	fbpB	ABC iron(III) transporter, inner membrane subunit, FbpB
	Sputw3181_0716	fbpC	ABC iron(III) transporter, ATPase subunit, FbpC
Position: -52 Score: 5.9 Sequence: TATTGAAAATTGTTCTCATTT Locus tag: Sputw3181_0403 Name: null Funciton: TonB-dependent receptor
	Sputw3181_0403		TonB-dependent receptor
Position: -101 Score: 5.6 Sequence: AAATGATAATCCTTCTCAGTT Locus tag: Sputw3181_3878 Name: viuA Funciton: TonB-dependent receptor
	Sputw3181_3878	viuA	TonB-dependent receptor
Position: -196 Score: 5.5 Sequence: AAATGATATCGTTTATCATTT Locus tag: Sputw3181_1285 Name: null Funciton: Conserved hypothetical protein Locus tag: Sputw3181_1284 Name: null Funciton: Iron-regulated membrane protein Locus tag: Sputw3181_1283 Name: null Funciton: Conserved hypothetical inner membrane protein
	Sputw3181_1285		Conserved hypothetical protein
	Sputw3181_1284		Iron-regulated membrane protein
	Sputw3181_1283		Conserved hypothetical inner membrane protein
Position: -90 Score: 5.7 Sequence: AATTGAAAACAATTATCAATA Position: -64 Score: 5.2 Sequence: TATTGATAACAATTCGTATTA Locus tag: Sputw3181_2167 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein Locus tag: Sputw3181_2166 Name: Sfri_2547 Funciton: Conserved hypothetical protein
	Sputw3181_2167	COG3182	PepSY-associated TM helix domain-containing protein
	Sputw3181_2166	Sfri_2547	Conserved hypothetical protein
Position: -60 Score: 4.6 Sequence: TTATGATAATGGATATTGTTT Locus tag: Sputw3181_1308 Name: null Funciton: Cytochrome B561 Locus tag: Sputw3181_1309 Name: yceI Funciton: Protein yceI precursor
	Sputw3181_1308		Cytochrome B561
	Sputw3181_1309	yceI	Protein yceI precursor
Position: -97 Score: 5.6 Sequence: TAACGAAAATCGTTATCATTT Locus tag: Sputw3181_0255 Name: SO4423.1 Funciton: TonB-dependent ferric achromobactin receptor
	Sputw3181_0255	SO4423.1	TonB-dependent ferric achromobactin receptor
Position: -49 Score: 4.7 Sequence: AAATACAAATCATTACTATTC Locus tag: Sputw3181_2867 Name: null Funciton: TonB-dependent receptor
	Sputw3181_2867		TonB-dependent receptor
Position: -91 Score: 5.1 Sequence: AAATAACAATAACTATCATTA Locus tag: Sputw3181_3569 Name: null Funciton: TonB-dependent siderophore receptor
	Sputw3181_3569		TonB-dependent siderophore receptor
Position: -40 Score: 6 Sequence: AGATGATAATGATTATCAATT Locus tag: Sputw3181_1332 Name: null Funciton: Hypothetical inner membrane protein
	Sputw3181_1332		Hypothetical inner membrane protein
Position: -54 Score: 5.3 Sequence: ATTTGATAAGCGTTTTCATTT Locus tag: Sputw3181_0646 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	Sputw3181_0646	bfd	Bacterioferritin-associated ferredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella sp W3-18-1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --