Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hmuB gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella denitrificans OS217
Position: -66
Score: 6.468
Sequence: AAATGAAAATCATTATCATTT
Locus tag: Sden_0789
Name: tonB
Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Sden_0788
Name: exbB
Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Sden_0787
Name: exbD
Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: Sden_0786
Name: hmuB
Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: Sden_0785
Name: hmuC
Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: Sden_0784
Name: hmuD
Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD -66 6.5 AAATGAAAATCATTATCATTT Sden_0789
Shewanella halifaxensis HAW-EB4
Position: -207
Score: 6.468
Sequence: AAATGAAAATCATTATCATTT
Locus tag: Shal_3400
Name: tonB
Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Shal_3401
Name: exbB
Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Shal_3402
Name: exbD
Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: Shal_3403
Name: hmuB
Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: Shal_3404
Name: hmuC
Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: Shal_3405
Name: hmuD
Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD -207 6.5 AAATGAAAATCATTATCATTT Shal_3400
Shewanella oneidensis MR-1
Position: -97
Score: 5.72154
Sequence: AAATAGAAATCATTATCATTT
Locus tag: SO3670
Name: tonB
Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: SO3671
Name: exbB
Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: SO3672
Name: exbD
Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: SO3673
Name: hmuB
Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: SO3674
Name: hmuC
Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: SO_3675
Name: hmuD
Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD -97 5.7 AAATAGAAATCATTATCATTT SO3670
Shewanella pealeana ATCC 700345
Position: -206
Score: 6.468
Sequence: AAATGAAAATCATTATCATTT
Locus tag: Spea_3328
Name: tonB
Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Spea_3329
Name: exbB
Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Spea_3330
Name: exbD
Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: Spea_3331
Name: hmuB
Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: Spea_3332
Name: hmuC
Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: Spea_3333
Name: hmuD
Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD -206 6.5 AAATGAAAATCATTATCATTT Spea_3328
Shewanella piezotolerans WP3
Position: -183
Score: 6.468
Sequence: AAATGAAAATCATTATCATTT
Locus tag: swp_3979
Name: tonB
Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: swp_3980
Name: exbB
Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: swp_3981
Name: exbD
Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: swp_3982
Name: hmuB
Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: swp_3983
Name: hmuC
Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: swp_3984
Name: hmuD
Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD -183 6.5 AAATGAAAATCATTATCATTT swp_3979
Shewanella putrefaciens CN-32
Position: -31
Score: 5.18715
Sequence: AAATGATAATTATCATGATTA
Locus tag: Sputcn32_0964
Name: exbB
Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Sputcn32_0963
Name: exbD
Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: Sputcn32_0962
Name: hmuB
Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: Sputcn32_0961
Name: hmuC
Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: Sputcn32_0960
Name: hmuD
Funciton: ABC hemin transporter, ATPase subunit, HmuD
exbB-exbD-hmuB-hmuC-hmuD -31 5.2 AAATGATAATTATCATGATTA Sputcn32_0964
Shewanella sp ANA-3
Position: -98
Score: 6.01763
Sequence: AAATGGAAATCATTATCATTT
Locus tag: Shewana3_3236
Name: tonB
Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Shewana3_3237
Name: exbB
Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Shewana3_3238
Name: exbD
Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: Shewana3_3239
Name: hmuB
Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: Shewana3_3240
Name: hmuC
Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: Shewana3_3241
Name: hmuD
Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD -98 6 AAATGGAAATCATTATCATTT Shewana3_3236
Shewanella woodyi ATCC 51908
Position: -80
Score: 6.468
Sequence: AAATGAAAATCATTATCATTT
Locus tag: Swoo_4005
Name: tonB
Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Swoo_4006
Name: exbB
Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Swoo_4007
Name: exbD
Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: Swoo_4008
Name: hmuB
Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: Swoo_4009
Name: hmuC
Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: Swoo_4010
Name: hmuD
Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD -80 6.5 AAATGAAAATCATTATCATTT Swoo_4005