Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing IucD gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella woodyi ATCC 51908
Position: -62
Score: 5.89912
Sequence: TAATGGGAATAATTATCATTT
Locus tag: Swoo_0585
Name: IucABC
Funciton: Aerobactin synthetase , IucABC
Locus tag: Swoo_0586
Name: IucD
Funciton: lysine N6-hydroxylase, IucD
Locus tag: Swoo_0587
Name: SO4423.1
Funciton: TonB-dependent ferric achromobactin receptor
IucABC-IucD-SO4423.1 -62 5.9 TAATGGGAATAATTATCATTT Swoo_0585