Regulon of Fur in Shewanella halifaxensis HAW-EB4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shal_2482
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	42
- Operons	24
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -100 Score: 5.7 Sequence: TAATGTAAATCATTCTCATTT Locus tag: Shal_3528 Name: Sfri_0810 Funciton: Hypothetical protein Locus tag: Shal_3527 Name: Sfri_0811 Funciton: Imelysin peptidase family lipoprotein Locus tag: Shal_3526 Name: Sfri_0812 Funciton: Protein of unknown function DUF1111
	Shal_3528	Sfri_0810	Hypothetical protein
	Shal_3527	Sfri_0811	Imelysin peptidase family lipoprotein
	Shal_3526	Sfri_0812	Protein of unknown function DUF1111
Position: -103 Score: 5.8 Sequence: TAACGATAATGATTTTCATTT Locus tag: Shal_2698 Name: null Funciton: Hypothetical protein
	Shal_2698		Hypothetical protein
Position: -126 Score: 5.7 Sequence: AATTGAAAATTATTATCGTTT Locus tag: Shal_2777 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Shal_2776 Name: feoB Funciton: Ferrous iron transport protein B
	Shal_2777	feoA	Ferrous iron transport protein A
	Shal_2776	feoB	Ferrous iron transport protein B
Position: -44 Score: 6.1 Sequence: AATTGATAATGATTATCAATT Locus tag: Shal_1179 Name: null Funciton: Hypothetical inner membrane protein
	Shal_1179		Hypothetical inner membrane protein
Position: -35 Score: 5.2 Sequence: TAATATAAACAATTATCATTT Locus tag: Shal_1861 Name: null Funciton: Signalling protein with EAL domain
	Shal_1861		Signalling protein with EAL domain
Position: -47 Score: 6.3 Sequence: AAATGATAACCATTATCATTT Locus tag: Shal_4274 Name: null Funciton: Conserved hypothetical inner membrane protein
	Shal_4274		Conserved hypothetical inner membrane protein
Position: -207 Score: 6.5 Sequence: AAATGAAAATCATTATCATTT Locus tag: Shal_3400 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: Shal_3401 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Shal_3402 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: Shal_3403 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: Shal_3404 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: Shal_3405 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
	Shal_3400	tonB	TonB mediated energy transduction system, energy transducer component, TonB
	Shal_3401	exbB	TonB mediated energy transduction system, inner membrane component, ExbB
	Shal_3402	exbD	TonB mediated energy transduction system, inner membrane component, ExbD
	Shal_3403	hmuB	ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
	Shal_3404	hmuC	ABC hemin transporter, inner membrane subunit, HmuC
	Shal_3405	hmuD	ABC hemin transporter, ATPase subunit, HmuD
Position: -111 Score: 6 Sequence: AAATGAAAACCATTATTATTT Locus tag: Shal_4189 Name: ftn Funciton: Ferritin, Ftn
	Shal_4189	ftn	Ferritin, Ftn
Position: -34 Score: 5.6 Sequence: AAATGAAAATGATTCGCATTG Locus tag: Shal_2220 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	Shal_2220		Two component transcriptional regulator, Winged helix family
Position: -67 Score: 5.6 Sequence: AAATGAGAATGAATAGCATTA Locus tag: Shal_0766 Name: Sama_0590 Funciton: TonB-dependent receptor
	Shal_0766	Sama_0590	TonB-dependent receptor
Position: -62 Score: 5.9 Sequence: TGTTGATAATCATTCTCATTT Locus tag: Shal_2195 Name: Sfri_2008 Funciton: Hypothetical protein
	Shal_2195	Sfri_2008	Hypothetical protein
Position: -87 Score: 4.4 Sequence: AAATACGTCCCATTATCATTT Locus tag: Shal_0192 Name: null Funciton: Hypothetical outer membrane protein
	Shal_0192		Hypothetical outer membrane protein
Position: -51 Score: 5.6 Sequence: TAATAAGAATCGTTATCATCT Locus tag: Shal_3021 Name: null Funciton: TonB-dependent receptor
	Shal_3021		TonB-dependent receptor
Position: -121 Score: 4.3 Sequence: TAGTGATAATGAAAATCACTA Position: -88 Score: 4.3 Sequence: TGTTGATATTTAACCTTATTT Locus tag: Shal_3179 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: Shal_3178 Name: bfr1 Funciton: Bacterioferritin subunit 1
	Shal_3179	bfr2	Bacterioferritin subunit 2
	Shal_3178	bfr1	Bacterioferritin subunit 1
Position: -58 Score: 5.5 Sequence: CACTGAGAATCATTTTCATTT Locus tag: Shal_3649 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	Shal_3649	bfd	Bacterioferritin-associated ferredoxin
Position: -336 Score: 5.7 Sequence: AAACGATAATAATTTTCAATT Locus tag: Shal_2778 Name: mtrD Funciton: Periplasmic decaheme cytochrome c, MtrD Locus tag: Shal_2779 Name: mtrE Funciton: Outer membrane protein, MtrE Locus tag: Shal_2780 Name: mtrF Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrF Locus tag: Shal_2781 Name: omcA Funciton: Surface localized decaheme cytochrome c lipoprotein, OmcA
	Shal_2778	mtrD	Periplasmic decaheme cytochrome c, MtrD
	Shal_2779	mtrE	Outer membrane protein, MtrE
	Shal_2780	mtrF	Surface localized decaheme cytochrome c lipoprotein, MtrF
	Shal_2781	omcA	Surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -144 Score: 6.5 Sequence: AAATGATAATGATTTTCATTT Locus tag: Shal_3399 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Shal_3398 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Shal_3397 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
	Shal_3399	hmuA	TonB-dependent haem/haemoglobin receptor, HmuA
	Shal_3398	huvX	Putative heme iron utilization protein
	Shal_3397		Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
Position: -96 Score: 5.1 Sequence: GAATGGAAACGGTTCTCAATT Locus tag: Shal_1257 Name: null Funciton: Conserved hypothetical protein Locus tag: Shal_1256 Name: null Funciton: Iron-regulated membrane protein Locus tag: Shal_1255 Name: null Funciton: Conserved hypothetical inner membrane protein
	Shal_1257		Conserved hypothetical protein
	Shal_1256		Iron-regulated membrane protein
	Shal_1255		Conserved hypothetical inner membrane protein
Position: -64 Score: 5.4 Sequence: AATTGAGAATTATTATCAGTC Locus tag: Shal_0897 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Shal_0898 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Shal_0899 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
	Shal_0897	fbpA	ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
	Shal_0898	fbpB	ABC iron(III) transporter, inner membrane subunit, FbpB
	Shal_0899	fbpC	ABC iron(III) transporter, ATPase subunit, FbpC
Position: -68 Score: 6 Sequence: AAATAAAAATAGTTCTCATTT Locus tag: Shal_4287 Name: null Funciton: TonB-dependent siderophore receptor
	Shal_4287		TonB-dependent siderophore receptor
Position: -42 Score: 5.8 Sequence: AAAGGAGAATAATTCTCATTT Locus tag: Shal_3020 Name: null Funciton: TonB-dependent receptor
	Shal_3020		TonB-dependent receptor
Position: -54 Score: 5.9 Sequence: ATTTGATAATGATTATCATTT Locus tag: Shal_3411 Name: null Funciton: Coproporphyrinogen III oxidase
	Shal_3411		Coproporphyrinogen III oxidase
Position: -78 Score: 4.8 Sequence: AAATGGAATTAGTTATAATCT Locus tag: Shal_3111 Name: adhC Funciton: S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284)
	Shal_3111	adhC	S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284)
Position: -65 Score: 5.3 Sequence: AGGTGAGAATAATTCTCATAA Locus tag: Shal_2783 Name: mtrH Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrH
	Shal_2783	mtrH	Surface localized decaheme cytochrome c lipoprotein, MtrH

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella halifaxensis HAW-EB4

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --