Orthologous regulated operons containing SO4700 gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella baltica OS155
Position: -86 Score: 4.50107 Sequence: AAATCGAATCAATTCGCATTA Locus tag: Sbal_0123 Name: null Funciton: Hypothetical outer membrane protein
Sbal_0123	-86	4.5	AAATCGAATCAATTCGCATTA	Sbal_0123
Shewanella denitrificans OS217
Position: -123 Score: 4.70527 Sequence: AAATAAGACTGGTTTGTATTT Locus tag: Sden_3594 Name: null Funciton: Hypothetical outer membrane protein
Sden_3594	-123	4.7	AAATAAGACTGGTTTGTATTT	Sden_3594
Shewanella frigidimarina NCIMB 400
Position: -80 Score: 5.30915 Sequence: AAACGAGACTGATTATCATTT Locus tag: Sfri_3875 Name: null Funciton: Hypothetical outer membrane protein
Sfri_3875	-80	5.3	AAACGAGACTGATTATCATTT	Sfri_3875
Shewanella halifaxensis HAW-EB4
Position: -87 Score: 4.37326 Sequence: AAATACGTCCCATTATCATTT Locus tag: Shal_0192 Name: null Funciton: Hypothetical outer membrane protein
Shal_0192	-87	4.4	AAATACGTCCCATTATCATTT	Shal_0192
Shewanella loihica PV-4
Position: -83 Score: 5.31125 Sequence: AAATGCAACCAATTCTCATTT Locus tag: Shew_3658 Name: null Funciton: Hypothetical outer membrane protein
Shew_3658	-83	5.3	AAATGCAACCAATTCTCATTT	Shew_3658
Shewanella oneidensis MR-1
Position: -86 Score: 5.30027 Sequence: AAATCAAATCCATTCTCATTA Locus tag: SO4700 Name: null Funciton: Hypothetical outer membrane protein
SO4700	-86	5.3	AAATCAAATCCATTCTCATTA	SO4700
Shewanella pealeana ATCC 700345
Position: 7 Score: 5.04863 Sequence: AAATACGAGCTATTATCATTT Locus tag: Spea_4066 Name: null Funciton: Hypothetical outer membrane protein
Spea_4066	7	5	AAATACGAGCTATTATCATTT	Spea_4066
Shewanella piezotolerans WP3
Position: -86 Score: 5.01181 Sequence: AAATACAACCGATTATCATTT Locus tag: swp_4927 Name: null Funciton: Hypothetical outer membrane protein
swp_4927	-86	5	AAATACAACCGATTATCATTT	swp_4927
Shewanella sediminis HAW-EB3
Position: -97 Score: 5.49149 Sequence: AAATGGGAAGTGTTATCATTT Locus tag: Ssed_0144 Name: null Funciton: Hypothetical outer membrane protein
Ssed_0144	-97	5.5	AAATGGGAAGTGTTATCATTT	Ssed_0144
Shewanella sp ANA-3
Position: -86 Score: 4.84989 Sequence: AAATCGAATCCATTCTCATTA Locus tag: Shewana3_4052 Name: null Funciton: Hypothetical outer membrane protein
Shewana3_4052	-86	4.8	AAATCGAATCCATTCTCATTA	Shewana3_4052
Shewanella sp MR-4
Position: -27 Score: 5.30027 Sequence: AAATCAAATCCATTCTCATTA Locus tag: Shewmr4_3843 Name: null Funciton: Hypothetical outer membrane protein
Shewmr4_3843	-27	5.3	AAATCAAATCCATTCTCATTA	Shewmr4_3843
Shewanella sp MR-7
Position: -27 Score: 5.30027 Sequence: AAATCAAATCCATTCTCATTA Locus tag: Shewmr7_3936 Name: null Funciton: Hypothetical outer membrane protein
Shewmr7_3936	-27	5.3	AAATCAAATCCATTCTCATTA	Shewmr7_3936
Shewanella woodyi ATCC 51908
Position: -85 Score: 5.24635 Sequence: AAATACAAAGCGTTATCATTT Locus tag: Swoo_0123 Name: null Funciton: Hypothetical outer membrane protein
Swoo_0123	-85	5.2	AAATACAAAGCGTTATCATTT	Swoo_0123

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing SO4700 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --