Regulon of Fur in Shewanella sediminis HAW-EB3

Properties
Regulator type:	Transcription factor
TF locus tag:	Ssed_2810
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	35
- Operons	23
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6 Sequence: AAATAAAAACGATTCTCATTT Locus tag: Ssed_4483 Name: null Funciton: TonB-dependent siderophore receptor
	Ssed_4483		TonB-dependent siderophore receptor
Position: -76 Score: 5.1 Sequence: TAATGCAAACGATTCGTATTT Locus tag: Ssed_3793 Name: Sfri_0810 Funciton: Hypothetical protein Locus tag: Ssed_3792 Name: Sfri_0811 Funciton: Imelysin peptidase family lipoprotein Locus tag: Ssed_3791 Name: Sfri_0812 Funciton: Protein of unknown function DUF1111
	Ssed_3793	Sfri_0810	Hypothetical protein
	Ssed_3792	Sfri_0811	Imelysin peptidase family lipoprotein
	Ssed_3791	Sfri_0812	Protein of unknown function DUF1111
Position: -83 Score: 5.6 Sequence: AAATGATAACCGTTTGCATTA Locus tag: Ssed_3889 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Ssed_3890 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Ssed_3891 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
	Ssed_3889	Sfri_4035	Conserved hypothetical signal peptide protein, possibly porin
	Ssed_3890		FMN-binding domain-containing protein
	Ssed_3891	COG3182	PepSY-associated TM helix domain-containing protein
Position: -41 Score: 5.7 Sequence: TAATGATAATGATTATCAATC Locus tag: Ssed_1239 Name: null Funciton: Hypothetical inner membrane protein
	Ssed_1239		Hypothetical inner membrane protein
Position: -34 Score: 5.5 Sequence: AAATGATAACAGTTCGTATTT Locus tag: Ssed_2316 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	Ssed_2316		Two component transcriptional regulator, Winged helix family
Position: -219 Score: 4.9 Sequence: GAGCGATAATCATTCTCATCT Position: -126 Score: 5.6 Sequence: AATTGAAAACTATTCTCGTTT Locus tag: Ssed_1531 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Ssed_1532 Name: feoB Funciton: Ferrous iron transport protein B
	Ssed_1531	feoA	Ferrous iron transport protein A
	Ssed_1532	feoB	Ferrous iron transport protein B
Position: -47 Score: 6.1 Sequence: AGATGAGAATAGTTATCATTT Locus tag: Ssed_4479 Name: null Funciton: Conserved hypothetical inner membrane protein
	Ssed_4479		Conserved hypothetical inner membrane protein
Position: -107 Score: 5.7 Sequence: TAATGATAATTATTAGTATTT Locus tag: Ssed_4374 Name: ftn Funciton: Ferritin, Ftn
	Ssed_4374	ftn	Ferritin, Ftn
Position: -84 Score: 5.5 Sequence: AAATGATAACCACTCTCATTA Locus tag: Ssed_3888 Name: Sama_0590 Funciton: TonB-dependent receptor
	Ssed_3888	Sama_0590	TonB-dependent receptor
Position: -64 Score: 5.8 Sequence: CATTGATAATCATTCTCATTT Locus tag: Ssed_2208 Name: Sfri_2008 Funciton: Hypothetical protein
	Ssed_2208	Sfri_2008	Hypothetical protein
Position: -54 Score: 5.8 Sequence: CATTGAGAATCATTTTCATTT Locus tag: Ssed_0782 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	Ssed_0782	bfd	Bacterioferritin-associated ferredoxin
Position: -49 Score: 5.5 Sequence: AAATGCAAATCGTTATCATTC Locus tag: Ssed_3242 Name: null Funciton: TonB-dependent receptor
	Ssed_3242		TonB-dependent receptor
Position: -154 Score: 5.3 Sequence: GAATTATAATCATTCTTATTT Locus tag: Ssed_0946 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Ssed_0947 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
	Ssed_0946	fbpB	ABC iron(III) transporter, inner membrane subunit, FbpB
	Ssed_0947	fbpC	ABC iron(III) transporter, ATPase subunit, FbpC
Position: -58 Score: 5.7 Sequence: GATTGATAATAATTATCATTA Locus tag: Ssed_0945 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
	Ssed_0945	fbpA	ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
Position: -137 Score: 4.6 Sequence: TAATGGGAATGATTATCTCTA Locus tag: Ssed_2230 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: Ssed_2231 Name: bfr1 Funciton: Bacterioferritin subunit 1
	Ssed_2230	bfr2	Bacterioferritin subunit 2
	Ssed_2231	bfr1	Bacterioferritin subunit 1
Position: -322 Score: 5.6 Sequence: AAACGAGAATAGTTTTCAATT Position: -229 Score: 4.9 Sequence: AGATGAGAATGATTATCGCTC Position: -110 Score: 4.8 Sequence: AGATAAAAATGTTACTCATTT Locus tag: Ssed_1530 Name: mtrD Funciton: Periplasmic decaheme cytochrome c, MtrD Locus tag: Ssed_1529 Name: mtrE Funciton: Outer membrane protein, MtrE Locus tag: Ssed_1528 Name: mtrF Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrF Locus tag: Ssed_1527 Name: omcA Funciton: Surface localized decaheme cytochrome c lipoprotein, OmcA
	Ssed_1530	mtrD	Periplasmic decaheme cytochrome c, MtrD
	Ssed_1529	mtrE	Outer membrane protein, MtrE
	Ssed_1528	mtrF	Surface localized decaheme cytochrome c lipoprotein, MtrF
	Ssed_1527	omcA	Surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -51 Score: 4.9 Sequence: AATCGAGAATGGTTATCATCC Locus tag: Ssed_1496 Name: SO4423.1 Funciton: TonB-dependent ferric achromobactin receptor
	Ssed_1496	SO4423.1	TonB-dependent ferric achromobactin receptor
Position: -98 Score: 5.1 Sequence: GAATGAAAACGGTTATCACCT Locus tag: Ssed_1345 Name: null Funciton: Conserved hypothetical protein Locus tag: Ssed_1344 Name: null Funciton: Iron-regulated membrane protein Locus tag: Ssed_1343 Name: null Funciton: Conserved hypothetical inner membrane protein
	Ssed_1345		Conserved hypothetical protein
	Ssed_1344		Iron-regulated membrane protein
	Ssed_1343		Conserved hypothetical inner membrane protein
Position: -38 Score: 5.1 Sequence: TGGTGAGAACGATTATTATTA Locus tag: Ssed_2007 Name: null Funciton: Probable two-component system sensor kinase
	Ssed_2007		Probable two-component system sensor kinase
Position: -97 Score: 5.5 Sequence: AAATGGGAAGTGTTATCATTT Locus tag: Ssed_0144 Name: null Funciton: Hypothetical outer membrane protein
	Ssed_0144		Hypothetical outer membrane protein
Position: -42 Score: 5.5 Sequence: TAAGGATAATAATTCTCATTA Locus tag: Ssed_3638 Name: null Funciton: TonB-dependent receptor
	Ssed_3638		TonB-dependent receptor
Position: -56 Score: 5 Sequence: TAATGTGAATAATTACTATTT Locus tag: Ssed_1968 Name: null Funciton: Signalling protein with EAL domain
	Ssed_1968		Signalling protein with EAL domain
Position: -67 Score: 5.3 Sequence: AAATGAAAATCATTTGTAGTT Locus tag: Ssed_1517 Name: null Funciton: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
	Ssed_1517		Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella sediminis HAW-EB3

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --