Regulon of Fur in Shewanella piezotolerans WP3

Properties
Regulator type:	Transcription factor
TF locus tag:	swp_2938
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	70
- Operons	33
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 5.3 Sequence: AAATGATAATGATTGCTATTA Position: -44 Score: 5.7 Sequence: AAATACAAATCGTTATCATTT Locus tag: swp_4138 Name: Sfri_0202 Funciton: Conserved hypothetical protein Locus tag: swp_4137 Name: null Funciton: Hypothetical protein Locus tag: swp_4136 Name: puiB Funciton: Uncharacterized iron-regulated membrane protein, PiuB
	swp_4138	Sfri_0202	Conserved hypothetical protein
	swp_4137		Hypothetical protein
	swp_4136	puiB	Uncharacterized iron-regulated membrane protein, PiuB
Position: -9 Score: 5.5 Sequence: CAATGATAATTGTTCGCATTT Locus tag: swp_2595 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	swp_2595		Two component transcriptional regulator, Winged helix family
Position: -56 Score: 6.1 Sequence: AATTGATAACGATTTTCATTT Locus tag: swp_3175 Name: null Funciton: Hypothetical protein
	swp_3175		Hypothetical protein
Position: -81 Score: 6 Sequence: AAATGAGAATAATTTGCATTA Locus tag: swp_4367 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: swp_4368 Name: null Funciton: FMN-binding domain-containing protein Locus tag: swp_4369 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
	swp_4367	Sfri_4035	Conserved hypothetical signal peptide protein, possibly porin
	swp_4368		FMN-binding domain-containing protein
	swp_4369	COG3182	PepSY-associated TM helix domain-containing protein
Position: -86 Score: 5 Sequence: AAATACAACCGATTATCATTT Locus tag: swp_4927 Name: null Funciton: Hypothetical outer membrane protein
	swp_4927		Hypothetical outer membrane protein
Position: -118 Score: 5.5 Sequence: TAATGATAATAATTATCTTTA Locus tag: swp_1175 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: swp_1176 Name: bfr1 Funciton: Bacterioferritin subunit 1
	swp_1175	bfr2	Bacterioferritin subunit 2
	swp_1176	bfr1	Bacterioferritin subunit 1
Position: -68 Score: 5.6 Sequence: GAATAAAAACAATTCTCATTT Locus tag: swp_5150 Name: null Funciton: TonB-dependent siderophore receptor
	swp_5150		TonB-dependent siderophore receptor
Position: -76 Score: 5.7 Sequence: AAGTGATAATCATTATCATTC Locus tag: swp_0953 Name: null Funciton: TonB-dependent heme receptor
	swp_0953		TonB-dependent heme receptor
Position: -46 Score: 6.1 Sequence: AAATGATAATCGTTATCATCT Locus tag: swp_5137 Name: null Funciton: Conserved hypothetical inner membrane protein
	swp_5137		Conserved hypothetical inner membrane protein
Position: -155 Score: 5.2 Sequence: TATTGATAGCAATTCTCATTA Locus tag: swp_3303 Name: swp_3303 Funciton: TonB-dependent siderophore receptor
	swp_3303	swp_3303	TonB-dependent siderophore receptor
Position: -183 Score: 6.5 Sequence: AAATGAAAATCATTATCATTT Locus tag: swp_3979 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: swp_3980 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: swp_3981 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: swp_3982 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: swp_3983 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: swp_3984 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
	swp_3979	tonB	TonB mediated energy transduction system, energy transducer component, TonB
	swp_3980	exbB	TonB mediated energy transduction system, inner membrane component, ExbB
	swp_3981	exbD	TonB mediated energy transduction system, inner membrane component, ExbD
	swp_3982	hmuB	ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
	swp_3983	hmuC	ABC hemin transporter, inner membrane subunit, HmuC
	swp_3984	hmuD	ABC hemin transporter, ATPase subunit, HmuD
Position: -110 Score: 6 Sequence: AAATGAAAACCATTATTATTT Locus tag: swp_0167 Name: ftn Funciton: Ferritin, Ftn
	swp_0167	ftn	Ferritin, Ftn
Position: -86 Score: 5.8 Sequence: TAATGCAAATCGTTCTCATTT Locus tag: swp_4049 Name: Sfri_0810 Funciton: Hypothetical protein Locus tag: swp_4048 Name: Sfri_0811 Funciton: Imelysin peptidase family lipoprotein Locus tag: swp_4047 Name: Sfri_0812 Funciton: Protein of unknown function DUF1111
	swp_4049	Sfri_0810	Hypothetical protein
	swp_4048	Sfri_0811	Imelysin peptidase family lipoprotein
	swp_4047	Sfri_0812	Protein of unknown function DUF1111
Position: -48 Score: 5.9 Sequence: AGTTGATAATGATTATCATTA Locus tag: swp_3985 Name: null Funciton: Coproporphyrinogen III oxidase
	swp_3985		Coproporphyrinogen III oxidase
Position: -51 Score: 5.8 Sequence: TAATGATAATGGTTATCATCA Locus tag: swp_3568 Name: null Funciton: TonB-dependent receptor
	swp_3568		TonB-dependent receptor
Position: -339 Score: 5.7 Sequence: AAACGATAATAATTTTCAATT Position: -239 Score: 5.3 Sequence: AAATAGTAATGGTTATTATTT Locus tag: swp_3272 Name: mtrD Funciton: Periplasmic decaheme cytochrome c, MtrD Locus tag: swp_3273 Name: mtrE Funciton: Outer membrane protein, MtrE Locus tag: swp_3274 Name: mtrF Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrF Locus tag: swp_3275 Name: omcA Funciton: Surface localized decaheme cytochrome c lipoprotein, OmcA
	swp_3272	mtrD	Periplasmic decaheme cytochrome c, MtrD
	swp_3273	mtrE	Outer membrane protein, MtrE
	swp_3274	mtrF	Surface localized decaheme cytochrome c lipoprotein, MtrF
	swp_3275	omcA	Surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -86 Score: 5.3 Sequence: GATTGATAACTATTCTCATCA Position: -57 Score: 5.6 Sequence: CATTGAGAATCGTTTTCATTT Locus tag: swp_0771 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	swp_0771	bfd	Bacterioferritin-associated ferredoxin
Position: -225 Score: 5.3 Sequence: AAATAATAACCATTACTATTT Position: -125 Score: 5.7 Sequence: AATTGAAAATTATTATCGTTT Locus tag: swp_3271 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: swp_3270 Name: feoB Funciton: Ferrous iron transport protein B
	swp_3271	feoA	Ferrous iron transport protein A
	swp_3270	feoB	Ferrous iron transport protein B
Position: -143 Score: 6.5 Sequence: AAATGATAATGATTTTCATTT Locus tag: swp_3978 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: swp_3976 Name: huvX Funciton: Putative heme iron utilization protein
	swp_3978	hmuA	TonB-dependent haem/haemoglobin receptor, HmuA
	swp_3976	huvX	Putative heme iron utilization protein
Position: -102 Score: 4.3 Sequence: TGATCATAATTGTTTTAAATC Locus tag: swp_3069 Name: null Funciton: Inner membrane protein with PepSY TM helix Locus tag: swp_3071 Name: null Funciton: Putative exported protein
	swp_3069		Inner membrane protein with PepSY TM helix
	swp_3071		Putative exported protein
Position: -456 Score: 5.3 Sequence: AATTGCGAATCATTCACATTT Locus tag: swp_0160 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: swp_0159 Name: null Funciton: Iron-regulated membrane protein
	swp_0160		Iron-regulated inner membrane protein
	swp_0159		Iron-regulated membrane protein
Position: -108 Score: 5.2 Sequence: CAACAATAATCATTATCATTT Locus tag: swp_1134 Name: SO4423.1 Funciton: TonB-dependent ferric achromobactin receptor
	swp_1134	SO4423.1	TonB-dependent ferric achromobactin receptor
Position: -60 Score: 5.2 Sequence: AATTGAGAACTATTATCAGCA Locus tag: swp_4107 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: swp_4106 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: swp_4105 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
	swp_4107	fbpA	ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
	swp_4106	fbpB	ABC iron(III) transporter, inner membrane subunit, FbpB
	swp_4105	fbpC	ABC iron(III) transporter, ATPase subunit, FbpC
Position: -104 Score: 5.3 Sequence: AAATGTGAATGATTCGCAATT Locus tag: swp_0161 Name: viuA Funciton: TonB-dependent receptor
	swp_0161	viuA	TonB-dependent receptor
Position: -91 Score: 5.2 Sequence: GAATAAAAATGGTTATCAATA Locus tag: swp_3413 Name: null Funciton: Conserved hypothetical protein Locus tag: swp_3414 Name: null Funciton: Iron-regulated membrane protein Locus tag: swp_3415 Name: null Funciton: Conserved hypothetical inner membrane protein
	swp_3413		Conserved hypothetical protein
	swp_3414		Iron-regulated membrane protein
	swp_3415		Conserved hypothetical inner membrane protein
Position: -271 Score: 5 Sequence: GGATGCCAATTGTTCTCATTT Position: -111 Score: 5.6 Sequence: AAATCGTAATAATTATCATTT Locus tag: swp_0085 Name: pvsA Funciton: Vibrioferrin ligase/carboxylase protein PvsA Locus tag: swp_0086 Name: pvsB Funciton: Vibrioferrin amide bond forming protein PvsB Locus tag: swp_0087 Name: pvsC Funciton: Vibrioferrin membrane-spanning transport protein PvsC Locus tag: swp_0088 Name: pvsD Funciton: Vibrioferrin biosynthesis protein, PvsD Locus tag: swp_0089 Name: pvsE Funciton: Vibrioferrin biosynthesis protein, PvsE
	swp_0085	pvsA	Vibrioferrin ligase/carboxylase protein PvsA
	swp_0086	pvsB	Vibrioferrin amide bond forming protein PvsB
	swp_0087	pvsC	Vibrioferrin membrane-spanning transport protein PvsC
	swp_0088	pvsD	Vibrioferrin biosynthesis protein, PvsD
	swp_0089	pvsE	Vibrioferrin biosynthesis protein, PvsE
Position: -206 Score: 5.6 Sequence: AAATGATAATTATTACGATTT Position: -46 Score: 5 Sequence: AAATGAGAACAATTGGCATCC Locus tag: swp_0084 Name: null Funciton: Putative siderophore biosynthesis protein, HpcH/HpaI aldolase family Locus tag: swp_0083 Name: Sfri_3851 Funciton: TonB-dependent siderophore receptor
	swp_0084		Putative siderophore biosynthesis protein, HpcH/HpaI aldolase family
	swp_0083	Sfri_3851	TonB-dependent siderophore receptor
Position: -94 Score: 5.6 Sequence: TGTTGAGATTAATTATCATTT Locus tag: swp_0926 Name: null Funciton: TonB-dependent siderophore receptor
	swp_0926		TonB-dependent siderophore receptor
Position: -84 Score: 5.7 Sequence: GAATGAGAATCAATATCATTT Locus tag: swp_4957 Name: null Funciton: Outer membrane receptor protein, mostly Fe transport Locus tag: swp_4956 Name: null Funciton: Probable zinc protease Locus tag: swp_4955 Name: null Funciton: ABC-type uncharacterized transport system, permease and ATPase components Locus tag: swp_4954 Name: null Funciton: TonB mediate energy transduction system, conserved hypothetical periplasmic component Locus tag: swp_4953 Name: ttpc Funciton: TonB mediated energy transduction system, inner membrane component, TtpC Locus tag: swp_4952 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: swp_4950 Name: exbD Funciton: TonB mediated energy transduction system, membrane anchored component, ExbD Locus tag: swp_4949 Name: null Funciton: Hypothetical protein Locus tag: swp_4948 Name: null Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: swp_4947 Name: tprX Funciton: TPR repeat-containing protein
	swp_4957		Outer membrane receptor protein, mostly Fe transport
	swp_4956		Probable zinc protease
	swp_4955		ABC-type uncharacterized transport system, permease and ATPase components
	swp_4954		TonB mediate energy transduction system, conserved hypothetical periplasmic component
	swp_4953	ttpc	TonB mediated energy transduction system, inner membrane component, TtpC
	swp_4952	exbB	TonB mediated energy transduction system, inner membrane component, ExbB
	swp_4950	exbD	TonB mediated energy transduction system, membrane anchored component, ExbD
	swp_4949		Hypothetical protein
	swp_4948		TonB mediated energy transduction system, energy transducer component, TonB
	swp_4947	tprX	TPR repeat-containing protein
Position: -43 Score: 6.1 Sequence: TAATGATAATGATTATCAATT Locus tag: swp_3598 Name: null Funciton: Hypothetical inner membrane protein
	swp_3598		Hypothetical inner membrane protein
Position: 29 Score: 5.6 Sequence: TAATGTTAATAATTATCATTA Locus tag: swp_2763 Name: null Funciton: Signalling protein with EAL domain
	swp_2763		Signalling protein with EAL domain
Position: -111 Score: 4.6 Sequence: ATATTAGAGGGATTATCATTT Locus tag: swp_2093 Name: adhC Funciton: S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284)
	swp_2093	adhC	S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284)
Position: -67 Score: 5 Sequence: AAATGAGATTTGTTCTCAAAC Locus tag: swp_3277 Name: mtrH Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrH
	swp_3277	mtrH	Surface localized decaheme cytochrome c lipoprotein, MtrH

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella piezotolerans WP3

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --