Regulon of Fur in Shewanella baltica OS155

Properties
Regulator type:	Transcription factor
TF locus tag:	Sbal_2509
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	60
- Operons	36
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 5.4 Sequence: GACTGATAATAGTTTTCATTT Locus tag: Sbal_1657 Name: null Funciton: Hypothetical protein
	Sbal_1657		Hypothetical protein
Position: -32 Score: 5.1 Sequence: AAATGATATAGATTCTCGTTT Locus tag: Sbal_2050 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	Sbal_2050		Two component transcriptional regulator, Winged helix family
Position: -64 Score: 5.4 Sequence: TATTGATAACAATTTGCATTA Locus tag: Sbal_2134 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein Locus tag: Sbal_2135 Name: Sfri_2547 Funciton: Conserved hypothetical protein
	Sbal_2134	COG3182	PepSY-associated TM helix domain-containing protein
	Sbal_2135	Sfri_2547	Conserved hypothetical protein
Position: -93 Score: 5.4 Sequence: AAATGCGAATTGTTTGCATTA Locus tag: Sbal_2014 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Sbal_2015 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Sbal_2016 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
	Sbal_2014	Sfri_4035	Conserved hypothetical signal peptide protein, possibly porin
	Sbal_2015		FMN-binding domain-containing protein
	Sbal_2016	COG3182	PepSY-associated TM helix domain-containing protein
Position: -232 Score: 6.1 Sequence: AAATGAGAATGATTTGCATTT Locus tag: Sbal_2708 Name: pubA Funciton: Putrescine monooxygenase, PubA Locus tag: Sbal_2709 Name: pubB Funciton: N-hydroxyputrescine-succinyl CoA transferase, PubB Locus tag: Sbal_2710 Name: pubC Funciton: NTP-dependent putrebactin synthetase, PubC Locus tag: Sbal_2711 Name: putA Funciton: TonB-dependent ferric putrebactin siderophore receptor, PutA Locus tag: Sbal_2712 Name: putB Funciton: Ferric putrebactin reductase, PutB
	Sbal_2708	pubA	Putrescine monooxygenase, PubA
	Sbal_2709	pubB	N-hydroxyputrescine-succinyl CoA transferase, PubB
	Sbal_2710	pubC	NTP-dependent putrebactin synthetase, PubC
	Sbal_2711	putA	TonB-dependent ferric putrebactin siderophore receptor, PutA
	Sbal_2712	putB	Ferric putrebactin reductase, PutB
Position: -68 Score: 5.6 Sequence: AAATAAAAACACTTCTCATTT Locus tag: Sbal_4363 Name: null Funciton: TonB-dependent siderophore receptor
	Sbal_4363		TonB-dependent siderophore receptor
Position: -121 Score: 5.4 Sequence: AATTGAAAACTATTATCGTTA Locus tag: Sbal_1594 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Sbal_1595 Name: feoB Funciton: Ferrous iron transport protein B
	Sbal_1594	feoA	Ferrous iron transport protein A
	Sbal_1595	feoB	Ferrous iron transport protein B
Position: -53 Score: 5.3 Sequence: ATTTGATAAGCGTTTTCATTT Locus tag: Sbal_0542 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	Sbal_0542	bfd	Bacterioferritin-associated ferredoxin
Position: -108 Score: 4.9 Sequence: AAATGATAATAGTTATTGATC Locus tag: Sbal_3635 Name: null Funciton: TonB-dependent siderophore receptor Locus tag: Sbal_3634 Name: piuC Funciton: Iron-uptake factor PiuC
	Sbal_3635		TonB-dependent siderophore receptor
	Sbal_3634	piuC	Iron-uptake factor PiuC
Position: -41 Score: 6 Sequence: AGATGATAATGATTATCAATT Locus tag: Sbal_3017 Name: null Funciton: Hypothetical inner membrane protein
	Sbal_3017		Hypothetical inner membrane protein
Position: -30 Score: 4.8 Sequence: GATTGCAAATGATTTTCAATG Locus tag: Sbal_1561 Name: null Funciton: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
	Sbal_1561		Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
Position: -50 Score: 5.2 Sequence: AATTGCGAATAGTTCTCAACA Locus tag: Sbal_2737 Name: null Funciton: Hypothetical inner membrane protein
	Sbal_2737		Hypothetical inner membrane protein
Position: -59 Score: 6 Sequence: TAATGAGAATTGTTATCATCT Locus tag: Sbal_4341 Name: null Funciton: Conserved hypothetical inner membrane protein
	Sbal_4341		Conserved hypothetical inner membrane protein
Position: -84 Score: 5.4 Sequence: AAGTGAGAACTATTCTTATCT Locus tag: Sbal_1397 Name: null Funciton: TonB-dependent heme receptor
	Sbal_1397		TonB-dependent heme receptor
Position: -63 Score: 6.1 Sequence: AAATGCAAATCATTATCATTT Locus tag: Sbal_0951 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: Sbal_0950 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Sbal_0949 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
	Sbal_0951	tonB	TonB mediated energy transduction system, energy transducer component, TonB
	Sbal_0950	exbB	TonB mediated energy transduction system, inner membrane component, ExbB
	Sbal_0949	exbD	TonB mediated energy transduction system, inner membrane component, ExbD
Position: -100 Score: 5.6 Sequence: GAATAAAAATCGTTATCATTT Locus tag: Sbal_0298 Name: SO4423.1 Funciton: TonB-dependent ferric achromobactin receptor
	Sbal_0298	SO4423.1	TonB-dependent ferric achromobactin receptor
Position: -165 Score: 4.7 Sequence: AAATAAAAATAATGATCACAT Position: -63 Score: 5.6 Sequence: TGTTGATAACAGTTATCATTT Locus tag: Sbal_4484 Name: Sfri_2008 Funciton: Hypothetical protein
	Sbal_4484	Sfri_2008	Hypothetical protein
Position: -165 Score: 4.7 Sequence: AAATAAAAATAATGATCACAT Position: -63 Score: 5.6 Sequence: TGTTGATAACAGTTATCATTT Locus tag: Sbal_2198 Name: Sfri_2008 Funciton: Hypothetical protein
	Sbal_2198	Sfri_2008	Hypothetical protein
Position: -101 Score: 5.8 Sequence: TAACGATAATTATTATCATTT Locus tag: Sbal_0657 Name: Sbal_0657 Funciton: Hypothetical protein
	Sbal_0657	Sbal_0657	Hypothetical protein
Position: -131 Score: 5.7 Sequence: AAATGAAAATCATTTTTATCA Locus tag: Sbal_4222 Name: ftn Funciton: Ferritin, Ftn
	Sbal_4222	ftn	Ferritin, Ftn
Position: -63 Score: 4.8 Sequence: AAATAAAAGTGATTCGCAATA Locus tag: Sbal_2136 Name: null Funciton: TonB-dependent siderophore receptor
	Sbal_2136		TonB-dependent siderophore receptor
Position: -61 Score: 5.3 Sequence: TTATGATAATGAATATTATTT Locus tag: Sbal_3042 Name: null Funciton: Cytochrome B561 Locus tag: Sbal_3041 Name: yceI Funciton: Protein yceI precursor
	Sbal_3042		Cytochrome B561
	Sbal_3041	yceI	Protein yceI precursor
Position: -64 Score: 5.5 Sequence: TAATGAGATTTATTCTTATCT Locus tag: Sbal_1590 Name: omcA Funciton: Surface localized decaheme cytochrome c lipoprotein, OmcA
	Sbal_1590	omcA	Surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -335 Score: 5.4 Sequence: TAACGATAATAGTTTTCAATT Locus tag: Sbal_1593 Name: mtrD Funciton: Periplasmic decaheme cytochrome c, MtrD Locus tag: Sbal_1592 Name: mtrE Funciton: Outer membrane protein, MtrE Locus tag: Sbal_1591 Name: mtrF Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrF
	Sbal_1593	mtrD	Periplasmic decaheme cytochrome c, MtrD
	Sbal_1592	mtrE	Outer membrane protein, MtrE
	Sbal_1591	mtrF	Surface localized decaheme cytochrome c lipoprotein, MtrF
Position: -284 Score: 6.1 Sequence: AAATGATAATGATTTGCATTT Locus tag: Sbal_0952 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Sbal_0953 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Sbal_0954 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
	Sbal_0952	hmuA	TonB-dependent haem/haemoglobin receptor, HmuA
	Sbal_0953	huvX	Putative heme iron utilization protein
	Sbal_0954		Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
Position: -45 Score: 5.4 Sequence: ATTTGATAATCGATCTCATTT Locus tag: Sbal_3255 Name: null Funciton: Inner membrane protein with PepSY TM helix Locus tag: Sbal_3254 Name: null Funciton: Putative exported protein Locus tag: Sbal_3253 Name: null Funciton: putative exported protein
	Sbal_3255		Inner membrane protein with PepSY TM helix
	Sbal_3254		Putative exported protein
	Sbal_3253		putative exported protein
Position: -47 Score: 5.2 Sequence: ATTTAAGAATAATTATCATTC Locus tag: Sbal_2423 Name: null Funciton: TonB-dependent receptor
	Sbal_2423		TonB-dependent receptor
Position: -76 Score: 5.4 Sequence: AACTGATAAGCATTATCATTA Locus tag: Sbal_0812 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
	Sbal_0812	fbpA	ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
Position: -52 Score: 5.9 Sequence: TATTGAAAATTGTTCTCATTT Locus tag: Sbal_0217 Name: null Funciton: TonB-dependent receptor
	Sbal_0217		TonB-dependent receptor
Position: -195 Score: 5.5 Sequence: AAATGATATCGTTTATCATTT Locus tag: Sbal_1237 Name: null Funciton: Conserved hypothetical protein Locus tag: Sbal_1236 Name: null Funciton: Iron-regulated membrane protein Locus tag: Sbal_1235 Name: null Funciton: Conserved hypothetical inner membrane protein
	Sbal_1237		Conserved hypothetical protein
	Sbal_1236		Iron-regulated membrane protein
	Sbal_1235		Conserved hypothetical inner membrane protein
Position: -126 Score: 5.3 Sequence: AAATGAGAATGGTTGTTATCA Locus tag: Sbal_0932 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: Sbal_0933 Name: bfr1 Funciton: Bacterioferritin subunit 1
	Sbal_0932	bfr2	Bacterioferritin subunit 2
	Sbal_0933	bfr1	Bacterioferritin subunit 1
Position: -83 Score: 4.8 Sequence: TAATGATAACGATTTGCGTTG Locus tag: Sbal_0904 Name: Sama_2655 Funciton: Conserved hypothetical protein Locus tag: Sbal_0905 Name: Sama_2656 Funciton: FMN-binding domain protein Locus tag: Sbal_0906 Name: Sama_2657 Funciton: ApbE family protein, putative Locus tag: Sbal_0907 Name: Sama_2658 Funciton: Hypothetical protein
	Sbal_0904	Sama_2655	Conserved hypothetical protein
	Sbal_0905	Sama_2656	FMN-binding domain protein
	Sbal_0906	Sama_2657	ApbE family protein, putative
	Sbal_0907	Sama_2658	Hypothetical protein
Position: -49 Score: 5 Sequence: AAATGCAAATCATTACTATTC Locus tag: Sbal_1315 Name: null Funciton: TonB-dependent receptor
	Sbal_1315		TonB-dependent receptor
Position: -86 Score: 4.5 Sequence: AAATCGAATCAATTCGCATTA Locus tag: Sbal_0123 Name: null Funciton: Hypothetical outer membrane protein
	Sbal_0123		Hypothetical outer membrane protein
Position: -46 Score: 5.3 Sequence: AAATGCGAATAATTAGTATTA Locus tag: Sbal_2274 Name: null Funciton: Signalling protein with EAL domain
	Sbal_2274		Signalling protein with EAL domain
Position: -46 Score: 5.3 Sequence: AAATGCGAATAATTAGTATTA Locus tag: Sbal_4560 Name: null Funciton: Signalling protein with EAL domain
	Sbal_4560		Signalling protein with EAL domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella baltica OS155

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --