Regulon of Fur in Shewanella pealeana ATCC 700345

Properties
Regulator type:	Transcription factor
TF locus tag:	Spea_1796
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	46
- Operons	26
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -191 Score: 5.1 Sequence: AAATAGTAACCATTCTTAATT Position: -126 Score: 5.7 Sequence: AATTGAAAATTATTATCGTTT Locus tag: Spea_2691 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Spea_2690 Name: feoB Funciton: Ferrous iron transport protein B
	Spea_2691	feoA	Ferrous iron transport protein A
	Spea_2690	feoB	Ferrous iron transport protein B
Position: -104 Score: 5.5 Sequence: GAACGATAATGATTTTCATTT Locus tag: Spea_2627 Name: null Funciton: Hypothetical protein
	Spea_2627		Hypothetical protein
Position: 7 Score: 5 Sequence: AAATACGAGCTATTATCATTT Locus tag: Spea_4066 Name: null Funciton: Hypothetical outer membrane protein
	Spea_4066		Hypothetical outer membrane protein
Position: -82 Score: 5.6 Sequence: TAATGATAACGATTTGCATTA Locus tag: Spea_0712 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Spea_0711 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Spea_0710 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
	Spea_0712	Sfri_4035	Conserved hypothetical signal peptide protein, possibly porin
	Spea_0711		FMN-binding domain-containing protein
	Spea_0710	COG3182	PepSY-associated TM helix domain-containing protein
Position: -69 Score: 6 Sequence: AAATAAAAATAGTTCTCATTT Locus tag: Spea_4236 Name: null Funciton: TonB-dependent siderophore receptor
	Spea_4236		TonB-dependent siderophore receptor
Position: -61 Score: 5.4 Sequence: TGTTGAGAACAGTTCTCATTA Locus tag: Spea_1624 Name: null Funciton: Hypothetical inner membrane protein
	Spea_1624		Hypothetical inner membrane protein
Position: -117 Score: 6.1 Sequence: TATTGATAATCATTATCATTT Locus tag: Spea_2212 Name: Sfri_2008 Funciton: Hypothetical protein
	Spea_2212	Sfri_2008	Hypothetical protein
Position: -47 Score: 5.9 Sequence: AAATGAGAAGCGTTATCATTT Locus tag: Spea_4226 Name: null Funciton: Conserved hypothetical inner membrane protein
	Spea_4226		Conserved hypothetical inner membrane protein
Position: -206 Score: 6.5 Sequence: AAATGAAAATCATTATCATTT Locus tag: Spea_3328 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: Spea_3329 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Spea_3330 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: Spea_3331 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: Spea_3332 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: Spea_3333 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
	Spea_3328	tonB	TonB mediated energy transduction system, energy transducer component, TonB
	Spea_3329	exbB	TonB mediated energy transduction system, inner membrane component, ExbB
	Spea_3330	exbD	TonB mediated energy transduction system, inner membrane component, ExbD
	Spea_3331	hmuB	ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
	Spea_3332	hmuC	ABC hemin transporter, inner membrane subunit, HmuC
	Spea_3333	hmuD	ABC hemin transporter, ATPase subunit, HmuD
Position: -111 Score: 6 Sequence: AAATGAAAACCATTATTATTT Locus tag: Spea_0129 Name: ftn Funciton: Ferritin, Ftn
	Spea_0129	ftn	Ferritin, Ftn
Position: -66 Score: 5.5 Sequence: AAATGATAATCAATCCCATTA Locus tag: Spea_0713 Name: Sama_0590 Funciton: TonB-dependent receptor
	Spea_0713	Sama_0590	TonB-dependent receptor
Position: -51 Score: 6 Sequence: TAATGATAATCGTTATCATCT Locus tag: Spea_2930 Name: null Funciton: TonB-dependent receptor
	Spea_2930		TonB-dependent receptor
Position: -317 Score: 5.7 Sequence: AAACGATAATAATTTTCAATT Position: -252 Score: 5.1 Sequence: AATTAAGAATGGTTACTATTT Locus tag: Spea_2692 Name: mtrD Funciton: Periplasmic decaheme cytochrome c, MtrD Locus tag: Spea_2693 Name: mtrE Funciton: Outer membrane protein, MtrE Locus tag: Spea_2694 Name: mtrF Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrF Locus tag: Spea_2695 Name: omcA Funciton: Surface localized decaheme cytochrome c lipoprotein, OmcA
	Spea_2692	mtrD	Periplasmic decaheme cytochrome c, MtrD
	Spea_2693	mtrE	Outer membrane protein, MtrE
	Spea_2694	mtrF	Surface localized decaheme cytochrome c lipoprotein, MtrF
	Spea_2695	omcA	Surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -58 Score: 5.8 Sequence: CATTGAGAATCATTTTCATTT Locus tag: Spea_3555 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	Spea_3555	bfd	Bacterioferritin-associated ferredoxin
Position: -143 Score: 6.5 Sequence: AAATGATAATGATTTTCATTT Locus tag: Spea_3327 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Spea_3326 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Spea_3325 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
	Spea_3327	hmuA	TonB-dependent haem/haemoglobin receptor, HmuA
	Spea_3326	huvX	Putative heme iron utilization protein
	Spea_3325		Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
Position: -108 Score: 5.3 Sequence: AAACACTAATCATTATCATTT Locus tag: Spea_0977 Name: SO4423.1 Funciton: TonB-dependent ferric achromobactin receptor
	Spea_0977	SO4423.1	TonB-dependent ferric achromobactin receptor
Position: -116 Score: 5.4 Sequence: TAATGAGAATGGTTATCTTTA Locus tag: Spea_3095 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: Spea_3094 Name: bfr1 Funciton: Bacterioferritin subunit 1
	Spea_3095	bfr2	Bacterioferritin subunit 2
	Spea_3094	bfr1	Bacterioferritin subunit 1
Position: -100 Score: 5.7 Sequence: TAATGTAAATCATTCTCATTT Locus tag: Spea_0670 Name: Sfri_0810 Funciton: Hypothetical protein Locus tag: Spea_0671 Name: Sfri_0811 Funciton: Imelysin peptidase family lipoprotein Locus tag: Spea_0672 Name: Sfri_0812 Funciton: Protein of unknown function DUF1111
	Spea_0670	Sfri_0810	Hypothetical protein
	Spea_0671	Sfri_0811	Imelysin peptidase family lipoprotein
	Spea_0672	Sfri_0812	Protein of unknown function DUF1111
Position: -60 Score: 5.8 Sequence: AATTGAGAATTATTATCAGTT Locus tag: Spea_0844 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Spea_0845 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Spea_0846 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
	Spea_0844	fbpA	ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
	Spea_0845	fbpB	ABC iron(III) transporter, inner membrane subunit, FbpB
	Spea_0846	fbpC	ABC iron(III) transporter, ATPase subunit, FbpC
Position: -82 Score: 5.3 Sequence: GAATGAAAACAGTTATCAGTT Locus tag: Spea_1223 Name: null Funciton: Conserved hypothetical protein Locus tag: Spea_1222 Name: null Funciton: Iron-regulated membrane protein Locus tag: Spea_1221 Name: null Funciton: Conserved hypothetical inner membrane protein
	Spea_1223		Conserved hypothetical protein
	Spea_1222		Iron-regulated membrane protein
	Spea_1221		Conserved hypothetical inner membrane protein
Position: -34 Score: 5.3 Sequence: TAATGCGAATTATTCGTATTT Locus tag: Spea_2236 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	Spea_2236		Two component transcriptional regulator, Winged helix family
Position: -67 Score: 5.3 Sequence: AAATGAGAGTTGTTCTCATAT Locus tag: Spea_2697 Name: omcA2 Funciton: Surface localized decaheme cytochrome c lipoprotein, OmcA
	Spea_2697	omcA2	Surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -33 Score: 6.1 Sequence: TAATGATAATGATTATCAATT Locus tag: Spea_1134 Name: null Funciton: Hypothetical inner membrane protein
	Spea_1134		Hypothetical inner membrane protein
Position: -43 Score: 5.8 Sequence: AAAAGAGAATAATTCTCATTT Locus tag: Spea_2929 Name: null Funciton: TonB-dependent receptor
	Spea_2929		TonB-dependent receptor
Position: -53 Score: 5.8 Sequence: ATTTGATAATAATTATCATTA Locus tag: Spea_3339 Name: null Funciton: Coproporphyrinogen III oxidase
	Spea_3339		Coproporphyrinogen III oxidase
Position: -80 Score: 5.5 Sequence: AAATGAAATCAATTATAATTT Locus tag: Spea_3021 Name: adhC Funciton: S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284)
	Spea_3021	adhC	S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella pealeana ATCC 700345

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --