Regulon of Fur in Shewanella oneidensis MR-1

Properties
Regulator type:	Transcription factor
TF locus tag:	SO1937
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	58
- Operons	32
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 4.9 Sequence: AGGTAGGAACAATTCTCATTT Locus tag: SO0719 Name: null Funciton: TonB-dependent receptor
	SO0719		TonB-dependent receptor
Position: -2 Score: 5.6 Sequence: AAATGATATTGATTCTCGTTT Locus tag: SO2426 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	SO2426		Two component transcriptional regulator, Winged helix family
Position: -60 Score: 5.4 Sequence: GACTGATAATAGTTTTCATTT Locus tag: SO2841 Name: null Funciton: Hypothetical protein
	SO2841		Hypothetical protein
Position: -98 Score: 5.4 Sequence: TAATAAAAATCGTTACCATTT Locus tag: SO4423.1 Name: SO4423.1 Funciton: TonB-dependent ferric achromobactin receptor
	SO4423.1	SO4423.1	TonB-dependent ferric achromobactin receptor
Position: -62 Score: 6.1 Sequence: AAATAATAACAATTCTCATTT Locus tag: SO0798 Name: null Funciton: TonB-dependent outer membrane receptor Locus tag: SO0797 Name: null Funciton: Periplasmic thioredoxin-family protein
	SO0798		TonB-dependent outer membrane receptor
	SO0797		Periplasmic thioredoxin-family protein
Position: -208 Score: 5.7 Sequence: AGATGAGAACGATTTGCATTT Locus tag: SO3030 Name: pubA Funciton: Putrescine monooxygenase, PubA Locus tag: SO3031 Name: pubB Funciton: N-hydroxyputrescine-succinyl CoA transferase, PubB Locus tag: SO3032 Name: pubC Funciton: NTP-dependent putrebactin synthetase, PubC Locus tag: SO3033 Name: putA Funciton: TonB-dependent ferric putrebactin siderophore receptor, PutA Locus tag: SO3034 Name: putB Funciton: Ferric putrebactin reductase, PutB
	SO3030	pubA	Putrescine monooxygenase, PubA
	SO3031	pubB	N-hydroxyputrescine-succinyl CoA transferase, PubB
	SO3032	pubC	NTP-dependent putrebactin synthetase, PubC
	SO3033	putA	TonB-dependent ferric putrebactin siderophore receptor, PutA
	SO3034	putB	Ferric putrebactin reductase, PutB
Position: -44 Score: 6 Sequence: AAATGATAATGATTATCAGTT Locus tag: SO3344 Name: null Funciton: Hypothetical inner membrane protein
	SO3344		Hypothetical inner membrane protein
Position: -60 Score: 6 Sequence: TAATGAGAATTGTTATCATCT Locus tag: SO4740 Name: null Funciton: Conserved hypothetical inner membrane protein
	SO4740		Conserved hypothetical inner membrane protein
Position: -108 Score: 5.1 Sequence: AAATGATAATAATTATTGATC Locus tag: SO3914 Name: null Funciton: TonB-dependent siderophore receptor Locus tag: SO3913 Name: piuC Funciton: Iron-uptake factor PiuC
	SO3914		TonB-dependent siderophore receptor
	SO3913	piuC	Iron-uptake factor PiuC
Position: -30 Score: 5.3 Sequence: AATTGAAAATGATTTTCACTG Locus tag: SO1755 Name: null Funciton: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
	SO1755		Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
Position: -49 Score: 5 Sequence: GGATGGAAATCATTATCATTC Locus tag: SO1482 Name: null Funciton: TonB-dependent receptor
	SO1482		TonB-dependent receptor
Position: -67 Score: 5.5 Sequence: TGTTGAGAACAATTCTCATCT Locus tag: SO3062 Name: null Funciton: Hypothetical inner membrane protein
	SO3062		Hypothetical inner membrane protein
Position: -82 Score: 5.5 Sequence: ATGTGAGAATTATTCTCATCT Locus tag: SO1580 Name: null Funciton: TonB-dependent heme receptor
	SO1580		TonB-dependent heme receptor
Position: -97 Score: 5.7 Sequence: AAATAGAAATCATTATCATTT Locus tag: SO3670 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: SO3671 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: SO3672 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: SO3673 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: SO3674 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: SO_3675 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
	SO3670	tonB	TonB mediated energy transduction system, energy transducer component, TonB
	SO3671	exbB	TonB mediated energy transduction system, inner membrane component, ExbB
	SO3672	exbD	TonB mediated energy transduction system, inner membrane component, ExbD
	SO3673	hmuB	ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
	SO3674	hmuC	ABC hemin transporter, inner membrane subunit, HmuC
	SO_3675	hmuD	ABC hemin transporter, ATPase subunit, HmuD
Position: -125 Score: 5.2 Sequence: TAATGAGAATGCTTTTAATTA Locus tag: SO1111 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: SO1112 Name: bfr1 Funciton: Bacterioferritin subunit 1
	SO1111	bfr2	Bacterioferritin subunit 2
	SO1112	bfr1	Bacterioferritin subunit 1
Position: -55 Score: 5.3 Sequence: ATTTGATAAGCGTTTTCATTT Locus tag: SO0583 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	SO0583	bfd	Bacterioferritin-associated ferredoxin
Position: -370 Score: 5.4 Sequence: TAACGATAATAGTTTTCAATT Locus tag: SO1782 Name: mtrD Funciton: Periplasmic decaheme cytochrome c, MtrD Locus tag: SO1781 Name: mtrE Funciton: Outer membrane protein, MtrE Locus tag: SO1780 Name: mtrF Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrF
	SO1782	mtrD	Periplasmic decaheme cytochrome c, MtrD
	SO1781	mtrE	Outer membrane protein, MtrE
	SO1780	mtrF	Surface localized decaheme cytochrome c lipoprotein, MtrF
Position: -133 Score: 5.7 Sequence: AAATGAAAATCATTTTTATCA Locus tag: SO0139 Name: ftn Funciton: Ferritin, Ftn
	SO0139	ftn	Ferritin, Ftn
Position: -121 Score: 5.4 Sequence: AATTGAAAACTATTATCGTTA Locus tag: SO1783 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: SO1784 Name: feoB Funciton: Ferrous iron transport protein B
	SO1783	feoA	Ferrous iron transport protein A
	SO1784	feoB	Ferrous iron transport protein B
Position: -64 Score: 5.6 Sequence: TAATGAGATTTGTTCTTATTT Locus tag: SO1779 Name: omcA Funciton: Surface localized decaheme cytochrome c lipoprotein, OmcA
	SO1779	omcA	Surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -169 Score: 5.7 Sequence: AAATGATAATGATTTCTATTT Locus tag: SO3669 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: SO3668 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: SO3667 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
	SO3669	hmuA	TonB-dependent haem/haemoglobin receptor, HmuA
	SO3668	huvX	Putative heme iron utilization protein
	SO3667		Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
Position: -185 Score: 5.4 Sequence: TTTTGATAATAAATATCATTT Locus tag: SO1188 Name: null Funciton: Inner membrane protein with PepSY TM helix Locus tag: SO1189 Name: null Funciton: Putative exported protein Locus tag: SO1190 Name: null Funciton: putative exported protein
	SO1188		Inner membrane protein with PepSY TM helix
	SO1189		Putative exported protein
	SO1190		putative exported protein
Position: -146 Score: 5.2 Sequence: TATTGCGAACTATTCTCATCA Locus tag: SO0447 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: SO0448 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: SO0449 Name: null Funciton: Iron-regulated membrane protein
	SO0447		Iron-regulated inner membrane protein
	SO0448		Iron-regulated inner membrane protein
	SO0449		Iron-regulated membrane protein
Position: -86 Score: 5.3 Sequence: AAATCAAATCCATTCTCATTA Locus tag: SO4700 Name: null Funciton: Hypothetical outer membrane protein
	SO4700		Hypothetical outer membrane protein
Position: -50 Score: 6.1 Sequence: TATTGAAAATTATTATCATTT Locus tag: SO_4523 Name: irgA Funciton: TonB-dependent receptor
	SO_4523	irgA	TonB-dependent receptor
Position: -100 Score: 5.8 Sequence: AAATGATATTGGTTATCAATT Locus tag: SO4516 Name: viuA Funciton: TonB-dependent receptor
	SO4516	viuA	TonB-dependent receptor
Position: -76 Score: 5.7 Sequence: AACTGATAACTATTATCATTA Locus tag: SO0744 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: SO0743 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: SO0742 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
	SO0744	fbpA	ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
	SO0743	fbpB	ABC iron(III) transporter, inner membrane subunit, FbpB
	SO0742	fbpC	ABC iron(III) transporter, ATPase subunit, FbpC
Position: -59 Score: 4.7 Sequence: TTATGATAATGAACATTATTT Locus tag: SO3371 Name: null Funciton: Cytochrome B561 Locus tag: SO3370 Name: yceI Funciton: Protein yceI precursor
	SO3371		Cytochrome B561
	SO3370	yceI	Protein yceI precursor
Position: -273 Score: 5.7 Sequence: AAATGATATTGTTTATCATTT Locus tag: SO3406 Name: null Funciton: Conserved hypothetical protein Locus tag: SO3407 Name: null Funciton: Iron-regulated membrane protein Locus tag: SO3408 Name: null Funciton: Conserved hypothetical inner membrane protein
	SO3406		Conserved hypothetical protein
	SO3407		Iron-regulated membrane protein
	SO3408		Conserved hypothetical inner membrane protein
Position: -220 Score: 5.8 Sequence: AAATGACAATAGTTGTCATTT Locus tag: SO3025 Name: null Funciton: Periplasmic esterase
	SO3025		Periplasmic esterase
Position: -44 Score: 5.6 Sequence: AAATGCGAATAATTAGCAATT Locus tag: SO2039 Name: null Funciton: Signalling protein with EAL domain
	SO2039		Signalling protein with EAL domain
Position: -116 Score: 5.7 Sequence: AAATAAAAACAATTCTTATTT Locus tag: SO4743 Name: null Funciton: TonB-dependent siderophore receptor
	SO4743		TonB-dependent siderophore receptor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella oneidensis MR-1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --