Orthologous regulated operons containing SO3344 gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -52 Score: 5.92796 Sequence: TATTGATAATAATTATCAATT Locus tag: Sama_2470 Name: null Funciton: Hypothetical inner membrane protein
Sama_2470	-52	5.9	TATTGATAATAATTATCAATT	Sama_2470
Shewanella baltica OS155
Position: -41 Score: 6.04648 Sequence: AGATGATAATGATTATCAATT Locus tag: Sbal_3017 Name: null Funciton: Hypothetical inner membrane protein
Sbal_3017	-41	6	AGATGATAATGATTATCAATT	Sbal_3017
Shewanella halifaxensis HAW-EB4
Position: -44 Score: 6.06949 Sequence: AATTGATAATGATTATCAATT Locus tag: Shal_1179 Name: null Funciton: Hypothetical inner membrane protein
Shal_1179	-44	6.1	AATTGATAATGATTATCAATT	Shal_1179
Shewanella loihica PV-4
Position: -43 Score: 6.28548 Sequence: AAATGATAATGATTATCAATT Locus tag: Shew_1146 Name: null Funciton: Hypothetical inner membrane protein
Shew_1146	-43	6.3	AAATGATAATGATTATCAATT	Shew_1146
Shewanella oneidensis MR-1
Position: -44 Score: 6.00891 Sequence: AAATGATAATGATTATCAGTT Locus tag: SO3344 Name: null Funciton: Hypothetical inner membrane protein
SO3344	-44	6	AAATGATAATGATTATCAGTT	SO3344
Shewanella pealeana ATCC 700345
Position: -33 Score: 6.13016 Sequence: TAATGATAATGATTATCAATT Locus tag: Spea_1134 Name: null Funciton: Hypothetical inner membrane protein
Spea_1134	-33	6.1	TAATGATAATGATTATCAATT	Spea_1134
Shewanella piezotolerans WP3
Position: -43 Score: 6.13016 Sequence: TAATGATAATGATTATCAATT Locus tag: swp_3598 Name: null Funciton: Hypothetical inner membrane protein
swp_3598	-43	6.1	TAATGATAATGATTATCAATT	swp_3598
Shewanella putrefaciens CN-32
Position: -40 Score: 6.04648 Sequence: AGATGATAATGATTATCAATT Locus tag: Sputcn32_2679 Name: null Funciton: Hypothetical inner membrane protein
Sputcn32_2679	-40	6	AGATGATAATGATTATCAATT	Sputcn32_2679
Shewanella sediminis HAW-EB3
Position: -41 Score: 5.72253 Sequence: TAATGATAATGATTATCAATC Locus tag: Ssed_1239 Name: null Funciton: Hypothetical inner membrane protein
Ssed_1239	-41	5.7	TAATGATAATGATTATCAATC	Ssed_1239
Shewanella sp ANA-3
Position: -44 Score: 6.07839 Sequence: AAATGATAATGATTATCACTT Locus tag: Shewana3_1202 Name: null Funciton: Hypothetical inner membrane protein
Shewana3_1202	-44	6.1	AAATGATAATGATTATCACTT	Shewana3_1202
Shewanella sp MR-4
Position: -44 Score: 6.07839 Sequence: AAATGATAATGATTATCACTT Locus tag: Shewmr4_1201 Name: null Funciton: Hypothetical inner membrane protein
Shewmr4_1201	-44	6.1	AAATGATAATGATTATCACTT	Shewmr4_1201
Shewanella sp MR-7
Position: -44 Score: 6.07839 Sequence: AAATGATAATGATTATCACTT Locus tag: Shewmr7_1272 Name: null Funciton: Hypothetical inner membrane protein
Shewmr7_1272	-44	6.1	AAATGATAATGATTATCACTT	Shewmr7_1272
Shewanella sp W3-18-1
Position: -40 Score: 6.04648 Sequence: AGATGATAATGATTATCAATT Locus tag: Sputw3181_1332 Name: null Funciton: Hypothetical inner membrane protein
Sputw3181_1332	-40	6	AGATGATAATGATTATCAATT	Sputw3181_1332
Shewanella woodyi ATCC 51908
Position: -42 Score: 6.00891 Sequence: AAATGATAATGATTATCAGTT Locus tag: Swoo_1339 Name: null Funciton: Hypothetical inner membrane protein
Swoo_1339	-42	6	AAATGATAATGATTATCAGTT	Swoo_1339

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing SO3344 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --