Regulon of Fur in Shewanella denitrificans OS217

Properties
Regulator type:	Transcription factor
TF locus tag:	Sden_1593
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	58
- Operons	22
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: 10 Score: 5.6 Sequence: TAATGAAAATGGTTATCGTTT Locus tag: Sden_1906 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	Sden_1906		Two component transcriptional regulator, Winged helix family
Position: -122 Score: 6.2 Sequence: AAATAATAATGATTATCATTT Locus tag: Sden_3064 Name: Sden_3064 Funciton: TonB-dependent receptor Locus tag: Sden_3065 Name: piuB Funciton: Uncharacterized iron-regulated membrane protein, PiuB
	Sden_3064	Sden_3064	TonB-dependent receptor
	Sden_3065	piuB	Uncharacterized iron-regulated membrane protein, PiuB
Position: -123 Score: 4.7 Sequence: AAATAAGACTGGTTTGTATTT Locus tag: Sden_3594 Name: null Funciton: Hypothetical outer membrane protein
	Sden_3594		Hypothetical outer membrane protein
Position: -120 Score: 5.6 Sequence: TAATGATAATGGTTATCACTA Locus tag: Sden_0990 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: Sden_0991 Name: bfr1 Funciton: Bacterioferritin subunit 1
	Sden_0990	bfr2	Bacterioferritin subunit 2
	Sden_0991	bfr1	Bacterioferritin subunit 1
Position: -91 Score: 5.1 Sequence: AAATACGAATAGTTTGCATTA Locus tag: Sden_0638 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Sden_0639 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Sden_0640 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
	Sden_0638	Sfri_4035	Conserved hypothetical signal peptide protein, possibly porin
	Sden_0639		FMN-binding domain-containing protein
	Sden_0640	COG3182	PepSY-associated TM helix domain-containing protein
Position: -172 Score: 5.5 Sequence: AACTGATAATCATTCTCATTG Locus tag: Sden_2503 Name: null Funciton: TonB-dependent heme receptor
	Sden_2503		TonB-dependent heme receptor
Position: -50 Score: 6 Sequence: TATTGATAACGATTATCATTT Locus tag: Sden_3706 Name: null Funciton: Conserved hypothetical inner membrane protein
	Sden_3706		Conserved hypothetical inner membrane protein
Position: -66 Score: 6.5 Sequence: AAATGAAAATCATTATCATTT Locus tag: Sden_0789 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: Sden_0788 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Sden_0787 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: Sden_0786 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: Sden_0785 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: Sden_0784 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
	Sden_0789	tonB	TonB mediated energy transduction system, energy transducer component, TonB
	Sden_0788	exbB	TonB mediated energy transduction system, inner membrane component, ExbB
	Sden_0787	exbD	TonB mediated energy transduction system, inner membrane component, ExbD
	Sden_0786	hmuB	ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
	Sden_0785	hmuC	ABC hemin transporter, inner membrane subunit, HmuC
	Sden_0784	hmuD	ABC hemin transporter, ATPase subunit, HmuD
Position: -36 Score: 6 Sequence: AAATAAAAACCATTCTCATTT Locus tag: Sden_1854 Name: Sfri_2008 Funciton: Hypothetical protein
	Sden_1854	Sfri_2008	Hypothetical protein
Position: -74 Score: 5.8 Sequence: TAATGCAAATTGTTATCATTT Locus tag: Sden_0721 Name: Sfri_0810 Funciton: Hypothetical protein Locus tag: Sden_0722 Name: Sfri_0811 Funciton: Imelysin peptidase family lipoprotein Locus tag: Sden_0723 Name: Sfri_0812 Funciton: Protein of unknown function DUF1111
	Sden_0721	Sfri_0810	Hypothetical protein
	Sden_0722	Sfri_0811	Imelysin peptidase family lipoprotein
	Sden_0723	Sfri_0812	Protein of unknown function DUF1111
Position: -116 Score: 5.4 Sequence: AATTGAAAACTATTATCGTTA Locus tag: Sden_2415 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Sden_2414 Name: feoB Funciton: Ferrous iron transport protein B
	Sden_2415	feoA	Ferrous iron transport protein A
	Sden_2414	feoB	Ferrous iron transport protein B
Position: -133 Score: 6.5 Sequence: AAATGATAATGATTTTCATTT Locus tag: Sden_0790 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Sden_0791 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Sden_0792 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
	Sden_0790	hmuA	TonB-dependent haem/haemoglobin receptor, HmuA
	Sden_0791	huvX	Putative heme iron utilization protein
	Sden_0792		Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
Position: -72 Score: 5.2 Sequence: AATTGCAAATCACTCTCATTT Locus tag: Sden_0620 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Sden_0619 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Sden_0618 Name: null Funciton: Iron-regulated membrane protein
	Sden_0620		Iron-regulated inner membrane protein
	Sden_0619		Iron-regulated inner membrane protein
	Sden_0618		Iron-regulated membrane protein
Position: -99 Score: 5.7 Sequence: CAATGATAACCGTTTTCATTT Locus tag: Sden_3217 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	Sden_3217	bfd	Bacterioferritin-associated ferredoxin
Position: -92 Score: 5.2 Sequence: AAATGAGAGTGATTTGCAATT Locus tag: Sden_0621 Name: viuA Funciton: TonB-dependent receptor
	Sden_0621	viuA	TonB-dependent receptor
Position: -75 Score: 5.2 Sequence: GAATAAAAACAGTTCTCAATT Locus tag: Sden_2355 Name: null Funciton: Conserved hypothetical protein Locus tag: Sden_2356 Name: null Funciton: Iron-regulated membrane protein Locus tag: Sden_2357 Name: null Funciton: Conserved hypothetical inner membrane protein
	Sden_2355		Conserved hypothetical protein
	Sden_2356		Iron-regulated membrane protein
	Sden_2357		Conserved hypothetical inner membrane protein
Position: -101 Score: 5.3 Sequence: AAACGCTAACAATTCTCATTA Locus tag: Sden_0609 Name: Sfri_3851 Funciton: TonB-dependent siderophore receptor
	Sden_0609	Sfri_3851	TonB-dependent siderophore receptor
Position: -69 Score: 5.3 Sequence: AAATGATAATGAAAATCATTA Position: -63 Score: 5 Sequence: TAATGAAAATCATTACCAGTC Locus tag: Sden_0590 Name: Sden_0590 Funciton: Putative siderophore biosynthesis protein, related to cysteine synthase Locus tag: Sden_0589 Name: Sden_0589 Funciton: Putative siderophore biosynthesis protein, Ornithine cyclodeaminase (EC 4.3.1.12) Locus tag: Sden_0588 Name: pvsB Funciton: Vibrioferrin amide bond forming protein PvsB Locus tag: Sden_0587 Name: Sden_0587 Funciton: Putative efflux transmembrane protein in siderophore biosynthesys operon Locus tag: Sden_0586 Name: Sden_0586 Funciton: Siderophore synthetase superfamily, group A / Siderophore synthetase superfamily, group C Locus tag: Sden_0585 Name: null Funciton: Putative siderophore biosynthesis protein, HpcH/HpaI aldolase family Locus tag: Sden_0584 Name: pvsE Funciton: Vibrioferrin biosynthesis protein, PvsE Locus tag: Sden_0583 Name: Sden_0583 Funciton: ParB-like nuclease Locus tag: Sden_0582 Name: Sden_0582 Funciton: Outer membrane receptor proteins, likely involved in siderophore uptake
	Sden_0590	Sden_0590	Putative siderophore biosynthesis protein, related to cysteine synthase
	Sden_0589	Sden_0589	Putative siderophore biosynthesis protein, Ornithine cyclodeaminase (EC 4.3.1.12)
	Sden_0588	pvsB	Vibrioferrin amide bond forming protein PvsB
	Sden_0587	Sden_0587	Putative efflux transmembrane protein in siderophore biosynthesys operon
	Sden_0586	Sden_0586	Siderophore synthetase superfamily, group A / Siderophore synthetase superfamily, group C
	Sden_0585		Putative siderophore biosynthesis protein, HpcH/HpaI aldolase family
	Sden_0584	pvsE	Vibrioferrin biosynthesis protein, PvsE
	Sden_0583	Sden_0583	ParB-like nuclease
	Sden_0582	Sden_0582	Outer membrane receptor proteins, likely involved in siderophore uptake
Position: -48 Score: 5.2 Sequence: CTATGATAATCATTATCATTC Locus tag: Sden_1445 Name: null Funciton: TonB-dependent receptor
	Sden_1445		TonB-dependent receptor
Position: -122 Score: 6.2 Sequence: AAATAATAATGATTATCATTT Locus tag: Sden_3064 Name: null Funciton: TonB-dependent siderophore receptor Locus tag: Sden_3065 Name: piuB Funciton: Iron-uptake factor PiuB
	Sden_3064		TonB-dependent siderophore receptor
	Sden_3065	piuB	Iron-uptake factor PiuB
Position: -58 Score: 5.8 Sequence: TATTGAGATTCATTATCATTT Locus tag: Sden_2159 Name: null Funciton: TonB-dependent receptor Locus tag: Sden_2158 Name: null Funciton: TonB mediate energy transduction system, conserved hypothetical periplasmic component Locus tag: Sden_2157 Name: ttpc Funciton: TonB mediated energy transduction system, inner membrane component, TtpC Locus tag: Sden_2156 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Sden_2155 Name: exbD Funciton: TonB mediated energy transduction system, membrane anchored component, ExbD Locus tag: Sden_2154 Name: null Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: Sden_2153 Name: tprX Funciton: TPR repeat-containing protein Locus tag: Sden_2152 Name: null Funciton: Inner membrane protein with PepSY TM helix Locus tag: Sden_2151 Name: null Funciton: Putative exported protein Locus tag: Sden_2150 Name: null Funciton: putative exported protein
	Sden_2159		TonB-dependent receptor
	Sden_2158		TonB mediate energy transduction system, conserved hypothetical periplasmic component
	Sden_2157	ttpc	TonB mediated energy transduction system, inner membrane component, TtpC
	Sden_2156	exbB	TonB mediated energy transduction system, inner membrane component, ExbB
	Sden_2155	exbD	TonB mediated energy transduction system, membrane anchored component, ExbD
	Sden_2154		TonB mediated energy transduction system, energy transducer component, TonB
	Sden_2153	tprX	TPR repeat-containing protein
	Sden_2152		Inner membrane protein with PepSY TM helix
	Sden_2151		Putative exported protein
	Sden_2150		putative exported protein
Position: -44 Score: 5.2 Sequence: AAATAGGAATAATTAGCATTA Locus tag: Sden_1592 Name: null Funciton: Signalling protein with EAL domain
	Sden_1592		Signalling protein with EAL domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella denitrificans OS217

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --