Regulon of Fur in Shewanella sp MR-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr4_1641
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	58
- Operons	35
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 6.2 Sequence: AAATAATAATTATTCTCATTT Locus tag: Shewmr4_3318 Name: null Funciton: TonB-dependent outer membrane receptor Locus tag: Shewmr4_3319 Name: null Funciton: Periplasmic thioredoxin-family protein
	Shewmr4_3318		TonB-dependent outer membrane receptor
	Shewmr4_3319		Periplasmic thioredoxin-family protein
Position: -71 Score: 5.6 Sequence: GACTGATAATAATTTTCATTT Locus tag: Shewmr4_2447 Name: null Funciton: Hypothetical protein
	Shewmr4_2447		Hypothetical protein
Position: -32 Score: 5.6 Sequence: AAATGATATTGATTCTCGTTT Locus tag: Shewmr4_1904 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	Shewmr4_1904		Two component transcriptional regulator, Winged helix family
Position: -65 Score: 5.5 Sequence: TATTGATAACAATTCGCATTA Locus tag: Shewmr4_2076 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein Locus tag: Shewmr4_2075 Name: Sfri_2547 Funciton: Conserved hypothetical protein
	Shewmr4_2076	COG3182	PepSY-associated TM helix domain-containing protein
	Shewmr4_2075	Sfri_2547	Conserved hypothetical protein
Position: -222 Score: 5.9 Sequence: AAATGAGAATGGTTTGCATTT Locus tag: Shewmr4_1454 Name: pubA Funciton: Putrescine monooxygenase, PubA Locus tag: Shewmr4_1453 Name: pubB Funciton: N-hydroxyputrescine-succinyl CoA transferase, PubB Locus tag: Shewmr4_1452 Name: pubC Funciton: NTP-dependent putrebactin synthetase, PubC Locus tag: Shewmr4_1451 Name: putA Funciton: TonB-dependent ferric putrebactin siderophore receptor, PutA Locus tag: Shewmr4_1450 Name: putB Funciton: Ferric putrebactin reductase, PutB
	Shewmr4_1454	pubA	Putrescine monooxygenase, PubA
	Shewmr4_1453	pubB	N-hydroxyputrescine-succinyl CoA transferase, PubB
	Shewmr4_1452	pubC	NTP-dependent putrebactin synthetase, PubC
	Shewmr4_1451	putA	TonB-dependent ferric putrebactin siderophore receptor, PutA
	Shewmr4_1450	putB	Ferric putrebactin reductase, PutB
Position: -121 Score: 5.4 Sequence: AATTGAAAACTATTATCGTTA Locus tag: Shewmr4_2505 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Shewmr4_2504 Name: feoB Funciton: Ferrous iron transport protein B
	Shewmr4_2505	feoA	Ferrous iron transport protein A
	Shewmr4_2504	feoB	Ferrous iron transport protein B
Position: -68 Score: 5.7 Sequence: AAATAAAAACAATTCTTATTT Locus tag: Shewmr4_3922 Name: null Funciton: TonB-dependent siderophore receptor
	Shewmr4_3922		TonB-dependent siderophore receptor
Position: -106 Score: 5.5 Sequence: AAATGATAATAATTATTGATT Locus tag: Shewmr4_3245 Name: null Funciton: TonB-dependent siderophore receptor Locus tag: Shewmr4_3244 Name: piuC Funciton: Iron-uptake factor PiuC
	Shewmr4_3245		TonB-dependent siderophore receptor
	Shewmr4_3244	piuC	Iron-uptake factor PiuC
Position: -62 Score: 5 Sequence: TAACGAGAATAATTCTTGTTT Locus tag: Shewmr4_0630 Name: Sama_0590 Funciton: TonB-dependent receptor
	Shewmr4_0630	Sama_0590	TonB-dependent receptor
Position: -54 Score: 5.3 Sequence: ATTTGATAAGCGTTTTCATTT Locus tag: Shewmr4_0582 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	Shewmr4_0582	bfd	Bacterioferritin-associated ferredoxin
Position: -44 Score: 6.1 Sequence: AAATGATAATGATTATCACTT Locus tag: Shewmr4_1201 Name: null Funciton: Hypothetical inner membrane protein
	Shewmr4_1201		Hypothetical inner membrane protein
Position: -30 Score: 4.9 Sequence: GATTGAAAATGATTTTCACTG Locus tag: Shewmr4_2541 Name: null Funciton: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
	Shewmr4_2541		Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
Position: -66 Score: 6 Sequence: AATTGAGAATGATTCTCATCT Locus tag: Shewmr4_1432 Name: null Funciton: Hypothetical inner membrane protein
	Shewmr4_1432		Hypothetical inner membrane protein
Position: -145 Score: 5.7 Sequence: AAATGATAATTATTTACATTA Locus tag: Shewmr4_0531 Name: null Funciton: TonB-dependent siderophore receptor
	Shewmr4_0531		TonB-dependent siderophore receptor
Position: -193 Score: 5.1 Sequence: AATTAAGAACGATTCTCGATT Locus tag: Shewmr4_0304 Name: Shewmr4_0304 Funciton: TonB-dependent siderophore receptor
	Shewmr4_0304	Shewmr4_0304	TonB-dependent siderophore receptor
Position: -98 Score: 6.2 Sequence: AAATGAGAATTATTGTCATTT Locus tag: Shewmr4_2386 Name: null Funciton: TonB-dependent siderophore receptor
	Shewmr4_2386		TonB-dependent siderophore receptor
Position: -59 Score: 5.7 Sequence: TGTTGATAACTATTCTCATTT Locus tag: Shewmr4_2003 Name: Sfri_2008 Funciton: Hypothetical protein
	Shewmr4_2003	Sfri_2008	Hypothetical protein
Position: -98 Score: 5.5 Sequence: CAATAAAAATCGTTATCATTT Locus tag: Shewmr4_0286 Name: SO4423.1 Funciton: TonB-dependent ferric achromobactin receptor
	Shewmr4_0286	SO4423.1	TonB-dependent ferric achromobactin receptor
Position: -57 Score: 5.6 Sequence: AAATGCAAATCGTTCTCAATA Locus tag: Shewmr4_0950 Name: null Funciton: TonB-dependent siderophore receptor
	Shewmr4_0950		TonB-dependent siderophore receptor
Position: -64 Score: 5.7 Sequence: TAATGAGATTTATTCTTATTT Locus tag: Shewmr4_2509 Name: omcA Funciton: Surface localized decaheme cytochrome c lipoprotein, OmcA
	Shewmr4_2509	omcA	Surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -326 Score: 5.4 Sequence: TAACGATAATAGTTTTCAATT Locus tag: Shewmr4_2506 Name: mtrD Funciton: Periplasmic decaheme cytochrome c, MtrD Locus tag: Shewmr4_2507 Name: mtrE Funciton: Outer membrane protein, MtrE Locus tag: Shewmr4_2508 Name: mtrF Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrF
	Shewmr4_2506	mtrD	Periplasmic decaheme cytochrome c, MtrD
	Shewmr4_2507	mtrE	Outer membrane protein, MtrE
	Shewmr4_2508	mtrF	Surface localized decaheme cytochrome c lipoprotein, MtrF
Position: -153 Score: 4.8 Sequence: TATTGCGAACTATTCTCACCA Locus tag: Shewmr4_0449 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Shewmr4_0450 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Shewmr4_0451 Name: null Funciton: Iron-regulated membrane protein
	Shewmr4_0449		Iron-regulated inner membrane protein
	Shewmr4_0450		Iron-regulated inner membrane protein
	Shewmr4_0451		Iron-regulated membrane protein
Position: -60 Score: 6 Sequence: TAATGAGAATTGTTATCATCT Locus tag: Shewmr4_3919 Name: null Funciton: Conserved hypothetical inner membrane protein
	Shewmr4_3919		Conserved hypothetical inner membrane protein
Position: -181 Score: 5.6 Sequence: TGTTGATAATAAATATCATTT Locus tag: Shewmr4_1010 Name: null Funciton: Inner membrane protein with PepSY TM helix Locus tag: Shewmr4_1011 Name: null Funciton: Putative exported protein Locus tag: Shewmr4_1012 Name: null Funciton: putative exported protein
	Shewmr4_1010		Inner membrane protein with PepSY TM helix
	Shewmr4_1011		Putative exported protein
	Shewmr4_1012		putative exported protein
Position: -47 Score: 5.2 Sequence: ATTTAAGAATAATTATCATTC Locus tag: Shewmr4_1806 Name: null Funciton: TonB-dependent receptor
	Shewmr4_1806		TonB-dependent receptor
Position: -59 Score: 5 Sequence: TTATGATAATGACTATTATTT Locus tag: Shewmr4_1177 Name: null Funciton: Cytochrome B561 Locus tag: Shewmr4_1178 Name: yceI Funciton: Protein yceI precursor
	Shewmr4_1177		Cytochrome B561
	Shewmr4_1178	yceI	Protein yceI precursor
Position: -99 Score: 6 Sequence: AAATGATATTGGTTATCATTT Locus tag: Shewmr4_3727 Name: viuA Funciton: TonB-dependent receptor
	Shewmr4_3727	viuA	TonB-dependent receptor
Position: -177 Score: 5.7 Sequence: AAATGATATTGTTTATCATTT Locus tag: Shewmr4_1148 Name: null Funciton: Conserved hypothetical protein Locus tag: Shewmr4_1147 Name: null Funciton: Iron-regulated membrane protein Locus tag: Shewmr4_1146 Name: null Funciton: Conserved hypothetical inner membrane protein
	Shewmr4_1148		Conserved hypothetical protein
	Shewmr4_1147		Iron-regulated membrane protein
	Shewmr4_1146		Conserved hypothetical inner membrane protein
Position: -76 Score: 5.7 Sequence: AACTGATAACTATTATCATTA Locus tag: Shewmr4_3347 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Shewmr4_3346 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Shewmr4_3345 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
	Shewmr4_3347	fbpA	ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
	Shewmr4_3346	fbpB	ABC iron(III) transporter, inner membrane subunit, FbpB
	Shewmr4_3345	fbpC	ABC iron(III) transporter, ATPase subunit, FbpC
Position: -132 Score: 5.4 Sequence: AAATGCAAATCATTTTTATCA Locus tag: Shewmr4_0133 Name: ftn Funciton: Ferritin, Ftn
	Shewmr4_0133	ftn	Ferritin, Ftn
Position: -84 Score: 4.9 Sequence: TAATGATAATGATTTGCGTTG Locus tag: Shewmr4_0920 Name: Sama_2655 Funciton: Conserved hypothetical protein Locus tag: Shewmr4_0921 Name: Sama_2656 Funciton: FMN-binding domain protein Locus tag: Shewmr4_0922 Name: Sama_2657 Funciton: ApbE family protein, putative Locus tag: Shewmr4_0923 Name: Sama_2658 Funciton: Hypothetical protein
	Shewmr4_0920	Sama_2655	Conserved hypothetical protein
	Shewmr4_0921	Sama_2656	FMN-binding domain protein
	Shewmr4_0922	Sama_2657	ApbE family protein, putative
	Shewmr4_0923	Sama_2658	Hypothetical protein
Position: -48 Score: 5.8 Sequence: AGATGAAAATCATTATCATTC Locus tag: Shewmr4_2768 Name: null Funciton: TonB-dependent receptor
	Shewmr4_2768		TonB-dependent receptor
Position: -124 Score: 5.4 Sequence: TAATGAGAATGCTTTTTATCT Locus tag: Shewmr4_0944 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: Shewmr4_0945 Name: bfr1 Funciton: Bacterioferritin subunit 1
	Shewmr4_0944	bfr2	Bacterioferritin subunit 2
	Shewmr4_0945	bfr1	Bacterioferritin subunit 1
Position: -27 Score: 5.3 Sequence: AAATCAAATCCATTCTCATTA Locus tag: Shewmr4_3843 Name: null Funciton: Hypothetical outer membrane protein
	Shewmr4_3843		Hypothetical outer membrane protein
Position: -42 Score: 5 Sequence: AAATGCGAATAATTAGCGATT Locus tag: Shewmr4_2112 Name: null Funciton: Signalling protein with EAL domain
	Shewmr4_2112		Signalling protein with EAL domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella sp MR-4

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --