Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing huvX gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella baltica OS155
Position: -284
Score: 6.10539
Sequence: AAATGATAATGATTTGCATTT
Locus tag: Sbal_0952
Name: hmuA
Funciton: TonB-dependent haem/haemoglobin receptor, HmuA
Locus tag: Sbal_0953
Name: huvX
Funciton: Putative heme iron utilization protein
Locus tag: Sbal_0954
Name: null
Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Sbal_0954 -284 6.1 AAATGATAATGATTTGCATTT Sbal_0952
Shewanella denitrificans OS217
Position: -133
Score: 6.468
Sequence: AAATGATAATGATTTTCATTT
Locus tag: Sden_0790
Name: hmuA
Funciton: TonB-dependent haem/haemoglobin receptor, HmuA
Locus tag: Sden_0791
Name: huvX
Funciton: Putative heme iron utilization protein
Locus tag: Sden_0792
Name: null
Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Sden_0792 -133 6.5 AAATGATAATGATTTTCATTT Sden_0790
Shewanella halifaxensis HAW-EB4
Position: -144
Score: 6.468
Sequence: AAATGATAATGATTTTCATTT
Locus tag: Shal_3399
Name: hmuA
Funciton: TonB-dependent haem/haemoglobin receptor, HmuA
Locus tag: Shal_3398
Name: huvX
Funciton: Putative heme iron utilization protein
Locus tag: Shal_3397
Name: null
Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Shal_3397 -144 6.5 AAATGATAATGATTTTCATTT Shal_3399
Shewanella oneidensis MR-1
Position: -169
Score: 5.72154
Sequence: AAATGATAATGATTTCTATTT
Locus tag: SO3669
Name: hmuA
Funciton: TonB-dependent haem/haemoglobin receptor, HmuA
Locus tag: SO3668
Name: huvX
Funciton: Putative heme iron utilization protein
Locus tag: SO3667
Name: null
Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-SO3667 -169 5.7 AAATGATAATGATTTCTATTT SO3669
Shewanella pealeana ATCC 700345
Position: -143
Score: 6.468
Sequence: AAATGATAATGATTTTCATTT
Locus tag: Spea_3327
Name: hmuA
Funciton: TonB-dependent haem/haemoglobin receptor, HmuA
Locus tag: Spea_3326
Name: huvX
Funciton: Putative heme iron utilization protein
Locus tag: Spea_3325
Name: null
Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Spea_3325 -143 6.5 AAATGATAATGATTTTCATTT Spea_3327
Shewanella piezotolerans WP3
Position: -143
Score: 6.468
Sequence: AAATGATAATGATTTTCATTT
Locus tag: swp_3978
Name: hmuA
Funciton: TonB-dependent haem/haemoglobin receptor, HmuA
Locus tag: swp_3976
Name: huvX
Funciton: Putative heme iron utilization protein
hmuA-huvX -143 6.5 AAATGATAATGATTTTCATTT swp_3978
Shewanella putrefaciens CN-32
Position: -178
Score: 6.0511
Sequence: AAATGATAATGATTACCATTT
Locus tag: Sputcn32_0966
Name: hmuA
Funciton: TonB-dependent haem/haemoglobin receptor, HmuA
Locus tag: Sputcn32_0967
Name: huvX
Funciton: Putative heme iron utilization protein
Locus tag: Sputcn32_0968
Name: null
Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Sputcn32_0968 -178 6.1 AAATGATAATGATTACCATTT Sputcn32_0966
Shewanella sp ANA-3
Position: -171
Score: 6.01763
Sequence: AAATGATAATGATTTCCATTT
Locus tag: Shewana3_3235
Name: hmuA
Funciton: TonB-dependent haem/haemoglobin receptor, HmuA
Locus tag: Shewana3_3234
Name: huvX
Funciton: Putative heme iron utilization protein
Locus tag: Shewana3_3233
Name: null
Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Shewana3_3233 -171 6 AAATGATAATGATTTCCATTT Shewana3_3235
Shewanella sp W3-18-1
Position: -178
Score: 6.0511
Sequence: AAATGATAATGATTACCATTT
Locus tag: Sputw3181_3201
Name: hmuA
Funciton: TonB-dependent haem/haemoglobin receptor, HmuA
Locus tag: Sputw3181_3200
Name: huvX
Funciton: Putative heme iron utilization protein
Locus tag: Sputw3181_3199
Name: null
Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Sputw3181_3199 -178 6.1 AAATGATAATGATTACCATTT Sputw3181_3201
Shewanella woodyi ATCC 51908
Position: -113
Score: 6.468
Sequence: AAATGATAATGATTTTCATTT
Locus tag: Swoo_4004
Name: hmuA
Funciton: TonB-dependent haem/haemoglobin receptor, HmuA
Locus tag: Swoo_4003
Name: huvX
Funciton: Putative heme iron utilization protein
Locus tag: Swoo_4002
Name: null
Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Swoo_4002 -113 6.5 AAATGATAATGATTTTCATTT Swoo_4004