Regulon of Fur in Shewanella amazonensis SB2B

Properties
Regulator type:	Transcription factor
TF locus tag:	Sama_1434
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	43
- Operons	24
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 4.8 Sequence: GAATAACAACCGTTCGCATTT Locus tag: Sama_1718 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	Sama_1718		Two component transcriptional regulator, Winged helix family
Position: -60 Score: 5.4 Sequence: GACTGAGAATGGTTTTCATTT Locus tag: Sama_1270 Name: null Funciton: Hypothetical protein
	Sama_1270		Hypothetical protein
Position: -54 Score: 5 Sequence: CATTGAGAGTAATTATCATTA Locus tag: Sama_1394 Name: SO4423.1 Funciton: TonB-dependent ferric achromobactin receptor
	Sama_1394	SO4423.1	TonB-dependent ferric achromobactin receptor
Position: -50 Score: 5.9 Sequence: AAGTGATAACTATTATCATTT Locus tag: Sama_3636 Name: null Funciton: Conserved hypothetical inner membrane protein
	Sama_3636		Conserved hypothetical inner membrane protein
Position: -84 Score: 5.1 Sequence: CAATGCGAATCGTTTGCATTT Locus tag: Sama_0589 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Sama_0588 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Sama_0587 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
	Sama_0589	Sfri_4035	Conserved hypothetical signal peptide protein, possibly porin
	Sama_0588		FMN-binding domain-containing protein
	Sama_0587	COG3182	PepSY-associated TM helix domain-containing protein
Position: -52 Score: 5.9 Sequence: TATTGATAATAATTATCAATT Locus tag: Sama_2470 Name: null Funciton: Hypothetical inner membrane protein
	Sama_2470		Hypothetical inner membrane protein
Position: -65 Score: 6 Sequence: TAATGATAATTATTTTTATTT Locus tag: Sama_3412 Name: Sden_3064 Funciton: TonB-dependent receptor Locus tag: Sama_3413 Name: piuB Funciton: Uncharacterized iron-regulated membrane protein, PiuB
	Sama_3412	Sden_3064	TonB-dependent receptor
	Sama_3413	piuB	Uncharacterized iron-regulated membrane protein, PiuB
Position: -122 Score: 4.7 Sequence: CAATAAGAATAATTAGCCTTT Locus tag: Sama_2530 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: Sama_2529 Name: bfr1 Funciton: Bacterioferritin subunit 1
	Sama_2530	bfr2	Bacterioferritin subunit 2
	Sama_2529	bfr1	Bacterioferritin subunit 1
Position: -59 Score: 5.5 Sequence: TGATGAGAACGGTTTTTATTT Locus tag: Sama_3040 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	Sama_3040	bfd	Bacterioferritin-associated ferredoxin
Position: -297 Score: 5.6 Sequence: TAACGATAATAATTTTCAATT Position: -150 Score: 4.7 Sequence: AAATCAGACTAATTATTAATA Locus tag: Sama_1213 Name: mtrD Funciton: Periplasmic decaheme cytochrome c, MtrD Locus tag: Sama_1212 Name: mtrE Funciton: Outer membrane protein, MtrE Locus tag: Sama_1211 Name: mtrF Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrF Locus tag: Sama_1210 Name: omcA Funciton: Surface localized decaheme cytochrome c lipoprotein, OmcA
	Sama_1213	mtrD	Periplasmic decaheme cytochrome c, MtrD
	Sama_1212	mtrE	Outer membrane protein, MtrE
	Sama_1211	mtrF	Surface localized decaheme cytochrome c lipoprotein, MtrF
	Sama_1210	omcA	Surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -2 Score: 5.9 Sequence: AAATGATAACTATTGTCATTA Locus tag: Sama_0590 Name: Sama_0590 Funciton: TonB-dependent receptor
	Sama_0590	Sama_0590	TonB-dependent receptor
Position: -40 Score: 5.6 Sequence: TAATGCGAATCATTTTTATTT Locus tag: Sama_1866 Name: null Funciton: Probable two-component system sensor kinase
	Sama_1866		Probable two-component system sensor kinase
Position: -113 Score: 5.1 Sequence: TAATGATAAGTGTTACTATTT Locus tag: Sama_0141 Name: ftn Funciton: Ferritin, Ftn
	Sama_0141	ftn	Ferritin, Ftn
Position: -119 Score: 5.6 Sequence: AATTGAAAATTATTATCGTTA Locus tag: Sama_1214 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Sama_1215 Name: feoB Funciton: Ferrous iron transport protein B
	Sama_1214	feoA	Ferrous iron transport protein A
	Sama_1215	feoB	Ferrous iron transport protein B
Position: -73 Score: 4.8 Sequence: TGGTGAGAATTACTCTCAATT Locus tag: Sama_2808 Name: null Funciton: Inner membrane protein with PepSY TM helix Locus tag: Sama_2809 Name: null Funciton: Putative exported protein Locus tag: Sama_2810 Name: null Funciton: putative exported protein
	Sama_2808		Inner membrane protein with PepSY TM helix
	Sama_2809		Putative exported protein
	Sama_2810		putative exported protein
Position: -57 Score: 5.8 Sequence: TAGTGATAATAATTATCATTA Locus tag: Sama_0666 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Sama_0667 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Sama_0668 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
	Sama_0666	fbpA	ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
	Sama_0667	fbpB	ABC iron(III) transporter, inner membrane subunit, FbpB
	Sama_0668	fbpC	ABC iron(III) transporter, ATPase subunit, FbpC
Position: -68 Score: 5.7 Sequence: AATTGAGAATTATTCTCAACA Locus tag: Sama_2875 Name: null Funciton: TonB-dependent siderophore receptor
	Sama_2875		TonB-dependent siderophore receptor
Position: -84 Score: 5.4 Sequence: TAATGCGAACTATTTTCATAT Locus tag: Sama_2655 Name: Sama_2655 Funciton: Conserved hypothetical protein Locus tag: Sama_2656 Name: Sama_2656 Funciton: FMN-binding domain protein Locus tag: Sama_2657 Name: Sama_2657 Funciton: ApbE family protein, putative Locus tag: Sama_2658 Name: Sama_2658 Funciton: Hypothetical protein
	Sama_2655	Sama_2655	Conserved hypothetical protein
	Sama_2656	Sama_2656	FMN-binding domain protein
	Sama_2657	Sama_2657	ApbE family protein, putative
	Sama_2658	Sama_2658	Hypothetical protein
Position: -52 Score: 6 Sequence: ATATGATAACTATTCTCATTT Locus tag: Sama_1788 Name: Sfri_2008 Funciton: Hypothetical protein
	Sama_1788	Sfri_2008	Hypothetical protein
Position: -65 Score: 6 Sequence: TAATGATAATTATTTTTATTT Locus tag: Sama_3412 Name: null Funciton: TonB-dependent siderophore receptor Locus tag: Sama_3413 Name: piuB Funciton: Iron-uptake factor PiuB
	Sama_3412		TonB-dependent siderophore receptor
	Sama_3413	piuB	Iron-uptake factor PiuB
Position: -38 Score: 5.4 Sequence: AGATGAAAACCATTCTCGTTA Locus tag: Sama_0949 Name: null Funciton: Cytochrome B561 Locus tag: Sama_0950 Name: yceI Funciton: Protein yceI precursor
	Sama_0949		Cytochrome B561
	Sama_0950	yceI	Protein yceI precursor
Position: -72 Score: 5.8 Sequence: AATTGAGAATGTTTATCATTT Locus tag: Sama_3409 Name: null Funciton: Conserved hypothetical protein Locus tag: Sama_3410 Name: null Funciton: Iron-regulated membrane protein Locus tag: Sama_3411 Name: null Funciton: Conserved hypothetical inner membrane protein
	Sama_3409		Conserved hypothetical protein
	Sama_3410		Iron-regulated membrane protein
	Sama_3411		Conserved hypothetical inner membrane protein
Position: -42 Score: 5.5 Sequence: TAATGAGATTTATTTGCATTA Locus tag: Sama_1896 Name: null Funciton: Signalling protein with EAL domain
	Sama_1896		Signalling protein with EAL domain
Position: -73 Score: 5.9 Sequence: AAATGCTAATCATTATCAATT Locus tag: Sama_3641 Name: null Funciton: TonB-dependent siderophore receptor
	Sama_3641		TonB-dependent siderophore receptor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella amazonensis SB2B

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --