Regulon of Fur in Shewanella woodyi ATCC 51908

Properties
Regulator type:	Transcription factor
TF locus tag:	Swoo_1842
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	48
- Operons	29
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -350 Score: 5.4 Sequence: AAATGATAATTATTTGTATAT Locus tag: Swoo_1506 Name: null Funciton: Hypothetical protein Locus tag: Swoo_1507 Name: puiB Funciton: Uncharacterized iron-regulated membrane protein, PiuB
	Swoo_1506		Hypothetical protein
	Swoo_1507	puiB	Uncharacterized iron-regulated membrane protein, PiuB
Position: -25 Score: 5.4 Sequence: AAATGATAATTATTTGTATAT Locus tag: Swoo_1505 Name: Sfri_0202 Funciton: Conserved hypothetical protein
	Swoo_1505	Sfri_0202	Conserved hypothetical protein
Position: -79 Score: 5.8 Sequence: TAATGAAAACGATTCGCATTT Locus tag: Swoo_0790 Name: Sfri_0810 Funciton: Hypothetical protein Locus tag: Swoo_0791 Name: Sfri_0811 Funciton: Imelysin peptidase family lipoprotein Locus tag: Swoo_0792 Name: Sfri_0812 Funciton: Protein of unknown function DUF1111
	Swoo_0790	Sfri_0810	Hypothetical protein
	Swoo_0791	Sfri_0811	Imelysin peptidase family lipoprotein
	Swoo_0792	Sfri_0812	Protein of unknown function DUF1111
Position: -83 Score: 5.4 Sequence: GAATGATAACAATTTGCATTA Locus tag: Swoo_3788 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Swoo_3789 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Swoo_3790 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
	Swoo_3788	Sfri_4035	Conserved hypothetical signal peptide protein, possibly porin
	Swoo_3789		FMN-binding domain-containing protein
	Swoo_3790	COG3182	PepSY-associated TM helix domain-containing protein
Position: -218 Score: 4.8 Sequence: TAGTGATAATCGTTCTCACAA Position: -125 Score: 5.6 Sequence: AATTGAAAACTATTATCGTTT Locus tag: Swoo_3123 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Swoo_3122 Name: feoB Funciton: Ferrous iron transport protein B
	Swoo_3123	feoA	Ferrous iron transport protein A
	Swoo_3122	feoB	Ferrous iron transport protein B
Position: -42 Score: 6 Sequence: AAATGATAATGATTATCAGTT Locus tag: Swoo_1339 Name: null Funciton: Hypothetical inner membrane protein
	Swoo_1339		Hypothetical inner membrane protein
Position: -66 Score: 5.2 Sequence: CAATGCTAATGATTTTCAACT Locus tag: Swoo_3151 Name: null Funciton: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
	Swoo_3151		Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
Position: -70 Score: 6.3 Sequence: AATTGAGAATAATTCTCATTT Locus tag: Swoo_2977 Name: null Funciton: Hypothetical inner membrane protein
	Swoo_2977		Hypothetical inner membrane protein
Position: -50 Score: 6.3 Sequence: AAATGAGAACCATTATCATTT Locus tag: Swoo_4887 Name: null Funciton: Conserved hypothetical inner membrane protein
	Swoo_4887		Conserved hypothetical inner membrane protein
Position: -80 Score: 6.5 Sequence: AAATGAAAATCATTATCATTT Locus tag: Swoo_4005 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: Swoo_4006 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Swoo_4007 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: Swoo_4008 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: Swoo_4009 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: Swoo_4010 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
	Swoo_4005	tonB	TonB mediated energy transduction system, energy transducer component, TonB
	Swoo_4006	exbB	TonB mediated energy transduction system, inner membrane component, ExbB
	Swoo_4007	exbD	TonB mediated energy transduction system, inner membrane component, ExbD
	Swoo_4008	hmuB	ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
	Swoo_4009	hmuC	ABC hemin transporter, inner membrane subunit, HmuC
	Swoo_4010	hmuD	ABC hemin transporter, ATPase subunit, HmuD
Position: -36 Score: 5.4 Sequence: TGTTGATAATTGTTCGCATTT Locus tag: Swoo_2294 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	Swoo_2294		Two component transcriptional regulator, Winged helix family
Position: -176 Score: 5.7 Sequence: TAATGAGAATTATTTGTATTT Locus tag: Swoo_4766 Name: ftn Funciton: Ferritin, Ftn
	Swoo_4766	ftn	Ferritin, Ftn
Position: -81 Score: 5.9 Sequence: AATTGATAATCGTTATCAATT Locus tag: Swoo_0946 Name: null Funciton: TonB-dependent siderophore receptor
	Swoo_0946		TonB-dependent siderophore receptor
Position: -2 Score: 5.5 Sequence: AAATGATAATCAATCCCATTA Locus tag: Swoo_3787 Name: Sama_0590 Funciton: TonB-dependent receptor
	Swoo_3787	Sama_0590	TonB-dependent receptor
Position: -62 Score: 5.9 Sequence: AGTTGATAACCATTCTCATTT Locus tag: Swoo_2428 Name: Sfri_2008 Funciton: Hypothetical protein
	Swoo_2428	Sfri_2008	Hypothetical protein
Position: -51 Score: 6 Sequence: TAATGATAATCGTTATCATCT Locus tag: Swoo_3375 Name: null Funciton: TonB-dependent receptor
	Swoo_3375		TonB-dependent receptor
Position: -49 Score: 6.2 Sequence: AAATGATATTAATTCTCATTT Locus tag: Swoo_1070 Name: Swoo_1070 Funciton: Hypothetical protein
	Swoo_1070	Swoo_1070	Hypothetical protein
Position: -79 Score: 5.5 Sequence: AATTAATAATCGTTTTTATTT Locus tag: Swoo_0997 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Swoo_0998 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
	Swoo_0997	fbpB	ABC iron(III) transporter, inner membrane subunit, FbpB
	Swoo_0998	fbpC	ABC iron(III) transporter, ATPase subunit, FbpC
Position: -57 Score: 5.4 Sequence: AATTGATAACTATTATCATCG Locus tag: Swoo_0996 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
	Swoo_0996	fbpA	ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
Position: -167 Score: 4.5 Sequence: AAATGATAATGCTTAATGTTA Locus tag: Swoo_3608 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: Swoo_3607 Name: bfr1 Funciton: Bacterioferritin subunit 1
	Swoo_3608	bfr2	Bacterioferritin subunit 2
	Swoo_3607	bfr1	Bacterioferritin subunit 1
Position: -56 Score: 5.6 Sequence: CATTGAGAATCGTTTTCATTT Locus tag: Swoo_4187 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	Swoo_4187	bfd	Bacterioferritin-associated ferredoxin
Position: -113 Score: 6.5 Sequence: AAATGATAATGATTTTCATTT Locus tag: Swoo_4004 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Swoo_4003 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Swoo_4002 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
	Swoo_4004	hmuA	TonB-dependent haem/haemoglobin receptor, HmuA
	Swoo_4003	huvX	Putative heme iron utilization protein
	Swoo_4002		Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
Position: -62 Score: 5.9 Sequence: TAATGGGAATAATTATCATTT Locus tag: Swoo_0585 Name: IucABC Funciton: Aerobactin synthetase , IucABC Locus tag: Swoo_0586 Name: IucD Funciton: lysine N6-hydroxylase, IucD Locus tag: Swoo_0587 Name: SO4423.1 Funciton: TonB-dependent ferric achromobactin receptor
	Swoo_0585	IucABC	Aerobactin synthetase , IucABC
	Swoo_0586	IucD	lysine N6-hydroxylase, IucD
	Swoo_0587	SO4423.1	TonB-dependent ferric achromobactin receptor
Position: -96 Score: 5.7 Sequence: AAATAAAAACCGTTCTCATTA Locus tag: Swoo_3307 Name: null Funciton: Conserved hypothetical protein Locus tag: Swoo_3308 Name: null Funciton: Iron-regulated membrane protein Locus tag: Swoo_3309 Name: null Funciton: Conserved hypothetical inner membrane protein
	Swoo_3307		Conserved hypothetical protein
	Swoo_3308		Iron-regulated membrane protein
	Swoo_3309		Conserved hypothetical inner membrane protein
Position: -48 Score: 5.6 Sequence: AATTGCGAACAATTATCATTA Locus tag: Swoo_2596 Name: null Funciton: Probable two-component system sensor kinase
	Swoo_2596		Probable two-component system sensor kinase
Position: -120 Score: 5.8 Sequence: TATTGATAATAAATATCATTT Locus tag: Swoo_2460 Name: Sbal_0657 Funciton: Hypothetical protein
	Swoo_2460	Sbal_0657	Hypothetical protein
Position: -67 Score: 6.2 Sequence: AAATAAAAATAATTCTCATTT Locus tag: Swoo_4894 Name: null Funciton: TonB-dependent siderophore receptor
	Swoo_4894		TonB-dependent siderophore receptor
Position: -85 Score: 5.2 Sequence: AAATACAAAGCGTTATCATTT Locus tag: Swoo_0123 Name: null Funciton: Hypothetical outer membrane protein
	Swoo_0123		Hypothetical outer membrane protein
Position: -79 Score: 4.6 Sequence: GAATAAGAATCACTCTTATCT Locus tag: Swoo_3124 Name: omcA2 Funciton: Surface localized decaheme cytochrome c lipoprotein, OmcA
	Swoo_3124	omcA2	Surface localized decaheme cytochrome c lipoprotein, OmcA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella woodyi ATCC 51908

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --