Regulon of Fur in Shewanella sp ANA-3

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewana3_1716
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	65
- Operons	36
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 5.4 Sequence: AATTGAAAACTATTATCGTTA Locus tag: Shewana3_2671 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Shewana3_2670 Name: feoB Funciton: Ferrous iron transport protein B
	Shewana3_2671	feoA	Ferrous iron transport protein A
	Shewana3_2670	feoB	Ferrous iron transport protein B
Position: -66 Score: 5.5 Sequence: TATTGATAACAATTCGCATTA Locus tag: Shewana3_2196 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein Locus tag: Shewana3_2195 Name: Sfri_2547 Funciton: Conserved hypothetical protein
	Shewana3_2196	COG3182	PepSY-associated TM helix domain-containing protein
	Shewana3_2195	Sfri_2547	Conserved hypothetical protein
Position: -32 Score: 5.6 Sequence: AAATGATATTGATTCTCGTTT Locus tag: Shewana3_1959 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	Shewana3_1959		Two component transcriptional regulator, Winged helix family
Position: -71 Score: 5.6 Sequence: GACTGATAATAATTTTCATTT Locus tag: Shewana3_2609 Name: null Funciton: Hypothetical protein
	Shewana3_2609		Hypothetical protein
Position: -98 Score: 5.5 Sequence: CAATAAAAATCGTTATCATTT Locus tag: Shewana3_0286 Name: SO4423.1 Funciton: TonB-dependent ferric achromobactin receptor
	Shewana3_0286	SO4423.1	TonB-dependent ferric achromobactin receptor
Position: -224 Score: 6.1 Sequence: AAATGAGAATGATTTGCATTT Locus tag: Shewana3_1510 Name: pubA Funciton: Putrescine monooxygenase, PubA Locus tag: Shewana3_1509 Name: pubB Funciton: N-hydroxyputrescine-succinyl CoA transferase, PubB Locus tag: Shewana3_1508 Name: pubC Funciton: NTP-dependent putrebactin synthetase, PubC Locus tag: Shewana3_1507 Name: putA Funciton: TonB-dependent ferric putrebactin siderophore receptor, PutA Locus tag: Shewana3_1506 Name: putB Funciton: Ferric putrebactin reductase, PutB
	Shewana3_1510	pubA	Putrescine monooxygenase, PubA
	Shewana3_1509	pubB	N-hydroxyputrescine-succinyl CoA transferase, PubB
	Shewana3_1508	pubC	NTP-dependent putrebactin synthetase, PubC
	Shewana3_1507	putA	TonB-dependent ferric putrebactin siderophore receptor, PutA
	Shewana3_1506	putB	Ferric putrebactin reductase, PutB
Position: -125 Score: 5.4 Sequence: TAATGAGAATGCTTTTTATCT Locus tag: Shewana3_0946 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: Shewana3_0947 Name: bfr1 Funciton: Bacterioferritin subunit 1
	Shewana3_0946	bfr2	Bacterioferritin subunit 2
	Shewana3_0947	bfr1	Bacterioferritin subunit 1
Position: -107 Score: 5.5 Sequence: AAATGATAATAATTATTGATT Locus tag: Shewana3_0716 Name: null Funciton: TonB-dependent siderophore receptor Locus tag: Shewana3_0717 Name: piuC Funciton: Iron-uptake factor PiuC
	Shewana3_0716		TonB-dependent siderophore receptor
	Shewana3_0717	piuC	Iron-uptake factor PiuC
Position: -30 Score: 4.9 Sequence: GATTGAAAATGATTTTCACTG Locus tag: Shewana3_2707 Name: null Funciton: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
	Shewana3_2707		Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
Position: -48 Score: 5.8 Sequence: AGATGAAAATCATTATCATTC Locus tag: Shewana3_2944 Name: null Funciton: TonB-dependent receptor
	Shewana3_2944		TonB-dependent receptor
Position: -67 Score: 5.8 Sequence: AGTTGAGAATAATTCTCATCT Locus tag: Shewana3_1485 Name: null Funciton: Hypothetical inner membrane protein
	Shewana3_1485		Hypothetical inner membrane protein
Position: -81 Score: 5.6 Sequence: AGGTGAGAATTATTCTCATCT Locus tag: Shewana3_2862 Name: null Funciton: TonB-dependent heme receptor
	Shewana3_2862		TonB-dependent heme receptor
Position: -54 Score: 5.3 Sequence: ATTTGATAAGCGTTTTCATTT Locus tag: Shewana3_0581 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	Shewana3_0581	bfd	Bacterioferritin-associated ferredoxin
Position: -98 Score: 6 Sequence: AAATGGAAATCATTATCATTT Locus tag: Shewana3_3236 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: Shewana3_3237 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Shewana3_3238 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: Shewana3_3239 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: Shewana3_3240 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: Shewana3_3241 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
	Shewana3_3236	tonB	TonB mediated energy transduction system, energy transducer component, TonB
	Shewana3_3237	exbB	TonB mediated energy transduction system, inner membrane component, ExbB
	Shewana3_3238	exbD	TonB mediated energy transduction system, inner membrane component, ExbD
	Shewana3_3239	hmuB	ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
	Shewana3_3240	hmuC	ABC hemin transporter, inner membrane subunit, HmuC
	Shewana3_3241	hmuD	ABC hemin transporter, ATPase subunit, HmuD
Position: -194 Score: 5.6 Sequence: AATTAATAACAATTCTCAATT Locus tag: Shewana3_0299 Name: Shewmr4_0304 Funciton: TonB-dependent siderophore receptor
	Shewana3_0299	Shewmr4_0304	TonB-dependent siderophore receptor
Position: -64 Score: 5.3 Sequence: TAATGAGATTTATTCTTATTC Locus tag: Shewana3_2675 Name: omcA Funciton: Surface localized decaheme cytochrome c lipoprotein, OmcA
	Shewana3_2675	omcA	Surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -68 Score: 5.7 Sequence: AAATAAAAACAATTCTTATTT Locus tag: Shewana3_4127 Name: null Funciton: TonB-dependent siderophore receptor
	Shewana3_4127		TonB-dependent siderophore receptor
Position: -326 Score: 5.4 Sequence: TAACGATAATAGTTTTCAATT Locus tag: Shewana3_2672 Name: mtrD Funciton: Periplasmic decaheme cytochrome c, MtrD Locus tag: Shewana3_2673 Name: mtrE Funciton: Outer membrane protein, MtrE Locus tag: Shewana3_2674 Name: mtrF Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrF
	Shewana3_2672	mtrD	Periplasmic decaheme cytochrome c, MtrD
	Shewana3_2673	mtrE	Outer membrane protein, MtrE
	Shewana3_2674	mtrF	Surface localized decaheme cytochrome c lipoprotein, MtrF
Position: -132 Score: 5.7 Sequence: AAATGAAAATCATTTTTATCA Locus tag: Shewana3_0132 Name: ftn Funciton: Ferritin, Ftn
	Shewana3_0132	ftn	Ferritin, Ftn
Position: -99 Score: 6 Sequence: AAATGAGAATTATTGTCATCT Locus tag: Shewana3_2551 Name: null Funciton: TonB-dependent siderophore receptor
	Shewana3_2551		TonB-dependent siderophore receptor
Position: -171 Score: 6 Sequence: AAATGATAATGATTTCCATTT Locus tag: Shewana3_3235 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Shewana3_3234 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Shewana3_3233 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
	Shewana3_3235	hmuA	TonB-dependent haem/haemoglobin receptor, HmuA
	Shewana3_3234	huvX	Putative heme iron utilization protein
	Shewana3_3233		Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
Position: -60 Score: 6 Sequence: TAATGAGAATTGTTATCATCT Locus tag: Shewana3_4124 Name: null Funciton: Conserved hypothetical inner membrane protein
	Shewana3_4124		Conserved hypothetical inner membrane protein
Position: -181 Score: 5.6 Sequence: TGTTGATAATAAATATCATTT Locus tag: Shewana3_1014 Name: null Funciton: Inner membrane protein with PepSY TM helix Locus tag: Shewana3_1015 Name: null Funciton: Putative exported protein Locus tag: Shewana3_1016 Name: null Funciton: putative exported protein
	Shewana3_1014		Inner membrane protein with PepSY TM helix
	Shewana3_1015		Putative exported protein
	Shewana3_1016		putative exported protein
Position: -152 Score: 5.1 Sequence: TATTGCGAACTGTTCTCATCA Locus tag: Shewana3_0445 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Shewana3_0446 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Shewana3_0447 Name: null Funciton: Iron-regulated membrane protein
	Shewana3_0445		Iron-regulated inner membrane protein
	Shewana3_0446		Iron-regulated inner membrane protein
	Shewana3_0447		Iron-regulated membrane protein
Position: -63 Score: 5.2 Sequence: AAATGCAAATCGTTCTCAATG Locus tag: Shewana3_0952 Name: null Funciton: TonB-dependent siderophore receptor
	Shewana3_0952		TonB-dependent siderophore receptor
Position: -47 Score: 5.2 Sequence: ATTTAAGAATAATTATCATTC Locus tag: Shewana3_1861 Name: null Funciton: TonB-dependent receptor
	Shewana3_1861		TonB-dependent receptor
Position: -49 Score: 6.1 Sequence: TATTGAAAATTATTATCATTT Locus tag: Shewana3_3929 Name: null Funciton: TonB-dependent receptor
	Shewana3_3929		TonB-dependent receptor
Position: -99 Score: 5.8 Sequence: AAATGATATTGGTTATCATCT Locus tag: Shewana3_3923 Name: viuA Funciton: TonB-dependent receptor
	Shewana3_3923	viuA	TonB-dependent receptor
Position: -76 Score: 5.7 Sequence: AACTGATAACTATTATCATTA Locus tag: Shewana3_3517 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Shewana3_3516 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Shewana3_3515 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
	Shewana3_3517	fbpA	ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
	Shewana3_3516	fbpB	ABC iron(III) transporter, inner membrane subunit, FbpB
	Shewana3_3515	fbpC	ABC iron(III) transporter, ATPase subunit, FbpC
Position: -84 Score: 4.9 Sequence: TAATGATAATGATTTGCGTTG Locus tag: Shewana3_0919 Name: Sama_2655 Funciton: Conserved hypothetical protein Locus tag: Shewana3_0920 Name: Sama_2656 Funciton: FMN-binding domain protein Locus tag: Shewana3_0921 Name: Sama_2657 Funciton: ApbE family protein, putative Locus tag: Shewana3_0922 Name: Sama_2658 Funciton: Hypothetical protein
	Shewana3_0919	Sama_2655	Conserved hypothetical protein
	Shewana3_0920	Sama_2656	FMN-binding domain protein
	Shewana3_0921	Sama_2657	ApbE family protein, putative
	Shewana3_0922	Sama_2658	Hypothetical protein
Position: -59 Score: 5 Sequence: TTATGATAATGACTATTATTT Locus tag: Shewana3_1178 Name: null Funciton: Cytochrome B561 Locus tag: Shewana3_1179 Name: yceI Funciton: Protein yceI precursor
	Shewana3_1178		Cytochrome B561
	Shewana3_1179	yceI	Protein yceI precursor
Position: -44 Score: 6.1 Sequence: AAATGATAATGATTATCACTT Locus tag: Shewana3_1202 Name: null Funciton: Hypothetical inner membrane protein
	Shewana3_1202		Hypothetical inner membrane protein
Position: -86 Score: 4.8 Sequence: AAATCGAATCCATTCTCATTA Locus tag: Shewana3_4052 Name: null Funciton: Hypothetical outer membrane protein
	Shewana3_4052		Hypothetical outer membrane protein
Position: -44 Score: 5 Sequence: AAATGCGAATAATTAGCGATT Locus tag: Shewana3_2237 Name: null Funciton: Signalling protein with EAL domain
	Shewana3_2237		Signalling protein with EAL domain
Position: -177 Score: 5.7 Sequence: AAATGATATTGTTTATCATTT Locus tag: Shewana3_1149 Name: null Funciton: Conserved hypothetical protein Locus tag: Shewana3_1148 Name: null Funciton: Iron-regulated membrane protein Locus tag: Shewana3_1147 Name: null Funciton: Conserved hypothetical inner membrane protein
	Shewana3_1149		Conserved hypothetical protein
	Shewana3_1148		Iron-regulated membrane protein
	Shewana3_1147		Conserved hypothetical inner membrane protein
Position: -177 Score: 5.8 Sequence: GAATGATAATAATTGTCATTT Locus tag: Shewana3_1514 Name: null Funciton: Periplasmic esterase
	Shewana3_1514		Periplasmic esterase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella sp ANA-3

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --