Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sden_2158 gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella denitrificans OS217
Position: -58
Score: 5.7843
Sequence: TATTGAGATTCATTATCATTT
Locus tag: Sden_2159
Name: null
Funciton: TonB-dependent receptor
Locus tag: Sden_2158
Name: null
Funciton: TonB mediate energy transduction system, conserved hypothetical periplasmic component
Locus tag: Sden_2157
Name: ttpc
Funciton: TonB mediated energy transduction system, inner membrane component, TtpC
Locus tag: Sden_2156
Name: exbB
Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Sden_2155
Name: exbD
Funciton: TonB mediated energy transduction system, membrane anchored component, ExbD
Locus tag: Sden_2154
Name: null
Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Sden_2153
Name: tprX
Funciton: TPR repeat-containing protein
Locus tag: Sden_2152
Name: null
Funciton: Inner membrane protein with PepSY TM helix
Locus tag: Sden_2151
Name: null
Funciton: Putative exported protein
Locus tag: Sden_2150
Name: null
Funciton: putative exported protein
Sden_2159-Sden_2158-ttpc-exbB-exbD-Sden_2154-tprX-Sden_2152-Sden_2151-Sden_2150 -58 5.8 TATTGAGATTCATTATCATTT Sden_2159
Shewanella piezotolerans WP3
Position: -84
Score: 5.74799
Sequence: GAATGAGAATCAATATCATTT
Locus tag: swp_4957
Name: null
Funciton: Outer membrane receptor protein, mostly Fe transport
Locus tag: swp_4956
Name: null
Funciton: Probable zinc protease
Locus tag: swp_4955
Name: null
Funciton: ABC-type uncharacterized transport system, permease and ATPase components
Locus tag: swp_4954
Name: null
Funciton: TonB mediate energy transduction system, conserved hypothetical periplasmic component
Locus tag: swp_4953
Name: ttpc
Funciton: TonB mediated energy transduction system, inner membrane component, TtpC
Locus tag: swp_4952
Name: exbB
Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: swp_4950
Name: exbD
Funciton: TonB mediated energy transduction system, membrane anchored component, ExbD
Locus tag: swp_4949
Name: null
Funciton: Hypothetical protein
Locus tag: swp_4948
Name: null
Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: swp_4947
Name: tprX
Funciton: TPR repeat-containing protein
swp_4957-swp_4956-swp_4955-swp_4954-ttpc-exbB-exbD-swp_4949-swp_4948-tprX -84 5.7 GAATGAGAATCAATATCATTT swp_4957