Regulog LexA - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - LexA
- By TF family - LexA
- By effector - DNA damage
- By pathway - SOS response
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 16 | 10 |
| Shewanella putrefaciens CN-32 | 14 | 9 |
| Shewanella sp W3-18-1 | 16 | 10 |
| Shewanella sp ANA-3 | 17 | 10 |
| Shewanella sp MR-4 | 14 | 9 |
| Shewanella sp MR-7 | 17 | 11 |
| Shewanella baltica OS155 | 18 | 11 |
| Shewanella denitrificans OS217 | 15 | 10 |
| Shewanella frigidimarina NCIMB 400 | 14 | 9 |
| Shewanella amazonensis SB2B | 18 | 11 |
| Shewanella loihica PV-4 | 17 | 10 |
| Shewanella pealeana ATCC 700345 | 15 | 10 |
| Shewanella halifaxensis HAW-EB4 | 18 | 12 |
| Shewanella piezotolerans WP3 | 12 | 8 |
| Shewanella sediminis HAW-EB3 | 14 | 9 |
| Shewanella woodyi ATCC 51908 | 15 | 10 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| umuD |
*
Shewanella oneidensis MR-1 Site: position = -32 score = 5.63726 sequence = AACTGTATATTTATACAGTT Gene: SO_A0013: DNA polymerase V, subunit UmuD |
*
Shewanella putrefaciens CN-32 Site: position = -32 score = 5.44547 sequence = AACTGTATATTTGTACAGTT Gene: Sputcn32_0175: DNA polymerase V, subunit UmuD |
*
Shewanella sp W3-18-1 Site: position = -46 score = 5.856 sequence = TACTGTATAAACAAACAGTA Gene: Sputw3181_1083: DNA polymerase V, subunit UmuD |
*2
Shewanella sp ANA-3 Site: position = -23 score = 5.86662 sequence = TACTGTATTAATGTACAGTA Gene: Shewana3_4173: DNA polymerase V, subunit UmuD Site: position = 14 score = 6.03457 sequence = TACTGTATTTACATACAGTA Gene: Shewana3_1833: DNA polymerase V, subunit UmuD |
*
Shewanella sp MR-4 Site: position = 14 score = 6.03306 sequence = TACTGTACTTATATACAGTA Gene: Shewmr4_1782: DNA polymerase V, subunit UmuD |
*
Shewanella sp MR-7 Site: position = 14 score = 6.22485 sequence = TACTGTATTTATATACAGTA Gene: Shewmr7_2195: DNA polymerase V, subunit UmuD |
*2
Shewanella baltica OS155 Site: position = -30 score = 5.64231 sequence = TGCTGTATATAATTACAGTG Gene: Sbal_3554: DNA polymerase V, subunit UmuD Site: position = -34 score = 5.63885 sequence = TACTGTTCATACGTACAGTA Gene: Sbal_2352: DNA polymerase V, subunit UmuD |
*
Shewanella denitrificans OS217 Site: position = -29 score = 5.9556 sequence = TACTGTATATAATTACAGTG Gene: Sden_3236: DNA polymerase V, subunit UmuD |
*2
Shewanella frigidimarina NCIMB 400 Gene: Sfri_3452: DNA polymerase V, subunit UmuD Site: position = -58 score = 5.91351 sequence = TACTGTTTATTTATACAGTG Site: position = -43 score = 4.80666 sequence = CAGTGTGTTTTTATACAGTA Gene: Sfri_1963: DNA polymerase V, subunit UmuD |
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -34 score = 5.69919 sequence = TACTGTATAAACATACAGTT Gene: Spea_2196: DNA polymerase V, subunit UmuD |
*2
Shewanella halifaxensis HAW-EB4 Site: position = -34 score = 5.92564 sequence = TACTGTATAAAAATACAGTG Gene: Shal_2184: DNA polymerase V, subunit UmuD Site: position = -35 score = 5.69768 sequence = TACTGTACAAATATACAGTT Gene: Shal_2170: DNA polymerase V, subunit UmuD |
|
*
Shewanella sediminis HAW-EB3 Site: position = -39 score = 6.14168 sequence = TACTGTATATTTATACAGTA Gene: Ssed_2172: DNA polymerase V, subunit UmuD |
*
Shewanella woodyi ATCC 51908 Site: position = -38 score = 5.29774 sequence = TACTGTATAAAAACACAGTT Gene: Swoo_2465: DNA polymerase V, subunit UmuD |
DNA polymerase V, subunit UmuD |
| umuC |
Gene: SO_A0012: DNA polymerase V, subunit UmuC |
|
Gene: Sputw3181_1082: DNA polymerase V, subunit UmuC |
2
Shewanella sp ANA-3 Gene: Shewana3_4172: DNA polymerase V, subunit UmuC Gene: Shewana3_1832: DNA polymerase V, subunit UmuC |
2
Shewanella sp MR-4 Gene: Shewmr4_3210: DNA polymerase V, subunit UmuC Gene: Shewmr4_2120: DNA polymerase V, subunit UmuC |
Gene: Shewmr7_2196: DNA polymerase V, subunit UmuC |
2
Shewanella baltica OS155 Gene: Sbal_3553: DNA polymerase V, subunit UmuC Gene: Sbal_2353: DNA polymerase V, subunit UmuC |
Gene: Sden_3235: DNA polymerase V, subunit UmuC |
2
Shewanella frigidimarina NCIMB 400 Gene: Sfri_3453: DNA polymerase V, subunit UmuC Gene: Sfri_1964: DNA polymerase V, subunit UmuC |
|
|
Gene: Spea_2195: DNA polymerase V, subunit UmuC |
2
Shewanella halifaxensis HAW-EB4 Gene: Shal_2183: DNA polymerase V, subunit UmuC Gene: Shal_2169: DNA polymerase V, subunit UmuC |
Gene: swp_4680: DNA polymerase V, subunit UmuC |
Gene: Ssed_2171: DNA polymerase V, subunit UmuC |
Gene: Swoo_2466: DNA polymerase V, subunit UmuC |
DNA polymerase V, subunit UmuC |
| CRON 2. | |||||||||||||||||
| xerD |
*
Shewanella oneidensis MR-1 Site: position = -39 score = 5.47588 sequence = TACTGTATAAAATTACAGCG Gene: SO_2037: Site-specific recombinase XerD |
|
|
|
|
*
Shewanella sp MR-7 Site: position = -39 score = 5.40829 sequence = TACTGTATAAAACAACAGTA Gene: Shewmr7_2132: Site-specific recombinase XerD |
|
|
|
*2
Shewanella amazonensis SB2B Site: position = -38 score = 5.87725 sequence = TACTGTTTTTATATACAGTT Gene: Sama_1355: Site-specific recombinase XerD Site: position = -34 score = 5.35077 sequence = CACTGTACGTACATACAGTT Gene: Sama_1633: Site-specific recombinase XerD |
|
|
|
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -48 score = 5.83024 sequence = CACTGTTTTTTTATACAGTA Gene: Swoo_4307: Site-specific recombinase XerD |
Site-specific recombinase XerD |
| CRON 3. | |||||||||||||||||
| yebG |
*
Shewanella oneidensis MR-1 Site: position = -31 score = 5.99668 sequence = TACTGTATATAAAAACAGTG Gene: SO_2604: SOS regulon DNA damage-inducible protein |
*
Shewanella putrefaciens CN-32 Site: position = -30 score = 5.99668 sequence = TACTGTATATAAAAACAGTG Gene: Sputcn32_2205: SOS regulon DNA damage-inducible protein |
*
Shewanella sp W3-18-1 Site: position = -30 score = 5.99668 sequence = TACTGTATATAAAAACAGTG Gene: Sputw3181_1804: SOS regulon DNA damage-inducible protein |
*
Shewanella sp ANA-3 Site: position = -31 score = 5.99668 sequence = TACTGTATATAAAAACAGTG Gene: Shewana3_1775: SOS regulon DNA damage-inducible protein |
*
Shewanella sp MR-4 Site: position = -31 score = 5.99668 sequence = TACTGTATATAAAAACAGTG Gene: Shewmr4_1670: SOS regulon DNA damage-inducible protein |
*
Shewanella sp MR-7 Site: position = -31 score = 5.99668 sequence = TACTGTATATAAAAACAGTG Gene: Shewmr7_1745: SOS regulon DNA damage-inducible protein |
*
Shewanella baltica OS155 Site: position = -31 score = 5.99668 sequence = TACTGTATATAAAAACAGTG Gene: Sbal_2450: SOS regulon DNA damage-inducible protein |
*
Shewanella denitrificans OS217 Site: position = -31 score = 5.99668 sequence = CACTGTATATAAAAACAGTA Gene: Sden_1719: SOS regulon DNA damage-inducible protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -31 score = 5.8639 sequence = CACTGTATATAAAAACAGTG Gene: Sfri_2231: SOS regulon DNA damage-inducible protein |
*
Shewanella amazonensis SB2B Site: position = -31 score = 5.78073 sequence = CACTGTATAAATAAACAGTG Gene: Sama_1582: SOS regulon DNA damage-inducible protein |
*
Shewanella loihica PV-4 Site: position = -31 score = 5.74447 sequence = AACTGTATATAAAAACAGTG Gene: Shew_1799: SOS regulon DNA damage-inducible protein |
*
Shewanella pealeana ATCC 700345 Site: position = -31 score = 5.8639 sequence = CACTGTATATAAAAACAGTG Gene: Spea_1932: SOS regulon DNA damage-inducible protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -31 score = 5.99668 sequence = TACTGTATATAAAAACAGTG Gene: Shal_2367: SOS regulon DNA damage-inducible protein |
*
Shewanella piezotolerans WP3 Site: position = 11 score = 5.99668 sequence = TACTGTATATAAAAACAGTG Gene: swp_2821: SOS regulon DNA damage-inducible protein |
*
Shewanella sediminis HAW-EB3 Site: position = -31 score = 5.87725 sequence = AACTGTATATAAAAACAGTA Gene: Ssed_2486: SOS regulon DNA damage-inducible protein |
*
Shewanella woodyi ATCC 51908 Site: position = -31 score = 5.87725 sequence = AACTGTATATAAAAACAGTA Gene: Swoo_2130: SOS regulon DNA damage-inducible protein |
SOS regulon DNA damage-inducible protein |
| yebR |
Gene: SO_2603: COG1956, GAF domain-containing protein |
Gene: Sputcn32_2204: COG1956, GAF domain-containing protein |
Gene: Sputw3181_1805: COG1956, GAF domain-containing protein |
Gene: Shewana3_1776: COG1956, GAF domain-containing protein |
Gene: Shewmr4_1671: COG1956, GAF domain-containing protein |
Gene: Shewmr7_1746: COG1956, GAF domain-containing protein |
Gene: Sbal_2449: COG1956, GAF domain-containing protein |
Gene: Sden_1720: COG1956, GAF domain-containing protein |
Gene: Sfri_2230: COG1956, GAF domain-containing protein |
Gene: Sama_1583: COG1956, GAF domain-containing protein |
Gene: Shew_1800: COG1956, GAF domain-containing protein |
Gene: Spea_1933: COG1956, GAF domain-containing protein |
Gene: Shal_2366: COG1956, GAF domain-containing protein |
Gene: swp_2820: COG1956, GAF domain-containing protein |
Gene: Ssed_2485: COG1956, GAF domain-containing protein |
Gene: Swoo_2131: COG1956, GAF domain-containing protein |
COG1956, GAF domain-containing protein |
| CRON 4. | |||||||||||||||||
| dinB |
*
Shewanella oneidensis MR-1 Site: position = -44 score = 5.87725 sequence = AACTGTTTTTATATACAGTA Gene: SO_1114: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella putrefaciens CN-32 Site: position = 20 score = 5.74501 sequence = TACTGGTTTTATATACAGTA Gene: Sputcn32_0951: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella sp W3-18-1 Site: position = -43 score = 5.74501 sequence = TACTGGTTTTATATACAGTA Gene: Sputw3181_3225: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella sp ANA-3 Site: position = -44 score = 6.12946 sequence = TACTGTTTTTATATACAGTA Gene: Shewana3_0949: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella sp MR-4 Site: position = -44 score = 6.12946 sequence = TACTGTTTTTATATACAGTA Gene: Shewmr4_0947: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella sp MR-7 Site: position = -44 score = 6.12946 sequence = TACTGTTTTTATATACAGTA Gene: Shewmr7_0985: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella baltica OS155 Site: position = -43 score = 6.12946 sequence = TACTGTTTTTATATACAGTA Gene: Sbal_0935: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella denitrificans OS217 Site: position = -52 score = 5.83024 sequence = CACTGTTTTTTTATACAGTA Gene: Sden_1185: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -57 score = 6.12946 sequence = TACTGTTTTTATATACAGTA Gene: Sfri_0961: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella amazonensis SB2B Site: position = -36 score = 6.12946 sequence = TACTGTTTTTATATACAGTA Gene: Sama_2527: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella loihica PV-4 Site: position = -43 score = 5.85449 sequence = TACTGTTTAAATGTACAGTA Gene: Shew_2871: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella pealeana ATCC 700345 Site: position = -44 score = 6.12946 sequence = TACTGTTTTTATATACAGTA Gene: Spea_3092: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -44 score = 6.12946 sequence = TACTGTTTTTATATACAGTA Gene: Shal_3176: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella piezotolerans WP3 Site: position = -95 score = 6.12946 sequence = TACTGTTTTTATATACAGTA Gene: swp_1179: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella sediminis HAW-EB3 Site: position = -56 score = 6.04628 sequence = TACTGTTTAAATATACAGTA Gene: Ssed_3422: DNA polymerase IV (EC 2.7.7.7) |
*
Shewanella woodyi ATCC 51908 Site: position = -52 score = 5.99668 sequence = CACTGTTTTTATATACAGTA Gene: Swoo_3604: DNA polymerase IV (EC 2.7.7.7) |
DNA polymerase IV (EC 2.7.7.7) |
| CRON 5. | |||||||||||||||||
| recN |
*
Shewanella oneidensis MR-1 Site: position = -72 score = 5.76698 sequence = TACTGTATATAAAATCAGTA Site: position = -50 score = 5.57589 sequence = TACTGTTTATCAATACAGTG Gene: SO_3462: DNA repair protein RecN |
*
Shewanella putrefaciens CN-32 Site: position = -50 score = 5.57589 sequence = TACTGTTTATCAATACAGTG Site: position = -72 score = 5.76698 sequence = TACTGTATATAAAATCAGTA Gene: Sputcn32_2771: DNA repair protein RecN |
*
Shewanella sp W3-18-1 Site: position = -72 score = 5.76698 sequence = TACTGTATATAAAATCAGTA Site: position = -50 score = 5.57589 sequence = TACTGTTTATCAATACAGTG Gene: Sputw3181_1241: DNA repair protein RecN |
*
Shewanella sp ANA-3 Site: position = -72 score = 5.86238 sequence = TACTGTATATAAATTCAGTA Site: position = -50 score = 5.57589 sequence = TACTGTTTATCAATACAGTG Gene: Shewana3_1104: DNA repair protein RecN |
*
Shewanella sp MR-4 Site: position = -72 score = 5.86238 sequence = TACTGTATATAAATTCAGTA Site: position = -50 score = 5.57589 sequence = TACTGTTTATCAATACAGTG Gene: Shewmr4_1104: DNA repair protein RecN |
*
Shewanella sp MR-7 Site: position = -72 score = 5.86238 sequence = TACTGTATATAAATTCAGTA Site: position = -50 score = 5.57589 sequence = TACTGTTTATCAATACAGTG Gene: Shewmr7_1170: DNA repair protein RecN |
*
Shewanella baltica OS155 Site: position = -72 score = 5.76698 sequence = TACTGTATATAAAATCAGTA Site: position = -50 score = 5.57589 sequence = TACTGTTTATCAATACAGTG Gene: Sbal_3153: DNA repair protein RecN |
*
Shewanella denitrificans OS217 Site: position = -71 score = 5.44579 sequence = TACTGTATAAAAAACCAGTG Site: position = -49 score = 5.57589 sequence = TACTGTTTATCAATACAGTG Gene: Sden_1151: DNA repair protein RecN |
*
Shewanella frigidimarina NCIMB 400 Site: position = -50 score = 5.57589 sequence = TACTGTTTATCAATACAGTG Site: position = -72 score = 5.76698 sequence = TACTGTATATAAAATCAGTA Gene: Sfri_1043: DNA repair protein RecN |
*
Shewanella amazonensis SB2B Site: position = -73 score = 5.40875 sequence = TACTGTACAAAAAATCAGTA Site: position = -51 score = 5.2956 sequence = TACTGTGTATCAATACAGTA Gene: Sama_1026: DNA repair protein RecN |
*
Shewanella loihica PV-4 Site: position = -62 score = 5.69594 sequence = TACTGTATAAAAATTCAGTA Site: position = -40 score = 4.94534 sequence = TACTGTGCATGAATACAGTA Gene: Shew_1196: DNA repair protein RecN |
*
Shewanella pealeana ATCC 700345 Site: position = -40 score = 5.30243 sequence = TACTGTTTAACCATACAGTG Site: position = -62 score = 5.856 sequence = TACTGTATGAATAAACAGTA Gene: Spea_1169: DNA repair protein RecN |
*
Shewanella halifaxensis HAW-EB4 Site: position = -62 score = 5.79193 sequence = TACTGTATAGATAAACAGTA Site: position = -40 score = 5.49272 sequence = TACTGTTTAACTATACAGTG Gene: Shal_1212: DNA repair protein RecN |
*
Shewanella piezotolerans WP3 Site: position = -61 score = 5.70867 sequence = TACTGTATAGAAAAACAGTA Site: position = -39 score = 5.57589 sequence = TACTGTTTATCAATACAGTG Gene: swp_1346: DNA repair protein RecN |
*
Shewanella sediminis HAW-EB3 Site: position = -40 score = 5.45456 sequence = TACTGTTTAAAAACACAGTA Site: position = -62 score = 5.76698 sequence = TACTGTATATAAAATCAGTA Gene: Ssed_1281: DNA repair protein RecN |
*
Shewanella woodyi ATCC 51908 Site: position = -64 score = 5.93766 sequence = TACTGTATTTATGAACAGTA Site: position = -42 score = 5.93766 sequence = TACTGTTCATAAATACAGTA Gene: Swoo_3359: DNA repair protein RecN |
DNA repair protein RecN |
| CRON 6. | |||||||||||||||||
| lexA |
*
Shewanella oneidensis MR-1 Site: position = -45 score = 5.88597 sequence = TACTGTATATACTAACAGTA Site: position = -26 score = 5.01913 sequence = AACTGTATAGAAAAACAGGA Gene: SO_4603: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella putrefaciens CN-32 Site: position = -45 score = 5.88597 sequence = TACTGTATATACTAACAGTA Site: position = -26 score = 5.01913 sequence = AACTGTATAGAAAAACAGGA Gene: Sputcn32_3780: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella sp W3-18-1 Site: position = -26 score = 5.01913 sequence = AACTGTATAGAAAAACAGGA Site: position = -45 score = 5.88597 sequence = TACTGTATATACTAACAGTA Gene: Sputw3181_0135: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella sp ANA-3 Site: position = -45 score = 5.88597 sequence = TACTGTATATACTAACAGTA Site: position = -26 score = 5.01913 sequence = AACTGTATAGAAAAACAGGA Gene: Shewana3_3989: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella sp MR-4 Site: position = -45 score = 5.88597 sequence = TACTGTATATACTAACAGTA Site: position = -26 score = 5.01913 sequence = AACTGTATAGAAAAACAGGA Gene: Shewmr4_3789: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella sp MR-7 Site: position = -45 score = 5.88597 sequence = TACTGTATATACTAACAGTA Site: position = -26 score = 5.01913 sequence = AACTGTATAGAAAAACAGGA Gene: Shewmr7_3862: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella baltica OS155 Site: position = -26 score = 5.01913 sequence = AACTGTATAGAAAAACAGGA Site: position = -45 score = 5.88597 sequence = TACTGTATATACTAACAGTA Gene: Sbal_0156: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella denitrificans OS217 Site: position = -45 score = 5.14443 sequence = TACTGTATATAATGACAGTC Site: position = -26 score = 5.10565 sequence = CACTGTATAAAAAGACAGGA Gene: Sden_3515: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -45 score = 5.01165 sequence = CACTGTATATAATGACAGTC Site: position = -26 score = 5.10565 sequence = CACTGTATAAAAAGACAGGA Gene: Sfri_0260: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella amazonensis SB2B Site: position = -45 score = 5.5987 sequence = TACTGTATATACTGACAGTA Site: position = -26 score = 5.01913 sequence = AACTGTATAGAAAAACAGGA Gene: Sama_3481: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella loihica PV-4 Site: position = -45 score = 4.90916 sequence = TACTGTATATACTGACAGGT Site: position = -26 score = 4.79379 sequence = TACTGTATGGAAAGACAGGA Gene: Shew_0127: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella pealeana ATCC 700345 Site: position = -45 score = 5.19643 sequence = TACTGTATATACTAACAGGT Site: position = -26 score = 4.85129 sequence = TACTGTATAGAAAGACAGGG Gene: Spea_3997: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -45 score = 4.90916 sequence = TACTGTATATACTGACAGGT Site: position = -26 score = 4.85129 sequence = TACTGTATAGAAAGACAGGG Gene: Shal_0260: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella piezotolerans WP3 Site: position = -45 score = 5.19643 sequence = TACTGTATATACTAACAGGT Site: position = -26 score = 5.01913 sequence = TACTGTATAGAAAAACAGGT Gene: swp_4821: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella sediminis HAW-EB3 Site: position = -45 score = 5.63376 sequence = TACTGTATATACTAACAGTT Site: position = -26 score = 4.98407 sequence = TACTGTATAGAAAGACAGGA Gene: Ssed_0200: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Shewanella woodyi ATCC 51908 Site: position = -26 score = 4.98407 sequence = TACTGTATAGAAAGACAGGA Site: position = -45 score = 5.34649 sequence = TACTGTATATACTGACAGTT Gene: Swoo_0180: SOS-response repressor and protease LexA (EC 3.4.21.88) |
SOS-response repressor and protease LexA (EC 3.4.21.88) |
| sulA |
Gene: SO_4604: Cell division inhibitor sulA |
Gene: Sputcn32_3781: Cell division inhibitor sulA |
Gene: Sputw3181_0134: Cell division inhibitor sulA |
Gene: Shewana3_3990: Cell division inhibitor sulA |
Gene: Shewmr4_3790: Cell division inhibitor sulA |
Gene: Shewmr7_3863: Cell division inhibitor sulA |
Gene: Sbal_0155: Cell division inhibitor sulA |
Gene: Sden_3516: Cell division inhibitor sulA |
Gene: Sfri_0259: Cell division inhibitor sulA |
Gene: Sama_3482: Cell division inhibitor sulA |
Gene: Shew_0126: Cell division inhibitor sulA |
Gene: Spea_3998: Cell division inhibitor sulA |
Gene: Shal_0259: Cell division inhibitor sulA |
Gene: swp_4822: Cell division inhibitor sulA |
Gene: Ssed_0199: Cell division inhibitor sulA |
Gene: Swoo_0179: Cell division inhibitor sulA |
Cell division inhibitor sulA |
| CRON 7. | |||||||||||||||||
| topB |
*
Shewanella oneidensis MR-1 Site: position = -32 score = 5.70393 sequence = TACTGTAATTATATCCAGTA Gene: SO_3061: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella putrefaciens CN-32 Site: position = -32 score = 5.57115 sequence = TACTGTAATTATATCCAGTG Gene: Sputcn32_2435: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella sp W3-18-1 Site: position = -32 score = 5.57115 sequence = TACTGTAATTATATCCAGTG Gene: Sputw3181_1573: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella sp ANA-3 Site: position = -32 score = 5.43837 sequence = CACTGTAATTATATCCAGTG Gene: Shewana3_1486: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella sp MR-4 Site: position = -32 score = 5.57115 sequence = CACTGTAATTATATCCAGTA Gene: Shewmr4_1433: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella sp MR-7 Site: position = 30 score = 5.57115 sequence = CACTGTAATTATATCCAGTA Gene: Shewmr7_1498: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella baltica OS155 Site: position = -32 score = 5.57115 sequence = TACTGTAATTATATCCAGTG Gene: Sbal_2736: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella denitrificans OS217 Site: position = -41 score = 5.63254 sequence = CACTGTAATTACATACAGTG Gene: Sden_2400: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -67 score = 5.753 sequence = TACTGTAAATTTATACAGTT Gene: Sfri_1401: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella amazonensis SB2B Site: position = 29 score = 5.29769 sequence = TACTGTAAATTCATCCAGTG Gene: Sama_2145: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella loihica PV-4 Site: position = -32 score = 5.90981 sequence = TACTGTTAATTTATACAGTA Gene: Shew_2299: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella pealeana ATCC 700345 Site: position = -36 score = 5.90981 sequence = TACTGTTAATTTATACAGTA Gene: Spea_1625: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -36 score = 5.90981 sequence = TACTGTTAATTTATACAGTA Gene: Shal_2636: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella piezotolerans WP3 Site: position = -36 score = 5.77703 sequence = TACTGTTAATTTATACAGTG Gene: swp_3111: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella sediminis HAW-EB3 Site: position = -38 score = 5.39258 sequence = TACTGGTAATTTATACAGTG Gene: Ssed_1658: DNA topoisomerase III (EC 5.99.1.2) |
*
Shewanella woodyi ATCC 51908 Site: position = -35 score = 5.39258 sequence = TACTGGTAATTTATACAGTG Gene: Swoo_2976: DNA topoisomerase III (EC 5.99.1.2) |
DNA topoisomerase III (EC 5.99.1.2) |
| CRON 8. | |||||||||||||||||
| recA |
*
Shewanella oneidensis MR-1 Site: position = -127 score = 5.59316 sequence = TACTGTATGATTGTACAGTA Gene: SO_3430: Recombinase A |
*
Shewanella putrefaciens CN-32 Site: position = -129 score = 5.59316 sequence = TACTGTATGATTGTACAGTA Gene: Sputcn32_2747: Recombinase A |
*
Shewanella sp W3-18-1 Site: position = -129 score = 5.59316 sequence = TACTGTATGATTGTACAGTA Gene: Sputw3181_1265: Recombinase A |
*
Shewanella sp ANA-3 Site: position = -128 score = 5.59316 sequence = TACTGTATGATTGTACAGTA Gene: Shewana3_1126: Recombinase A |
*
Shewanella sp MR-4 Site: position = -128 score = 5.59316 sequence = TACTGTATGATTGTACAGTA Gene: Shewmr4_1125: Recombinase A |
*
Shewanella sp MR-7 Site: position = -128 score = 5.59316 sequence = TACTGTATGATTGTACAGTA Gene: Shewmr7_1196: Recombinase A |
*
Shewanella baltica OS155 Site: position = -127 score = 5.59316 sequence = TACTGTATGATTGTACAGTA Gene: Sbal_3117: Recombinase A |
*
Shewanella denitrificans OS217 Site: position = -203 score = 5.78496 sequence = TACTGTATGATTATACAGTA Gene: Sden_1208: Recombinase A |
*
Shewanella frigidimarina NCIMB 400 Site: position = -113 score = 5.53061 sequence = TACTGTATGACTATACAGTA Gene: Sfri_1062: Recombinase A |
*
Shewanella amazonensis SB2B Site: position = -115 score = 5.59316 sequence = TACTGTATGATTGTACAGTA Gene: Sama_1046: Recombinase A |
*
Shewanella loihica PV-4 Site: position = -127 score = 5.59316 sequence = TACTGTATGATTGTACAGTA Gene: Shew_1215: Recombinase A |
*
Shewanella pealeana ATCC 700345 Site: position = -124 score = 5.59316 sequence = TACTGTATGATTGTACAGTA Gene: Spea_1195: Recombinase A |
*
Shewanella halifaxensis HAW-EB4 Site: position = -124 score = 5.59316 sequence = TACTGTATGATTGTACAGTA Gene: Shal_1232: Recombinase A |
*
Shewanella piezotolerans WP3 Site: position = -123 score = 5.59316 sequence = TACTGTATGATTGTACAGTA Gene: swp_1366: Recombinase A |
*
Shewanella sediminis HAW-EB3 Site: position = -135 score = 5.59316 sequence = TACTGTATGATTGTACAGTA Gene: Ssed_1300: Recombinase A |
*
Shewanella woodyi ATCC 51908 Site: position = -124 score = 5.53061 sequence = TACTGTATGACTATACAGTA Gene: Swoo_3340: Recombinase A |
Recombinase A |
| recX |
Gene: SO_3429: Regulatory protein RecX |
Gene: Sputcn32_2746: Regulatory protein RecX |
Gene: Sputw3181_1266: Regulatory protein RecX |
Gene: Shewana3_1127: Regulatory protein RecX |
Gene: Shewmr4_1126: Regulatory protein RecX |
Gene: Shewmr7_1197: Regulatory protein RecX |
Gene: Sbal_3116: Regulatory protein RecX |
Gene: Sden_0902: Regulatory protein RecX |
Gene: Sfri_0228: Regulatory protein RecX |
Gene: Sama_1047: Regulatory protein RecX |
Gene: Shew_1216: Regulatory protein RecX |
Gene: Spea_1595: Regulatory protein RecX |
Gene: Shal_1663: Regulatory protein RecX |
Gene: swp_2411: Regulatory protein RecX |
Gene: Ssed_3210: Regulatory protein RecX |
Gene: Swoo_2970: Regulatory protein RecX |
Regulatory protein RecX |
| CRON 9. | |||||||||||||||||
| dinG |
*
Shewanella oneidensis MR-1 Site: position = -43 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: SO_1819: ATP-dependent helicase DinG/Rad3 |
*
Shewanella putrefaciens CN-32 Site: position = -43 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: Sputcn32_1513: ATP-dependent helicase DinG/Rad3 |
*
Shewanella sp W3-18-1 Site: position = -43 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: Sputw3181_2587: ATP-dependent helicase DinG/Rad3 |
*
Shewanella sp ANA-3 Site: position = -43 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: Shewana3_2630: ATP-dependent helicase DinG/Rad3 |
*
Shewanella sp MR-4 Site: position = -43 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: Shewmr4_2470: ATP-dependent helicase DinG/Rad3 |
*
Shewanella sp MR-7 Site: position = -43 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: Shewmr7_2538: ATP-dependent helicase DinG/Rad3 |
*
Shewanella baltica OS155 Site: position = -43 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: Sbal_1629: ATP-dependent helicase DinG/Rad3 |
*
Shewanella denitrificans OS217 Site: position = -52 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: Sden_2429: ATP-dependent helicase DinG/Rad3 |
*
Shewanella frigidimarina NCIMB 400 Site: position = -51 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: Sfri_2630: ATP-dependent helicase DinG/Rad3 |
*
Shewanella amazonensis SB2B Site: position = -42 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: Sama_1249: ATP-dependent helicase DinG/Rad3 |
*
Shewanella loihica PV-4 Site: position = -43 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: Shew_2483: ATP-dependent helicase DinG/Rad3 |
*
Shewanella pealeana ATCC 700345 Site: position = -43 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: Spea_2656: ATP-dependent helicase DinG/Rad3 |
*
Shewanella halifaxensis HAW-EB4 Site: position = -43 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: Shal_2730: ATP-dependent helicase DinG/Rad3 |
*
Shewanella piezotolerans WP3 Site: position = -10 score = 5.35513 sequence = CACTGTTATTATGTACAGCA Gene: swp_3212: ATP-dependent helicase DinG/Rad3 |
*
Shewanella sediminis HAW-EB3 Site: position = -36 score = 5.10292 sequence = CACTGTTATTATGTACAGCT Gene: Ssed_1566: ATP-dependent helicase DinG/Rad3 |
*
Shewanella woodyi ATCC 51908 Site: position = -37 score = 5.10292 sequence = CACTGTTATTATGTACAGCT Gene: Swoo_3086: ATP-dependent helicase DinG/Rad3 |
ATP-dependent helicase DinG/Rad3 |
| SO1818 |
Gene: SO_1818: protein of unknown function DUF81 |
Gene: Sputcn32_1512: protein of unknown function DUF81 |
Gene: Sputw3181_2588: protein of unknown function DUF81 |
Gene: Shewana3_2631: protein of unknown function DUF81 |
Gene: Shewmr4_2471: protein of unknown function DUF81 |
Gene: Shewmr7_2539: protein of unknown function DUF81 |
Gene: Sbal_1628: protein of unknown function DUF81 |
Gene: Sden_2430: protein of unknown function DUF81 |
Gene: Sfri_2631: protein of unknown function DUF81 |
Gene: Sama_1248: protein of unknown function DUF81 |
Gene: Shew_2484: protein of unknown function DUF81 |
Gene: Spea_2657: protein of unknown function DUF81 |
Gene: Shal_2731: protein of unknown function DUF81 |
Gene: swp_3214: protein of unknown function DUF81 |
Gene: Ssed_1565: protein of unknown function DUF81 |
Gene: Swoo_3087: protein of unknown function DUF81 |
protein of unknown function DUF81 |
| SO1817 |
Gene: SO_1817: Primosomal replication protein N prime-like protein |
Gene: Sputcn32_1511: Primosomal replication protein N prime-like protein |
Gene: Sputw3181_2589: Primosomal replication protein N prime-like protein |
Gene: Shewana3_2632: Primosomal replication protein N prime-like protein |
Gene: Shewmr4_2472: Primosomal replication protein N prime-like protein |
Gene: Shewmr7_2540: Primosomal replication protein N prime-like protein |
Gene: Sbal_1627: Primosomal replication protein N prime-like protein |
Gene: Sden_2431: Primosomal replication protein N prime-like protein |
Gene: Sfri_2632: Primosomal replication protein N prime-like protein |
Gene: Sama_1247: Primosomal replication protein N prime-like protein |
Gene: Shew_2485: Primosomal replication protein N prime-like protein |
Gene: Spea_2658: Primosomal replication protein N prime-like protein |
Gene: Shal_2732: Primosomal replication protein N prime-like protein |
Gene: swp_3216: Primosomal replication protein N prime-like protein |
Gene: Ssed_1564: Primosomal replication protein N prime-like protein |
Gene: Swoo_3088: Primosomal replication protein N prime-like protein |
Primosomal replication protein N prime-like protein |
| CRON 10. | |||||||||||||||||
| recG |
*
Shewanella oneidensis MR-1 Site: position = -45 score = 4.30174 sequence = ATATGTATAAATTCACAGTG Gene: SO_4364: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella putrefaciens CN-32 Site: position = -21 score = 4.30174 sequence = ATATGTATAAATTCACAGTG Gene: Sputcn32_0450: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella sp W3-18-1 Site: position = -21 score = 4.30174 sequence = ATATGTATAAATTCACAGTG Gene: Sputw3181_0304: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella sp ANA-3 Site: position = -21 score = 4.30174 sequence = ATATGTATAAATTCACAGTG Gene: Shewana3_0348: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella sp MR-4 Site: position = -21 score = 4.30174 sequence = ATATGTATAAATTCACAGTG Gene: Shewmr4_0354: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella sp MR-7 Site: position = -21 score = 4.30174 sequence = ATATGTATAAATTCACAGTG Gene: Shewmr7_3672: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella baltica OS155 Site: position = -21 score = 4.30174 sequence = ATATGTATAAATTCACAGTG Gene: Sbal_0346: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella denitrificans OS217 Site: position = -36 score = 4.81021 sequence = ATATGTATAAATTTACAGTG Gene: Sden_3476: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -47 score = 5.31265 sequence = ATCTGTATATAATTACAGTG Gene: Sfri_0356: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella amazonensis SB2B Site: position = -36 score = 4.43452 sequence = ATATGTATAAATTCACAGTA Gene: Sama_3375: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella loihica PV-4 Site: position = -71 score = 5.10942 sequence = ATATGTATATATTTACAGTA Gene: Shew_3507: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella pealeana ATCC 700345 Site: position = -21 score = 4.81021 sequence = ATATGTATAAATTTACAGTG Gene: Spea_3884: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -21 score = 4.81021 sequence = ATATGTATAAATTTACAGTG Gene: Shal_0385: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella piezotolerans WP3 Site: position = -21 score = 4.81021 sequence = ATATGTATAAATTTACAGTG Gene: swp_0309: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella sediminis HAW-EB3 Site: position = -71 score = 4.52139 sequence = ATATGTATATAAACACAGTG Gene: Ssed_0329: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Shewanella woodyi ATCC 51908 Site: position = -68 score = 5.02986 sequence = ATATGTATATAAATACAGTG Gene: Swoo_4592: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
| CRON 11. | |||||||||||||||||
| ogr |
|
|
*
Shewanella sp W3-18-1 Site: position = -63 score = 5.32178 sequence = TACTGTTTAAAAACACAGTG Gene: Sputw3181_2904: phage transcriptional activator, Ogr/delta |
|
|
*
Shewanella sp MR-7 Site: position = -82 score = 5.86763 sequence = TACTGTTTAAAAAAACAGTA Gene: Shewmr7_0718: phage transcriptional activator, Ogr/delta |
*
Shewanella baltica OS155 Site: position = -63 score = 5.83024 sequence = CACTGTTTAAAAATACAGTA Gene: Sbal_1278: phage transcriptional activator, Ogr/delta |
|
|
|
|
|
*
Shewanella halifaxensis HAW-EB4 Site: position = -63 score = 5.26276 sequence = TACTGTTCAAAAACACAGTA Gene: Shal_1316: phage transcriptional activator, Ogr/delta |
|
|
|
phage transcriptional activator, Ogr/delta |
| CRON 12. | |||||||||||||||||
| imuA |
|
|
|
|
|
|
|
|
|
*
Shewanella amazonensis SB2B Site: position = -66 score = 5.88947 sequence = TACTGTATAAATATACAGTT Gene: Sama_1865: Predicted RecA/RadA recombinase |
*
Shewanella loihica PV-4 Site: position = -145 score = 6.09207 sequence = TACTGTATTTATATACAGTG Gene: Shew_2102: Predicted RecA/RadA recombinase |
|
|
|
|
|
Predicted RecA/RadA recombinase |
| imuB |
|
|
|
|
|
|
|
|
|
Gene: Sama_1864: DNA polymerase-like protein PA0670 |
Gene: Shew_2101: DNA polymerase-like protein PA0670 |
|
|
Gene: swp_2324: DNA polymerase-like protein PA0670 |
|
|
DNA polymerase-like protein PA0670 |
| dnaE2 |
|
|
|
|
|
|
|
|
|
Gene: Sama_1863: DNA polymerase III alpha subunit (EC 2.7.7.7) |
Gene: Shew_2100: DNA polymerase III alpha subunit (EC 2.7.7.7) |
|
|
Gene: swp_2325: DNA polymerase III alpha subunit (EC 2.7.7.7) |
|
|
DNA polymerase III alpha subunit (EC 2.7.7.7) |
| CRON 13. | |||||||||||||||||
| xerC |
|
|
|
|
|
|
|
*2
Shewanella denitrificans OS217 Site: position = -39 score = 5.3314 sequence = AACTGTATATAAACACAGTG Gene: Sden_1131: Integron integrase IntI2 Gene: Sden_3261: Integron integrase IntI2 |
|
|
*
Shewanella loihica PV-4 Site: position = -299 score = 5.46744 sequence = CGCTGTTTATTTATACAGTG Gene: Shew_3147: Integron integrase IntI2 |
*
Shewanella pealeana ATCC 700345 Site: position = -100 score = 5.30013 sequence = AACTGTATGTATATACAGCT Gene: Spea_2629: Integron integrase IntI2 |
*
Shewanella halifaxensis HAW-EB4 Site: position = -35 score = 5.65915 sequence = TACTGTATAGATAAACAGTG Gene: Shal_1634: Integron integrase IntI2 |
Gene: swp_1916: Integron integrase IntI2 |
|
Gene: Swoo_2645: Integron integrase IntI2 |
Integron integrase IntI2 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |