Regulon of LexA in Shewanella sediminis HAW-EB3

Properties
Regulator type:	Transcription factor
TF locus tag:	Ssed_0200
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Shewanellaceae
Statistics of regulated genes:
- Genes	14
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 6.1 Sequence: TACTGTATATTTATACAGTA Locus tag: Ssed_2172 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: Ssed_2171 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	Ssed_2172	umuD	DNA polymerase V, subunit UmuD
	Ssed_2171	umuC	DNA polymerase V, subunit UmuC
Position: -135 Score: 5.6 Sequence: TACTGTATGATTGTACAGTA Locus tag: Ssed_1300 Name: recA Funciton: Recombinase A
	Ssed_1300	recA	Recombinase A
Position: -45 Score: 5.6 Sequence: TACTGTATATACTAACAGTT Position: -26 Score: 5 Sequence: TACTGTATAGAAAGACAGGA Locus tag: Ssed_0200 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Ssed_0199 Name: sulA Funciton: Cell division inhibitor sulA
	Ssed_0200	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Ssed_0199	sulA	Cell division inhibitor sulA
Position: -38 Score: 5.4 Sequence: TACTGGTAATTTATACAGTG Locus tag: Ssed_1658 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	Ssed_1658	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -62 Score: 5.8 Sequence: TACTGTATATAAAATCAGTA Position: -40 Score: 5.5 Sequence: TACTGTTTAAAAACACAGTA Locus tag: Ssed_1281 Name: recN Funciton: DNA repair protein RecN
	Ssed_1281	recN	DNA repair protein RecN
Position: -36 Score: 5.1 Sequence: CACTGTTATTATGTACAGCT Locus tag: Ssed_1566 Name: dinG Funciton: ATP-dependent helicase DinG/Rad3 Locus tag: Ssed_1565 Name: SO1818 Funciton: protein of unknown function DUF81 Locus tag: Ssed_1564 Name: SO1817 Funciton: Primosomal replication protein N prime-like protein
	Ssed_1566	dinG	ATP-dependent helicase DinG/Rad3
	Ssed_1565	SO1818	protein of unknown function DUF81
	Ssed_1564	SO1817	Primosomal replication protein N prime-like protein
Position: -31 Score: 5.9 Sequence: AACTGTATATAAAAACAGTA Locus tag: Ssed_2486 Name: yebG Funciton: SOS regulon DNA damage-inducible protein Locus tag: Ssed_2485 Name: yebR Funciton: COG1956, GAF domain-containing protein
	Ssed_2486	yebG	SOS regulon DNA damage-inducible protein
	Ssed_2485	yebR	COG1956, GAF domain-containing protein
Position: -56 Score: 6 Sequence: TACTGTTTAAATATACAGTA Locus tag: Ssed_3422 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Ssed_3422	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -71 Score: 4.5 Sequence: ATATGTATATAAACACAGTG Locus tag: Ssed_0329 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	Ssed_0329	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Shewanella sediminis HAW-EB3

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --