Regulon of LexA in Shewanella denitrificans OS217

Properties
Regulator type:	Transcription factor
TF locus tag:	Sden_3515
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Shewanellaceae
Statistics of regulated genes:
- Genes	15
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 5.4 Sequence: TACTGTATAAAAAACCAGTG Position: -49 Score: 5.6 Sequence: TACTGTTTATCAATACAGTG Locus tag: Sden_1151 Name: recN Funciton: DNA repair protein RecN
	Sden_1151	recN	DNA repair protein RecN
Position: -203 Score: 5.8 Sequence: TACTGTATGATTATACAGTA Locus tag: Sden_1208 Name: recA Funciton: Recombinase A
	Sden_1208	recA	Recombinase A
Position: -45 Score: 5.1 Sequence: TACTGTATATAATGACAGTC Position: -26 Score: 5.1 Sequence: CACTGTATAAAAAGACAGGA Locus tag: Sden_3515 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Sden_3516 Name: sulA Funciton: Cell division inhibitor sulA
	Sden_3515	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Sden_3516	sulA	Cell division inhibitor sulA
Position: -52 Score: 5.4 Sequence: CACTGTTATTATGTACAGCA Locus tag: Sden_2429 Name: dinG Funciton: ATP-dependent helicase DinG/Rad3 Locus tag: Sden_2430 Name: SO1818 Funciton: protein of unknown function DUF81 Locus tag: Sden_2431 Name: SO1817 Funciton: Primosomal replication protein N prime-like protein
	Sden_2429	dinG	ATP-dependent helicase DinG/Rad3
	Sden_2430	SO1818	protein of unknown function DUF81
	Sden_2431	SO1817	Primosomal replication protein N prime-like protein
Position: -41 Score: 5.6 Sequence: CACTGTAATTACATACAGTG Locus tag: Sden_2400 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	Sden_2400	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -31 Score: 6 Sequence: CACTGTATATAAAAACAGTA Locus tag: Sden_1719 Name: yebG Funciton: SOS regulon DNA damage-inducible protein Locus tag: Sden_1720 Name: yebR Funciton: COG1956, GAF domain-containing protein
	Sden_1719	yebG	SOS regulon DNA damage-inducible protein
	Sden_1720	yebR	COG1956, GAF domain-containing protein
Position: -52 Score: 5.8 Sequence: CACTGTTTTTTTATACAGTA Locus tag: Sden_1185 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Sden_1185	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -36 Score: 4.8 Sequence: ATATGTATAAATTTACAGTG Locus tag: Sden_3476 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	Sden_3476	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)
Position: -29 Score: 6 Sequence: TACTGTATATAATTACAGTG Locus tag: Sden_3236 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: Sden_3235 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	Sden_3236	umuD	DNA polymerase V, subunit UmuD
	Sden_3235	umuC	DNA polymerase V, subunit UmuC
Position: -39 Score: 5.3 Sequence: AACTGTATATAAACACAGTG Locus tag: Sden_1131 Name: xerC Funciton: Integron integrase IntI2
	Sden_1131	xerC	Integron integrase IntI2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Shewanella denitrificans OS217

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --