Regulon of LexA in Shewanella piezotolerans WP3

Properties
Regulator type:	Transcription factor
TF locus tag:	swp_4821
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Shewanellaceae
Statistics of regulated genes:
- Genes	12
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -21 Score: 4.8 Sequence: ATATGTATAAATTTACAGTG Locus tag: swp_0309 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	swp_0309	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)
Position: -45 Score: 5.2 Sequence: TACTGTATATACTAACAGGT Position: -26 Score: 5 Sequence: TACTGTATAGAAAAACAGGT Locus tag: swp_4821 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: swp_4822 Name: sulA Funciton: Cell division inhibitor sulA
	swp_4821	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	swp_4822	sulA	Cell division inhibitor sulA
Position: -36 Score: 5.8 Sequence: TACTGTTAATTTATACAGTG Locus tag: swp_3111 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	swp_3111	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -123 Score: 5.6 Sequence: TACTGTATGATTGTACAGTA Locus tag: swp_1366 Name: recA Funciton: Recombinase A
	swp_1366	recA	Recombinase A
Position: -61 Score: 5.7 Sequence: TACTGTATAGAAAAACAGTA Position: -39 Score: 5.6 Sequence: TACTGTTTATCAATACAGTG Locus tag: swp_1346 Name: recN Funciton: DNA repair protein RecN
	swp_1346	recN	DNA repair protein RecN
Position: -10 Score: 5.4 Sequence: CACTGTTATTATGTACAGCA Locus tag: swp_3212 Name: dinG Funciton: ATP-dependent helicase DinG/Rad3 Locus tag: swp_3214 Name: SO1818 Funciton: protein of unknown function DUF81 Locus tag: swp_3216 Name: SO1817 Funciton: Primosomal replication protein N prime-like protein
	swp_3212	dinG	ATP-dependent helicase DinG/Rad3
	swp_3214	SO1818	protein of unknown function DUF81
	swp_3216	SO1817	Primosomal replication protein N prime-like protein
Position: 11 Score: 6 Sequence: TACTGTATATAAAAACAGTG Locus tag: swp_2821 Name: yebG Funciton: SOS regulon DNA damage-inducible protein Locus tag: swp_2820 Name: yebR Funciton: COG1956, GAF domain-containing protein
	swp_2821	yebG	SOS regulon DNA damage-inducible protein
	swp_2820	yebR	COG1956, GAF domain-containing protein
Position: -95 Score: 6.1 Sequence: TACTGTTTTTATATACAGTA Locus tag: swp_1179 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	swp_1179	dinB	DNA polymerase IV (EC 2.7.7.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Shewanella piezotolerans WP3

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --