Regulon of LexA in Shewanella frigidimarina NCIMB 400

Properties
Regulator type:	Transcription factor
TF locus tag:	Sfri_0260
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Shewanellaceae
Statistics of regulated genes:
- Genes	14
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 5.8 Sequence: TACTGTATATAAAATCAGTA Position: -50 Score: 5.6 Sequence: TACTGTTTATCAATACAGTG Locus tag: Sfri_1043 Name: recN Funciton: DNA repair protein RecN
	Sfri_1043	recN	DNA repair protein RecN
Position: -113 Score: 5.5 Sequence: TACTGTATGACTATACAGTA Locus tag: Sfri_1062 Name: recA Funciton: Recombinase A
	Sfri_1062	recA	Recombinase A
Position: -45 Score: 5 Sequence: CACTGTATATAATGACAGTC Position: -26 Score: 5.1 Sequence: CACTGTATAAAAAGACAGGA Locus tag: Sfri_0260 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Sfri_0259 Name: sulA Funciton: Cell division inhibitor sulA
	Sfri_0260	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Sfri_0259	sulA	Cell division inhibitor sulA
Position: -51 Score: 5.4 Sequence: CACTGTTATTATGTACAGCA Locus tag: Sfri_2630 Name: dinG Funciton: ATP-dependent helicase DinG/Rad3 Locus tag: Sfri_2631 Name: SO1818 Funciton: protein of unknown function DUF81 Locus tag: Sfri_2632 Name: SO1817 Funciton: Primosomal replication protein N prime-like protein
	Sfri_2630	dinG	ATP-dependent helicase DinG/Rad3
	Sfri_2631	SO1818	protein of unknown function DUF81
	Sfri_2632	SO1817	Primosomal replication protein N prime-like protein
Position: -58 Score: 5.9 Sequence: TACTGTTTATTTATACAGTG Position: -43 Score: 4.8 Sequence: CAGTGTGTTTTTATACAGTA Locus tag: Sfri_1963 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: Sfri_1964 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	Sfri_1963	umuD	DNA polymerase V, subunit UmuD
	Sfri_1964	umuC	DNA polymerase V, subunit UmuC
Position: -67 Score: 5.8 Sequence: TACTGTAAATTTATACAGTT Locus tag: Sfri_1401 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	Sfri_1401	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -31 Score: 5.9 Sequence: CACTGTATATAAAAACAGTG Locus tag: Sfri_2231 Name: yebG Funciton: SOS regulon DNA damage-inducible protein Locus tag: Sfri_2230 Name: yebR Funciton: COG1956, GAF domain-containing protein
	Sfri_2231	yebG	SOS regulon DNA damage-inducible protein
	Sfri_2230	yebR	COG1956, GAF domain-containing protein
Position: -57 Score: 6.1 Sequence: TACTGTTTTTATATACAGTA Locus tag: Sfri_0961 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Sfri_0961	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -47 Score: 5.3 Sequence: ATCTGTATATAATTACAGTG Locus tag: Sfri_0356 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	Sfri_0356	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Shewanella frigidimarina NCIMB 400

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --