Regulon of LexA in Shewanella amazonensis SB2B

Properties
Regulator type:	Transcription factor
TF locus tag:	Sama_3481
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Shewanellaceae
Statistics of regulated genes:
- Genes	18
- Operons	11
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 5.6 Sequence: TACTGTATATACTGACAGTA Position: -26 Score: 5 Sequence: AACTGTATAGAAAAACAGGA Locus tag: Sama_3481 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Sama_3482 Name: sulA Funciton: Cell division inhibitor sulA
	Sama_3481	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Sama_3482	sulA	Cell division inhibitor sulA
Position: -42 Score: 5.4 Sequence: CACTGTTATTATGTACAGCA Locus tag: Sama_1249 Name: dinG Funciton: ATP-dependent helicase DinG/Rad3 Locus tag: Sama_1248 Name: SO1818 Funciton: protein of unknown function DUF81 Locus tag: Sama_1247 Name: SO1817 Funciton: Primosomal replication protein N prime-like protein
	Sama_1249	dinG	ATP-dependent helicase DinG/Rad3
	Sama_1248	SO1818	protein of unknown function DUF81
	Sama_1247	SO1817	Primosomal replication protein N prime-like protein
Position: 29 Score: 5.3 Sequence: TACTGTAAATTCATCCAGTG Locus tag: Sama_2145 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	Sama_2145	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -36 Score: 4.4 Sequence: ATATGTATAAATTCACAGTA Locus tag: Sama_3375 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	Sama_3375	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)
Position: -115 Score: 5.6 Sequence: TACTGTATGATTGTACAGTA Locus tag: Sama_1046 Name: recA Funciton: Recombinase A Locus tag: Sama_1047 Name: recX Funciton: Regulatory protein RecX
	Sama_1046	recA	Recombinase A
	Sama_1047	recX	Regulatory protein RecX
Position: -73 Score: 5.4 Sequence: TACTGTACAAAAAATCAGTA Position: -51 Score: 5.3 Sequence: TACTGTGTATCAATACAGTA Locus tag: Sama_1026 Name: recN Funciton: DNA repair protein RecN
	Sama_1026	recN	DNA repair protein RecN
Position: -31 Score: 5.8 Sequence: CACTGTATAAATAAACAGTG Locus tag: Sama_1582 Name: yebG Funciton: SOS regulon DNA damage-inducible protein Locus tag: Sama_1583 Name: yebR Funciton: COG1956, GAF domain-containing protein
	Sama_1582	yebG	SOS regulon DNA damage-inducible protein
	Sama_1583	yebR	COG1956, GAF domain-containing protein
Position: -36 Score: 6.1 Sequence: TACTGTTTTTATATACAGTA Locus tag: Sama_2527 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Sama_2527	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -66 Score: 5.9 Sequence: TACTGTATAAATATACAGTT Locus tag: Sama_1865 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Sama_1864 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Sama_1863 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Sama_1865	imuA	Predicted RecA/RadA recombinase
	Sama_1864	imuB	DNA polymerase-like protein PA0670
	Sama_1863	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -38 Score: 5.9 Sequence: TACTGTTTTTATATACAGTT Locus tag: Sama_1355 Name: xerD Funciton: Site-specific recombinase XerD
	Sama_1355	xerD	Site-specific recombinase XerD
Position: -34 Score: 5.4 Sequence: CACTGTACGTACATACAGTT Locus tag: Sama_1633 Name: xerD Funciton: Site-specific recombinase XerD
	Sama_1633	xerD	Site-specific recombinase XerD

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Shewanella amazonensis SB2B

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --