Regulon of LexA in Shewanella pealeana ATCC 700345

Properties
Regulator type:	Transcription factor
TF locus tag:	Spea_3997
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Shewanellaceae
Statistics of regulated genes:
- Genes	15
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 5.2 Sequence: TACTGTATATACTAACAGGT Position: -26 Score: 4.9 Sequence: TACTGTATAGAAAGACAGGG Locus tag: Spea_3997 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Spea_3998 Name: sulA Funciton: Cell division inhibitor sulA
	Spea_3997	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Spea_3998	sulA	Cell division inhibitor sulA
Position: -34 Score: 5.7 Sequence: TACTGTATAAACATACAGTT Locus tag: Spea_2196 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: Spea_2195 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	Spea_2196	umuD	DNA polymerase V, subunit UmuD
	Spea_2195	umuC	DNA polymerase V, subunit UmuC
Position: -36 Score: 5.9 Sequence: TACTGTTAATTTATACAGTA Locus tag: Spea_1625 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	Spea_1625	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -124 Score: 5.6 Sequence: TACTGTATGATTGTACAGTA Locus tag: Spea_1195 Name: recA Funciton: Recombinase A
	Spea_1195	recA	Recombinase A
Position: -21 Score: 4.8 Sequence: ATATGTATAAATTTACAGTG Locus tag: Spea_3884 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	Spea_3884	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)
Position: -62 Score: 5.9 Sequence: TACTGTATGAATAAACAGTA Position: -40 Score: 5.3 Sequence: TACTGTTTAACCATACAGTG Locus tag: Spea_1169 Name: recN Funciton: DNA repair protein RecN
	Spea_1169	recN	DNA repair protein RecN
Position: -43 Score: 5.4 Sequence: CACTGTTATTATGTACAGCA Locus tag: Spea_2656 Name: dinG Funciton: ATP-dependent helicase DinG/Rad3 Locus tag: Spea_2657 Name: SO1818 Funciton: protein of unknown function DUF81 Locus tag: Spea_2658 Name: SO1817 Funciton: Primosomal replication protein N prime-like protein
	Spea_2656	dinG	ATP-dependent helicase DinG/Rad3
	Spea_2657	SO1818	protein of unknown function DUF81
	Spea_2658	SO1817	Primosomal replication protein N prime-like protein
Position: -31 Score: 5.9 Sequence: CACTGTATATAAAAACAGTG Locus tag: Spea_1932 Name: yebG Funciton: SOS regulon DNA damage-inducible protein Locus tag: Spea_1933 Name: yebR Funciton: COG1956, GAF domain-containing protein
	Spea_1932	yebG	SOS regulon DNA damage-inducible protein
	Spea_1933	yebR	COG1956, GAF domain-containing protein
Position: -44 Score: 6.1 Sequence: TACTGTTTTTATATACAGTA Locus tag: Spea_3092 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Spea_3092	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -100 Score: 5.3 Sequence: AACTGTATGTATATACAGCT Locus tag: Spea_2629 Name: xerC Funciton: Integron integrase IntI2
	Spea_2629	xerC	Integron integrase IntI2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Shewanella pealeana ATCC 700345

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --