Regulon of LexA in Shewanella woodyi ATCC 51908

Properties
Regulator type:	Transcription factor
TF locus tag:	Swoo_0180
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Shewanellaceae
Statistics of regulated genes:
- Genes	15
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 5 Sequence: ATATGTATATAAATACAGTG Locus tag: Swoo_4592 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	Swoo_4592	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)
Position: -45 Score: 5.3 Sequence: TACTGTATATACTGACAGTT Position: -26 Score: 5 Sequence: TACTGTATAGAAAGACAGGA Locus tag: Swoo_0180 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Swoo_0179 Name: sulA Funciton: Cell division inhibitor sulA
	Swoo_0180	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Swoo_0179	sulA	Cell division inhibitor sulA
Position: -38 Score: 5.3 Sequence: TACTGTATAAAAACACAGTT Locus tag: Swoo_2465 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: Swoo_2466 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	Swoo_2465	umuD	DNA polymerase V, subunit UmuD
	Swoo_2466	umuC	DNA polymerase V, subunit UmuC
Position: -124 Score: 5.5 Sequence: TACTGTATGACTATACAGTA Locus tag: Swoo_3340 Name: recA Funciton: Recombinase A
	Swoo_3340	recA	Recombinase A
Position: -35 Score: 5.4 Sequence: TACTGGTAATTTATACAGTG Locus tag: Swoo_2976 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	Swoo_2976	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -64 Score: 5.9 Sequence: TACTGTATTTATGAACAGTA Position: -42 Score: 5.9 Sequence: TACTGTTCATAAATACAGTA Locus tag: Swoo_3359 Name: recN Funciton: DNA repair protein RecN
	Swoo_3359	recN	DNA repair protein RecN
Position: -37 Score: 5.1 Sequence: CACTGTTATTATGTACAGCT Locus tag: Swoo_3086 Name: dinG Funciton: ATP-dependent helicase DinG/Rad3 Locus tag: Swoo_3087 Name: SO1818 Funciton: protein of unknown function DUF81 Locus tag: Swoo_3088 Name: SO1817 Funciton: Primosomal replication protein N prime-like protein
	Swoo_3086	dinG	ATP-dependent helicase DinG/Rad3
	Swoo_3087	SO1818	protein of unknown function DUF81
	Swoo_3088	SO1817	Primosomal replication protein N prime-like protein
Position: -31 Score: 5.9 Sequence: AACTGTATATAAAAACAGTA Locus tag: Swoo_2130 Name: yebG Funciton: SOS regulon DNA damage-inducible protein Locus tag: Swoo_2131 Name: yebR Funciton: COG1956, GAF domain-containing protein
	Swoo_2130	yebG	SOS regulon DNA damage-inducible protein
	Swoo_2131	yebR	COG1956, GAF domain-containing protein
Position: -52 Score: 6 Sequence: CACTGTTTTTATATACAGTA Locus tag: Swoo_3604 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Swoo_3604	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -48 Score: 5.8 Sequence: CACTGTTTTTTTATACAGTA Locus tag: Swoo_4307 Name: xerD Funciton: Site-specific recombinase XerD
	Swoo_4307	xerD	Site-specific recombinase XerD

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Shewanella woodyi ATCC 51908

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --