Regulon of LexA in Shewanella putrefaciens CN-32

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputcn32_3780
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Shewanellaceae
Statistics of regulated genes:
- Genes	14
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 5.8 Sequence: TACTGTATATAAAATCAGTA Position: -50 Score: 5.6 Sequence: TACTGTTTATCAATACAGTG Locus tag: Sputcn32_2771 Name: recN Funciton: DNA repair protein RecN
	Sputcn32_2771	recN	DNA repair protein RecN
Position: -43 Score: 5.4 Sequence: CACTGTTATTATGTACAGCA Locus tag: Sputcn32_1513 Name: dinG Funciton: ATP-dependent helicase DinG/Rad3 Locus tag: Sputcn32_1512 Name: SO1818 Funciton: protein of unknown function DUF81 Locus tag: Sputcn32_1511 Name: SO1817 Funciton: Primosomal replication protein N prime-like protein
	Sputcn32_1513	dinG	ATP-dependent helicase DinG/Rad3
	Sputcn32_1512	SO1818	protein of unknown function DUF81
	Sputcn32_1511	SO1817	Primosomal replication protein N prime-like protein
Position: -129 Score: 5.6 Sequence: TACTGTATGATTGTACAGTA Locus tag: Sputcn32_2747 Name: recA Funciton: Recombinase A Locus tag: Sputcn32_2746 Name: recX Funciton: Regulatory protein RecX
	Sputcn32_2747	recA	Recombinase A
	Sputcn32_2746	recX	Regulatory protein RecX
Position: -32 Score: 5.4 Sequence: AACTGTATATTTGTACAGTT Locus tag: Sputcn32_0175 Name: umuD Funciton: DNA polymerase V, subunit UmuD
	Sputcn32_0175	umuD	DNA polymerase V, subunit UmuD
Position: -45 Score: 5.9 Sequence: TACTGTATATACTAACAGTA Position: -26 Score: 5 Sequence: AACTGTATAGAAAAACAGGA Locus tag: Sputcn32_3780 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Sputcn32_3781 Name: sulA Funciton: Cell division inhibitor sulA
	Sputcn32_3780	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Sputcn32_3781	sulA	Cell division inhibitor sulA
Position: -32 Score: 5.6 Sequence: TACTGTAATTATATCCAGTG Locus tag: Sputcn32_2435 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	Sputcn32_2435	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -30 Score: 6 Sequence: TACTGTATATAAAAACAGTG Locus tag: Sputcn32_2205 Name: yebG Funciton: SOS regulon DNA damage-inducible protein Locus tag: Sputcn32_2204 Name: yebR Funciton: COG1956, GAF domain-containing protein
	Sputcn32_2205	yebG	SOS regulon DNA damage-inducible protein
	Sputcn32_2204	yebR	COG1956, GAF domain-containing protein
Position: 20 Score: 5.7 Sequence: TACTGGTTTTATATACAGTA Locus tag: Sputcn32_0951 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Sputcn32_0951	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -21 Score: 4.3 Sequence: ATATGTATAAATTCACAGTG Locus tag: Sputcn32_0450 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	Sputcn32_0450	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Shewanella putrefaciens CN-32

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --