Regulon of LexA in Shewanella sp ANA-3

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewana3_3989
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Shewanellaceae
Statistics of regulated genes:
- Genes	17
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -128 Score: 5.6 Sequence: TACTGTATGATTGTACAGTA Locus tag: Shewana3_1126 Name: recA Funciton: Recombinase A Locus tag: Shewana3_1127 Name: recX Funciton: Regulatory protein RecX
	Shewana3_1126	recA	Recombinase A
	Shewana3_1127	recX	Regulatory protein RecX
Position: -45 Score: 5.9 Sequence: TACTGTATATACTAACAGTA Position: -26 Score: 5 Sequence: AACTGTATAGAAAAACAGGA Locus tag: Shewana3_3989 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Shewana3_3990 Name: sulA Funciton: Cell division inhibitor sulA
	Shewana3_3989	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Shewana3_3990	sulA	Cell division inhibitor sulA
Position: -72 Score: 5.9 Sequence: TACTGTATATAAATTCAGTA Position: -50 Score: 5.6 Sequence: TACTGTTTATCAATACAGTG Locus tag: Shewana3_1104 Name: recN Funciton: DNA repair protein RecN
	Shewana3_1104	recN	DNA repair protein RecN
Position: -32 Score: 5.4 Sequence: CACTGTAATTATATCCAGTG Locus tag: Shewana3_1486 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	Shewana3_1486	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -43 Score: 5.4 Sequence: CACTGTTATTATGTACAGCA Locus tag: Shewana3_2630 Name: dinG Funciton: ATP-dependent helicase DinG/Rad3 Locus tag: Shewana3_2631 Name: SO1818 Funciton: protein of unknown function DUF81 Locus tag: Shewana3_2632 Name: SO1817 Funciton: Primosomal replication protein N prime-like protein
	Shewana3_2630	dinG	ATP-dependent helicase DinG/Rad3
	Shewana3_2631	SO1818	protein of unknown function DUF81
	Shewana3_2632	SO1817	Primosomal replication protein N prime-like protein
Position: -31 Score: 6 Sequence: TACTGTATATAAAAACAGTG Locus tag: Shewana3_1775 Name: yebG Funciton: SOS regulon DNA damage-inducible protein Locus tag: Shewana3_1776 Name: yebR Funciton: COG1956, GAF domain-containing protein
	Shewana3_1775	yebG	SOS regulon DNA damage-inducible protein
	Shewana3_1776	yebR	COG1956, GAF domain-containing protein
Position: -44 Score: 6.1 Sequence: TACTGTTTTTATATACAGTA Locus tag: Shewana3_0949 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Shewana3_0949	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -21 Score: 4.3 Sequence: ATATGTATAAATTCACAGTG Locus tag: Shewana3_0348 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	Shewana3_0348	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)
Position: 14 Score: 6 Sequence: TACTGTATTTACATACAGTA Locus tag: Shewana3_1833 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: Shewana3_1832 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	Shewana3_1833	umuD	DNA polymerase V, subunit UmuD
	Shewana3_1832	umuC	DNA polymerase V, subunit UmuC
Position: -23 Score: 5.9 Sequence: TACTGTATTAATGTACAGTA Locus tag: Shewana3_4173 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: Shewana3_4172 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	Shewana3_4173	umuD	DNA polymerase V, subunit UmuD
	Shewana3_4172	umuC	DNA polymerase V, subunit UmuC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Shewanella sp ANA-3

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --