Regulon of LexA in Shewanella sp MR-7

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr7_3862
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Shewanellaceae
Statistics of regulated genes:
- Genes	17
- Operons	11
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 5.9 Sequence: TACTGTATATACTAACAGTA Position: -26 Score: 5 Sequence: AACTGTATAGAAAAACAGGA Locus tag: Shewmr7_3862 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Shewmr7_3863 Name: sulA Funciton: Cell division inhibitor sulA
	Shewmr7_3862	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Shewmr7_3863	sulA	Cell division inhibitor sulA
Position: -128 Score: 5.6 Sequence: TACTGTATGATTGTACAGTA Locus tag: Shewmr7_1196 Name: recA Funciton: Recombinase A Locus tag: Shewmr7_1197 Name: recX Funciton: Regulatory protein RecX
	Shewmr7_1196	recA	Recombinase A
	Shewmr7_1197	recX	Regulatory protein RecX
Position: -72 Score: 5.9 Sequence: TACTGTATATAAATTCAGTA Position: -50 Score: 5.6 Sequence: TACTGTTTATCAATACAGTG Locus tag: Shewmr7_1170 Name: recN Funciton: DNA repair protein RecN
	Shewmr7_1170	recN	DNA repair protein RecN
Position: 30 Score: 5.6 Sequence: CACTGTAATTATATCCAGTA Locus tag: Shewmr7_1498 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	Shewmr7_1498	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -43 Score: 5.4 Sequence: CACTGTTATTATGTACAGCA Locus tag: Shewmr7_2538 Name: dinG Funciton: ATP-dependent helicase DinG/Rad3 Locus tag: Shewmr7_2539 Name: SO1818 Funciton: protein of unknown function DUF81 Locus tag: Shewmr7_2540 Name: SO1817 Funciton: Primosomal replication protein N prime-like protein
	Shewmr7_2538	dinG	ATP-dependent helicase DinG/Rad3
	Shewmr7_2539	SO1818	protein of unknown function DUF81
	Shewmr7_2540	SO1817	Primosomal replication protein N prime-like protein
Position: -31 Score: 6 Sequence: TACTGTATATAAAAACAGTG Locus tag: Shewmr7_1745 Name: yebG Funciton: SOS regulon DNA damage-inducible protein Locus tag: Shewmr7_1746 Name: yebR Funciton: COG1956, GAF domain-containing protein
	Shewmr7_1745	yebG	SOS regulon DNA damage-inducible protein
	Shewmr7_1746	yebR	COG1956, GAF domain-containing protein
Position: -44 Score: 6.1 Sequence: TACTGTTTTTATATACAGTA Locus tag: Shewmr7_0985 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Shewmr7_0985	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -21 Score: 4.3 Sequence: ATATGTATAAATTCACAGTG Locus tag: Shewmr7_3672 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	Shewmr7_3672	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)
Position: 14 Score: 6.2 Sequence: TACTGTATTTATATACAGTA Locus tag: Shewmr7_2195 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: Shewmr7_2196 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	Shewmr7_2195	umuD	DNA polymerase V, subunit UmuD
	Shewmr7_2196	umuC	DNA polymerase V, subunit UmuC
Position: -82 Score: 5.9 Sequence: TACTGTTTAAAAAAACAGTA Locus tag: Shewmr7_0718 Name: ogr Funciton: phage transcriptional activator, Ogr/delta
	Shewmr7_0718	ogr	phage transcriptional activator, Ogr/delta
Position: -39 Score: 5.4 Sequence: TACTGTATAAAACAACAGTA Locus tag: Shewmr7_2132 Name: xerD Funciton: Site-specific recombinase XerD
	Shewmr7_2132	xerD	Site-specific recombinase XerD

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Shewanella sp MR-7

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --