Regulog Zur - Cyanobacteria

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Cyanobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Synechococcus sp. PCC 7002	7	3
Synechocystis sp. PCC 6803	5	3
Cyanothece sp. ATCC 51142	27	17
Cyanothece sp. PCC 8801	13	9
Cyanothece sp. PCC 7425	9	5
Microcystis aeruginosa NIES-843	10	5
Nostoc sp. PCC 7120	22	8
Trichodesmium erythraeum IMS101	9	6
Synechococcus elongatus PCC 7942	7	3
Prochlorococcus marinus str. MIT 9313	3	2
Synechococcus sp. JA-3-3Ab	4	1
Synechococcus sp. WH 8102	4	3
Gloeobacter violaceus PCC 7421	5	3
Thermosynechococcus elongatus BP-1	4	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes															Function

CRON 1.
cce_1484	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	* Cyanothece sp. ATCC 51142 Site: position = -40 score = 6.68012 sequence = ACTAGAATGATTATCATTATCAT Gene: cce_1484: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein	2 Cyanothece sp. PCC 8801* Site: position = -53 score = 4.90046 sequence = ACAATTATGAAAATCATTATGAG Gene: PCC8801_2483: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein Site: position = -40 score = 6.95963 sequence = ATTAGAATGATTATCATTATCAT Gene: PCC8801_0773: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein	* Cyanothece sp. PCC 7425 Site: position = -29 score = 5.20204 sequence = TTGAAAATGAGAATGGTTCTTAT Gene: Cyan7425_0822: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein	Microcystis aeruginosa NIES-843 Gene: MAE_31440: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein	Nostoc sp. PCC 7120	Trichodesmium erythraeum IMS101 Gene: Tery_3218: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein	2 Synechococcus elongatus PCC 7942* Site: position = -59 score = 4.89761 sequence = TAGGGAATGATAACGATTCTCAA Gene: Synpcc7942_1316: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein Gene: Synpcc7942_2575: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein	* Prochlorococcus marinus str. MIT 9313 Site: position = -34 score = 5.95581 sequence = ATAAAAATGGGAATCATTCTCAT Gene: PMT2203: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein	Synechococcus sp. JA-3-3Ab Gene: CYA_1680: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein	* Synechococcus sp. WH 8102 Site: position = 37 score = 6.32587 sequence = GTAAAAATGATAATCATTCTCAT Gene: SYNW0971: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein	2 Gloeobacter violaceus PCC 7421* Site: position = -6 score = 5.29863 sequence = TCTAGAATGAGAATCATTCTTGA Gene: glr1694: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein Gene: glr3311: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein	Thermosynechococcus elongatus BP-1	Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
cce_1485	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	* Cyanothece sp. ATCC 51142 Site: position = -31 score = 6.68012 sequence = ATGATAATGATAATCATTCTAGT Gene: cce_1485: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein	2 Cyanothece sp. PCC 8801* Site: position = -32 score = 6.95963 sequence = ATGATAATGATAATCATTCTAAT Gene: PCC8801_0774: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Site: position = -84 score = 4.90046 sequence = CTCATAATGATTTTCATAATTGT Gene: PCC8801_2484: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein	* Cyanothece sp. PCC 7425 Site: position = -29 score = 5.27785 sequence = ATAAGAATTATTCTCATTTTCAC Gene: Cyan7425_0794: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein	Microcystis aeruginosa NIES-843 Gene: MAE_04690: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein	Nostoc sp. PCC 7120	Trichodesmium erythraeum IMS101 Gene: Tery_3219: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein	2 Synechococcus elongatus PCC 7942 Gene: Synpcc7942_1317: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Gene: Synpcc7942_2574: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein	* Prochlorococcus marinus str. MIT 9313 Site: position = -111 score = 5.95581 sequence = ATGAGAATGATTCCCATTTTTAT Gene: PMT2202: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein	Synechococcus sp. JA-3-3Ab Gene: CYA_1679: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein	* Synechococcus sp. WH 8102 Site: position = -83 score = 6.32587 sequence = ATGAGAATGATTATCATTTTTAC Gene: SYNW0970: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein	2 Gloeobacter violaceus PCC 7421 Gene: gll3310: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Gene: glr3312: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein	Thermosynechococcus elongatus BP-1	Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
cce_1486	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142 Gene: cce_1486: Predicted Mn/Zn chelate ABC transporter, permease protein	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425 Gene: Cyan7425_4926: Predicted Mn/Zn chelate ABC transporter, permease protein	Microcystis aeruginosa NIES-843 Gene: MAE_08530: Predicted Mn/Zn chelate ABC transporter, permease protein	Nostoc sp. PCC 7120	* Trichodesmium erythraeum IMS101 Site: position = -287 score = 5.24377 sequence = ATTATAATCATATTTATTATTAA Gene: Tery_3358: Predicted Mn/Zn chelate ABC transporter, permease protein	2 Synechococcus elongatus PCC 7942 Gene: Synpcc7942_1318: Predicted Mn/Zn chelate ABC transporter, permease protein Gene: Synpcc7942_2573: Predicted Mn/Zn chelate ABC transporter, permease protein	Prochlorococcus marinus str. MIT 9313 Gene: PMT2201: Predicted Mn/Zn chelate ABC transporter, permease protein	Synechococcus sp. JA-3-3Ab Gene: CYA_1678: Predicted Mn/Zn chelate ABC transporter, permease protein	Synechococcus sp. WH 8102 Gene: SYNW0969: Predicted Mn/Zn chelate ABC transporter, permease protein	3 Gloeobacter violaceus PCC 7421* Site: position = -56 score = 5.29863 sequence = TCAAGAATGATTCTCATTCTAGA Gene: gll1693: Predicted Mn/Zn chelate ABC transporter, permease protein Gene: gll3309: Predicted Mn/Zn chelate ABC transporter, permease protein Gene: glr3313: Predicted Mn/Zn chelate ABC transporter, permease protein	Thermosynechococcus elongatus BP-1	Predicted Mn/Zn chelate ABC transporter, permease protein

CRON 2.
hisI2	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	* Cyanothece sp. ATCC 51142 Site: position = -37 score = 5.42518 sequence = ATGATAATGATTATCAAAATTGA Gene: cce_4845: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	* Trichodesmium erythraeum IMS101 Site: position = -37 score = 4.80538 sequence = AGGATAATGATTATTAAAATTGA Gene: Tery_2490: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)

CRON 3.
ompZ	Synechococcus sp. PCC 7002	* Synechocystis sp. PCC 6803 Site: position = -118 score = 6.72536 sequence = ATGATAATGATTATCATTATTTA Gene: sll1550: Predicted zink uptake outer membrane protein	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425 Gene: Cyan7425_0823: Predicted zink uptake outer membrane protein	* Microcystis aeruginosa NIES-843 Site: position = -40 score = 5.52967 sequence = CTGAGAACAATAATCATTCTTGT Gene: MAE_10010: Predicted zink uptake outer membrane protein	Nostoc sp. PCC 7120	Trichodesmium erythraeum IMS101	4 Synechococcus elongatus PCC 7942* Site: position = -37 score = 6.10867 sequence = ATGAGAATAATAATCATTTTTAG Gene: Synpcc7942_1463: Predicted zink uptake outer membrane protein Gene: Synpcc7942_1464: Predicted zink uptake outer membrane protein Gene: Synpcc7942_1635: Predicted zink uptake outer membrane protein Gene: Synpcc7942_1607: Predicted zink uptake outer membrane protein	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab Gene: CYA_1411: Predicted zink uptake outer membrane protein	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	* Thermosynechococcus elongatus BP-1 Site: position = -84 score = 6.16162 sequence = AGTAGAATGATAATCATTACAAT Gene: tlr1246: Predicted zink uptake outer membrane protein	Predicted zink uptake outer membrane protein

CRON 4.
smtA	Synechococcus sp. PCC 7002 Gene: SYNPCC7002_A2563: Predicted zinc-binding metallothionein	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142 Gene: cce_2496: Predicted zinc-binding metallothionein	* Cyanothece sp. PCC 8801 Site: position = -152 score = 5.74129 sequence = TCTAGAATGATAATCACTCTCAT Gene: PCC8801_0861: Predicted zinc-binding metallothionein	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942 Gene: Synpcc7942_1290: Predicted zinc-binding metallothionein	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	* Synechococcus sp. WH 8102 Site: position = -105 score = 6.17488 sequence = CCGATAATGATTATCATTCTTTT Site: position = -79 score = 5.49836 sequence = CCAATAATGAGAATTATTCTTAT Gene: SYNW0359: Predicted zinc-binding metallothionein	Gloeobacter violaceus PCC 7421 Gene: gsl3430: Predicted zinc-binding metallothionein	Thermosynechococcus elongatus BP-1 Gene: tsl1016: Predicted zinc-binding metallothionein	Predicted zinc-binding metallothionein

CRON 5.
thrS2	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	2 Cyanothece sp. ATCC 51142* Site: position = 28 score = 6.3225 sequence = ATGATAATGATTATTATTACAAT Gene: cce_4835: Threonyl-tRNA synthetase (EC 6.1.1.3) Site: position = 81 score = 6.71995 sequence = TTGATAATGATTATCATTTTTAT Site: position = 127 score = 6.94326 sequence = ATAATAATGATTATCATTTTTAT Gene: cce_1495: Threonyl-tRNA synthetase (EC 6.1.1.3)	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	* Microcystis aeruginosa NIES-843 Site: position = -34 score = 6.00144 sequence = GCTACAATGATAATCATTATCAT Gene: MAE_31590: Threonyl-tRNA synthetase (EC 6.1.1.3)	* Nostoc sp. PCC 7120 Site: position = -28 score = 5.87463 sequence = ATGATAACGATTCTCATTATTTA Gene: all4723: Threonyl-tRNA synthetase (EC 6.1.1.3)	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Threonyl-tRNA synthetase (EC 6.1.1.3)
yciC	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	4 Cyanothece sp. ATCC 51142* Site: position = -80 score = 6.3225 sequence = ATTGTAATAATAATCATTATCAT Site: position = -52 score = 5.30237 sequence = CGTAAATTGATAATCATTATCAA Gene: cce_4834: Putative zinc chaperone, COG0523 family Site: position = -46 score = 5.62245 sequence = TTAAGAACGATTATCGTTATAGT Gene: cce_4833: Putative zinc chaperone, COG0523 family Gene: cce_1500: Putative zinc chaperone, COG0523 family Gene: cce_3555: Putative zinc chaperone, COG0523 family	Cyanothece sp. PCC 8801 Gene: PCC8801_0865: Putative zinc chaperone, COG0523 family	Cyanothece sp. PCC 7425 Gene: Cyan7425_1081: Putative zinc chaperone, COG0523 family	Microcystis aeruginosa NIES-843 Gene: MAE_31600: Putative zinc chaperone, COG0523 family	Nostoc sp. PCC 7120 Gene: all4722: Putative zinc chaperone, COG0523 family	* Trichodesmium erythraeum IMS101 Site: position = -255 score = 5.17916 sequence = ATTATGATAATAATTATTGCAAT Gene: Tery_4617: Putative zinc chaperone, COG0523 family	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	* Thermosynechococcus elongatus BP-1 Site: position = -36 score = 5.71652 sequence = ATGAGAATGATTCTCTTTTTCTT Gene: tlr2276: Putative zinc chaperone, COG0523 family	Putative zinc chaperone, COG0523 family
folE2	Synechococcus sp. PCC 7002 Gene: SYNPCC7002_G0128: GTP cyclohydrolase I (EC 3.5.4.16)	Synechocystis sp. PCC 6803	* Cyanothece sp. ATCC 51142 Site: position = -43 score = 5.41907 sequence = TTGAGAACGATTATCATTTTATC Gene: cce_1501: GTP cyclohydrolase I (EC 3.5.4.16)	* Cyanothece sp. PCC 8801 Site: position = -50 score = 5.89161 sequence = TTGAGAACGATTATCATTTTAAA Gene: PCC8801_0864: GTP cyclohydrolase I (EC 3.5.4.16)	Cyanothece sp. PCC 7425	* Microcystis aeruginosa NIES-843 Site: position = -323 score = 5.85518 sequence = ATGATAACGATTATCATTCTAGG Gene: MAE_22860: GTP cyclohydrolase I (EC 3.5.4.16)	Nostoc sp. PCC 7120 Gene: all4721: GTP cyclohydrolase I (EC 3.5.4.16)	Trichodesmium erythraeum IMS101 Gene: Tery_4616: GTP cyclohydrolase I (EC 3.5.4.16)	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	GTP cyclohydrolase I (EC 3.5.4.16)
hemB2	* Synechococcus sp. PCC 7002 Site: position = -25 score = 5.9318 sequence = TCGAGAATGATTATCATTTTTTA Gene: SYNPCC7002_G0127: Porphobilinogen synthase (EC 4.2.1.24)	Synechocystis sp. PCC 6803	2 Cyanothece sp. ATCC 51142* Site: position = -78 score = 7.11365 sequence = ATAATAATGATTATCATTATTAT Site: position = -32 score = 5.91941 sequence = ATAATAATGATTATCGTTTCTAA Gene: cce_1489: Porphobilinogen synthase (EC 4.2.1.24) Site: position = -72 score = 6.01902 sequence = TAAATAATAATAATCATTCTCGT Site: position = -46 score = 6.63211 sequence = ATAATAATGATTATCATTTTGAT Gene: cce_4852: Porphobilinogen synthase (EC 4.2.1.24)	* Cyanothece sp. PCC 8801 Site: position = -72 score = 5.50274 sequence = TTGATAATGATTATCATTCCGTG Site: position = -32 score = 6.68613 sequence = ATAATAATGATTATCATTTTTAA Gene: PCC8801_0777: Porphobilinogen synthase (EC 4.2.1.24)	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843 Gene: MAE_22850: Porphobilinogen synthase (EC 4.2.1.24)	* Nostoc sp. PCC 7120 Site: position = -31 score = 5.71889 sequence = ATGATAATGGTTATCAATCTTGT Gene: all4725: Porphobilinogen synthase (EC 4.2.1.24)	Trichodesmium erythraeum IMS101 Gene: Tery_4608: Porphobilinogen synthase (EC 4.2.1.24)	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313 Gene: PMT1547: Porphobilinogen synthase (EC 4.2.1.24)	Synechococcus sp. JA-3-3Ab Gene: CYA_2762: Porphobilinogen synthase (EC 4.2.1.24)	Synechococcus sp. WH 8102 Gene: SYNW1933: Porphobilinogen synthase (EC 4.2.1.24)	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1 Gene: tll0422: Porphobilinogen synthase (EC 4.2.1.24)	Porphobilinogen synthase (EC 4.2.1.24)
PF07992	* Synechococcus sp. PCC 7002 Site: position = -70 score = 6.37965 sequence = TTGATAATAATTATCATTTTTAT Gene: SYNPCC7002_G0132: Predicted FAD-dependent oxidoreductase, PF07992 family	Synechocystis sp. PCC 6803	* Cyanothece sp. ATCC 51142 Site: position = -62 score = 6.37457 sequence = ATTAAAATGATAACCATTATTAT Site: position = -36 score = 6.12924 sequence = ATGAGAATGATTATCGTTAATTT Gene: cce_4863: Predicted FAD-dependent oxidoreductase, PF07992 family	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120 Gene: all4724: Predicted FAD-dependent oxidoreductase, PF07992 family	* Trichodesmium erythraeum IMS101 Site: position = -43 score = 6.51848 sequence = AAAAGAATGATAATCATTCTTAA Gene: Tery_4613: Predicted FAD-dependent oxidoreductase, PF07992 family	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Predicted FAD-dependent oxidoreductase, PF07992 family

CRON 6.
glr0533	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	* Gloeobacter violaceus PCC 7421 Site: position = -40 score = 5.62945 sequence = TTGAGAACGACTATCATTGTTAT Gene: glr0533: Predicted metal transporter	Thermosynechococcus elongatus BP-1	Predicted metal transporter
yciC2	Synechococcus sp. PCC 7002 Gene: SYNPCC7002_D0010: Putative zinc chaperone, COG0523 family	Synechocystis sp. PCC 6803	2 Cyanothece sp. ATCC 51142* Site: position = -77 score = 6.11985 sequence = TTGAGAATGATTATTATTCTTAA Site: position = -38 score = 6.16874 sequence = ATGAAAATGATTATCATTTTAGA Gene: cce_1488: Putative zinc chaperone, COG0523 family Site: position = -50 score = 5.77593 sequence = ATGAGATCAATTATCATTATCAT Gene: cce_4857: Putative zinc chaperone, COG0523 family	* Cyanothece sp. PCC 8801 Site: position = -76 score = 5.37298 sequence = TTGAGAATGATTCTTATTCTTGA Site: position = -38 score = 5.74129 sequence = ATGAGAGTGATTATCATTCTAGA Gene: PCC8801_0862: Putative zinc chaperone, COG0523 family	* Cyanothece sp. PCC 7425 Site: position = -41 score = 6.16639 sequence = TTGATAATGATTATCATTGTATA Gene: Cyan7425_1909: Putative zinc chaperone, COG0523 family	Microcystis aeruginosa NIES-843	* Nostoc sp. PCC 7120 Site: position = -44 score = 5.01359 sequence = GTGATAATGATTATCCGTATGGT Gene: all1751: Putative zinc chaperone, COG0523 family	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102 Gene: SYNW2482: Putative zinc chaperone, COG0523 family	Gloeobacter violaceus PCC 7421 Gene: glr0534: Putative zinc chaperone, COG0523 family	Thermosynechococcus elongatus BP-1	Putative zinc chaperone, COG0523 family
COG2319	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	2 Cyanothece sp. ATCC 51142 Gene: cce_1487: WD-40 repeat-containing protein, COG2319 family Gene: cce_4858: WD-40 repeat-containing protein, COG2319 family	Cyanothece sp. PCC 8801 Gene: PCC8801_0863: WD-40 repeat-containing protein, COG2319 family	Cyanothece sp. PCC 7425 Gene: Cyan7425_1908: WD-40 repeat-containing protein, COG2319 family	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120 Gene: all1750: WD-40 repeat-containing protein, COG2319 family	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102 Gene: SYNW2483: WD-40 repeat-containing protein, COG2319 family	Gloeobacter violaceus PCC 7421 Gene: glr0535: WD-40 repeat-containing protein, COG2319 family	Thermosynechococcus elongatus BP-1	WD-40 repeat-containing protein, COG2319 family

CRON 7.
znuA	* Synechococcus sp. PCC 7002 Site: position = -39 score = 5.54711 sequence = ATAAGAACGATTATCATTTCAAG Gene: SYNPCC7002_A2501: Zinc ABC transporter, substrate-binding protein	* Synechocystis sp. PCC 6803 Site: position = -84 score = 5.6038 sequence = ATGATAATGATTATCGTTTATTG Gene: slr2043: Zinc ABC transporter, substrate-binding protein	2 Cyanothece sp. ATCC 51142* Site: position = -72 score = 6.12924 sequence = AAATTAACGATAATCATTCTCAT Site: position = -46 score = 6.37457 sequence = ATAATAATGGTTATCATTTTAAT Gene: cce_4862: Zinc ABC transporter, substrate-binding protein Site: position = -79 score = 5.59416 sequence = TTAATAGTGATAATGATTCTTAT Gene: cce_2961: Zinc ABC transporter, substrate-binding protein	* Cyanothece sp. PCC 8801 Site: position = -52 score = 5.29102 sequence = GATACAATGATAATCGTTATCAG Gene: PCC8801_3888: Zinc ABC transporter, substrate-binding protein	Cyanothece sp. PCC 7425 Gene: Cyan7425_1915: Zinc ABC transporter, substrate-binding protein	* Microcystis aeruginosa NIES-843 Site: position = -67 score = 4.79342 sequence = TTCAGAATGATAACGATTCTCAC Gene: MAE_20780: Zinc ABC transporter, substrate-binding pro	* Nostoc sp. PCC 7120 Site: position = -110 score = 6.15196 sequence = ATGAGAATGAGAATTATTATAAT Site: position = -80 score = 5.04367 sequence = TGTACAATAAGTATCATTGTCAA Gene: all0833: Zinc ABC transporter, substrate-binding protein	* Trichodesmium erythraeum IMS101 Site: position = -49 score = 6.89596 sequence = AAAAGAATGATAATCATTATCAT Gene: Tery_4951: Zinc ABC transporter, substrate-binding protein	* Synechococcus elongatus PCC 7942 Site: position = -84 score = 5.6038 sequence = ATGATAATGATTATCGTTTATTG Gene: slr2043: Zinc ABC transporter, substrate-binding protein	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab Gene: CYA_2532: Zinc ABC transporter, substrate-binding protein	Synechococcus sp. WH 8102 Gene: SYNW2481: Zinc ABC transporter, substrate-binding protein	Gloeobacter violaceus PCC 7421	* Thermosynechococcus elongatus BP-1 Site: position = -31 score = 6.31155 sequence = ATGAGAATGATTATCATTCATCT Gene: tlr2062: Zinc ABC transporter, substrate-binding protein	Zinc ABC transporter, substrate-binding protein
znuB	Synechococcus sp. PCC 7002 Gene: SYNPCC7002_A2500: Zinc ABC transporter, ATP-binding protein	Synechocystis sp. PCC 6803 Gene: slr2044: Zinc ABC transporter, ATP-binding protein	2 Cyanothece sp. ATCC 51142 Gene: cce_4861: Zinc ABC transporter, ATP-binding protein Gene: cce_2962: Zinc ABC transporter, ATP-binding protein	Cyanothece sp. PCC 8801 Gene: PCC8801_3889: Zinc ABC transporter, ATP-binding protein	Cyanothece sp. PCC 7425 Gene: Cyan7425_1914: Zinc ABC transporter, ATP-binding protein	Microcystis aeruginosa NIES-843 Gene: MAE_20770: Zinc ABC transporter, ATP-binding protein	Nostoc sp. PCC 7120 Gene: all0832: Zinc ABC transporter, ATP-binding protein	Trichodesmium erythraeum IMS101 Gene: Tery_4952: Zinc ABC transporter, ATP-binding protein	Synechococcus elongatus PCC 7942 Gene: slr2044: Zinc ABC transporter, ATP-binding protein	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab Gene: CYA_2531: Zinc ABC transporter, ATP-binding protein	Synechococcus sp. WH 8102 Gene: SYNW2480: Zinc ABC transporter, ATP-binding protein	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1 Gene: tlr2063: Zinc ABC transporter, ATP-binding protein	Zinc ABC transporter, ATP-binding protein
znuC	Synechococcus sp. PCC 7002 Gene: SYNPCC7002_A2499: Zinc ABC transporter, permease protein	Synechocystis sp. PCC 6803 Gene: slr2045: Zinc ABC transporter, permease protein	2 Cyanothece sp. ATCC 51142 Gene: cce_4860: Zinc ABC transporter, permease protein Gene: cce_2963: Zinc ABC transporter, permease protein	Cyanothece sp. PCC 8801 Gene: PCC8801_3890: Zinc ABC transporter, permease protein	Cyanothece sp. PCC 7425 Gene: Cyan7425_1913: Zinc ABC transporter, permease protein	Microcystis aeruginosa NIES-843 Gene: MAE_52810: Zinc ABC transporter, permease protein	Nostoc sp. PCC 7120 Gene: all0830: Zinc ABC transporter, permease protein	Trichodesmium erythraeum IMS101 Gene: Tery_4953: Zinc ABC transporter, permease protein	Synechococcus elongatus PCC 7942 Gene: slr2045: Zinc ABC transporter, permease protein	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab Gene: CYA_2529: Zinc ABC transporter, permease protein	Synechococcus sp. WH 8102 Gene: SYNW2479: Zinc ABC transporter, permease protein	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1 Gene: tlr0501: Zinc ABC transporter, permease protein	Zinc ABC transporter, permease protein
zur	Synechococcus sp. PCC 7002 Gene: SYNPCC7002_A2498: Zinc uptake transcription regulator, Fur family	* Synechocystis sp. PCC 6803 Site: position = -45 score = 5.6038 sequence = CAATAAACGATAATCATTATCAT Gene: sll1937: Zinc uptake transcription regulator, Fur family	* Cyanothece sp. ATCC 51142 Site: position = -120 score = 6.04887 sequence = ATAATAATGATTATTATTCTACA Gene: cce_4859: Zinc uptake transcription regulator, Fur family	Cyanothece sp. PCC 8801 Gene: PCC8801_4134: Zinc uptake transcription regulator, Fur family	* Cyanothece sp. PCC 7425 Site: position = -56 score = 6.43243 sequence = ATGATAATGATTATCATTGCCTT Gene: Cyan7425_1917: Zinc uptake transcription regulator, Fur family	Microcystis aeruginosa NIES-843 Gene: MAE_57540: Zinc uptake transcription regulator, Fur family	Nostoc sp. PCC 7120 Gene: all2473: Zinc uptake transcription regulator, Fur family	Trichodesmium erythraeum IMS101 Gene: Tery_1953: Zinc uptake transcription regulator, Fur family	Synechococcus elongatus PCC 7942 Gene: Synpcc7942_0817: Zinc uptake transcription regulator, Fur family	Prochlorococcus marinus str. MIT 9313 Gene: PMT2208: Zinc uptake transcription regulator, Fur family	Synechococcus sp. JA-3-3Ab Gene: CYA_1383: Zinc uptake transcription regulator, Fur family	Synechococcus sp. WH 8102 Gene: SYNW2401: Zinc uptake transcription regulator, Fur family	Gloeobacter violaceus PCC 7421 Gene: glr0783: Zinc uptake transcription regulator, Fur family	Thermosynechococcus elongatus BP-1 Gene: tlr0192: Zinc uptake transcription regulator, Fur family	Zinc uptake transcription regulator, Fur family
Cyan7425_1916	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	* Cyanothece sp. PCC 7425 Site: position = -104 score = 6.43243 sequence = AAGGCAATGATAATCATTATCAT Gene: Cyan7425_1916: Hypothetical protein	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Hypothetical protein
sufE	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	* Synechococcus sp. JA-3-3Ab Site: position = -39 score = 5.73875 sequence = TTATGATTGATTATCATTCTCAT Gene: CYA_2533: Cysteine desulfuration protein	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Cysteine desulfuration protein

CRON 8.
alr3242	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	* Nostoc sp. PCC 7120 Site: position = -260 score = 4.28993 sequence = ATGATAATCATTATCAAAAAATG Site: position = -266 score = 5.56479 sequence = GTAAACATGATAATCATTATCAA Gene: alr3242: Zinc-regulated TonB-dependent outer mambrane receptor	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Zinc-regulated TonB-dependent outer mambrane receptor
alr3243	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120 Gene: alr3243: ABC transporter, periplasmic binding protein, COG0614 family	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	ABC transporter, periplasmic binding protein, COG0614 family

CRON 9.
alr1197	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	* Cyanothece sp. ATCC 51142 Site: position = -6 score = 4.69003 sequence = CTAACAATGATTACTGTAATTAT Gene: cce_1494: Putative metallochaperone, similar to COG0523 family	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	* Microcystis aeruginosa NIES-843 Site: position = -6 score = 5.55075 sequence = GCTAGAATGATTATCATTATCAC Gene: MAE_31630: Putative metallochaperone, similar to COG0523 family	* Nostoc sp. PCC 7120 Site: position = -29 score = 4.43984 sequence = AACTGCATGAAAATGATTATCAT Site: position = -23 score = 6.06488 sequence = ATGAAAATGATTATCATTTAAAA Gene: alr1197: Putative metallochaperone, similar to COG0523 family	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Putative metallochaperone, similar to COG0523 family
alr1198	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142 Gene: cce_1493: Metallophosphoesterase, COG0622 family	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843 Gene: MAE_31640: Metallophosphoesterase, COG0622 family	Nostoc sp. PCC 7120 Gene: alr1198: Metallophosphoesterase, COG0622 family	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Metallophosphoesterase, COG0622 family
alr1199	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142 Gene: cce_1492: Metal-dependent phosphatase	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843 Gene: MAE_31650: Metal-dependent phosphatase	Nostoc sp. PCC 7120 Gene: alr1199: Metal-dependent phosphatase	* Trichodesmium erythraeum IMS101 Site: position = -84 score = 4.30461 sequence = TTTGAAACAAGTATTATTGTTTT Gene: Tery_4609: Metal-dependent phosphatase	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Metal-dependent phosphatase

CRON 10.
omp	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	2 Nostoc sp. PCC 7120* Site: position = -122 score = 5.8542 sequence = GTGATAATAATAATCATTATCTA Gene: alr4028: Zinc-regulated TonB-dependent outer mambrane receptor Gene: alr4029: Zinc-regulated TonB-dependent outer mambrane receptor	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Zinc-regulated TonB-dependent outer mambrane receptor
alr4030	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120 Gene: alr4030: Putative ferredoxin, COG3411 family	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Putative ferredoxin, COG3411 family
alr4031	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120 Gene: alr4031: ABC transporter, periplasmic binding protein, COG0614 family	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	ABC transporter, periplasmic binding protein, COG0614 family
alr4032	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120 Gene: alr4032: ABC transporter, permease protein	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	ABC transporter, permease protein
alr4033	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120 Gene: alr4033: ABC transporter, ATP-binding protein	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	ABC transporter, ATP-binding protein

CRON 11.
all3515	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	* Nostoc sp. PCC 7120 Site: position = -52 score = 5.42815 sequence = CTGATTATGATAATCATTATCGG Gene: all3515: Putative outer membrane protein	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Putative outer membrane protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Zur - Cyanobacteria

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --