Regulog Zur - Cyanobacteria
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Cyanobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Cyanobacteria
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Synechococcus sp. PCC 7002 | 7 | 3 |
| Synechocystis sp. PCC 6803 | 5 | 3 |
| Cyanothece sp. ATCC 51142 | 27 | 17 |
| Cyanothece sp. PCC 8801 | 13 | 9 |
| Cyanothece sp. PCC 7425 | 9 | 5 |
| Microcystis aeruginosa NIES-843 | 10 | 5 |
| Nostoc sp. PCC 7120 | 22 | 8 |
| Trichodesmium erythraeum IMS101 | 9 | 6 |
| Synechococcus elongatus PCC 7942 | 7 | 3 |
| Prochlorococcus marinus str. MIT 9313 | 3 | 2 |
| Synechococcus sp. JA-3-3Ab | 4 | 1 |
| Synechococcus sp. WH 8102 | 4 | 3 |
| Gloeobacter violaceus PCC 7421 | 5 | 3 |
| Thermosynechococcus elongatus BP-1 | 4 | 3 |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| cce_1484 |
|
|
*
Cyanothece sp. ATCC 51142 Site: position = -40 score = 6.68012 sequence = ACTAGAATGATTATCATTATCAT Gene: cce_1484: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein |
*2
Cyanothece sp. PCC 8801 Site: position = -53 score = 4.90046 sequence = ACAATTATGAAAATCATTATGAG Gene: PCC8801_2483: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein Site: position = -40 score = 6.95963 sequence = ATTAGAATGATTATCATTATCAT Gene: PCC8801_0773: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein |
*
Cyanothece sp. PCC 7425 Site: position = -29 score = 5.20204 sequence = TTGAAAATGAGAATGGTTCTTAT Gene: Cyan7425_0822: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein |
Gene: MAE_31440: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein |
|
Gene: Tery_3218: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein |
*2
Synechococcus elongatus PCC 7942 Site: position = -59 score = 4.89761 sequence = TAGGGAATGATAACGATTCTCAA Gene: Synpcc7942_1316: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein Gene: Synpcc7942_2575: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein |
*
Prochlorococcus marinus str. MIT 9313 Site: position = -34 score = 5.95581 sequence = ATAAAAATGGGAATCATTCTCAT Gene: PMT2203: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein |
Gene: CYA_1680: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein |
*
Synechococcus sp. WH 8102 Site: position = 37 score = 6.32587 sequence = GTAAAAATGATAATCATTCTCAT Gene: SYNW0971: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein |
*2
Gloeobacter violaceus PCC 7421 Site: position = -6 score = 5.29863 sequence = TCTAGAATGAGAATCATTCTTGA Gene: glr1694: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein Gene: glr3311: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein |
|
Predicted Mn/Zn chelate ABC transporter, substrate-binding protein |
| cce_1485 |
|
|
*
Cyanothece sp. ATCC 51142 Site: position = -31 score = 6.68012 sequence = ATGATAATGATAATCATTCTAGT Gene: cce_1485: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein |
*2
Cyanothece sp. PCC 8801 Site: position = -32 score = 6.95963 sequence = ATGATAATGATAATCATTCTAAT Gene: PCC8801_0774: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Site: position = -84 score = 4.90046 sequence = CTCATAATGATTTTCATAATTGT Gene: PCC8801_2484: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein |
*
Cyanothece sp. PCC 7425 Site: position = -29 score = 5.27785 sequence = ATAAGAATTATTCTCATTTTCAC Gene: Cyan7425_0794: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein |
Gene: MAE_04690: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein |
|
Gene: Tery_3219: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein |
2
Synechococcus elongatus PCC 7942 Gene: Synpcc7942_1317: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Gene: Synpcc7942_2574: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein |
*
Prochlorococcus marinus str. MIT 9313 Site: position = -111 score = 5.95581 sequence = ATGAGAATGATTCCCATTTTTAT Gene: PMT2202: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein |
Gene: CYA_1679: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein |
*
Synechococcus sp. WH 8102 Site: position = -83 score = 6.32587 sequence = ATGAGAATGATTATCATTTTTAC Gene: SYNW0970: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein |
2
Gloeobacter violaceus PCC 7421 Gene: gll3310: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Gene: glr3312: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein |
|
Predicted Mn/Zn chelate ABC transporter, ATP-binding protein |
| cce_1486 |
|
|
Gene: cce_1486: Predicted Mn/Zn chelate ABC transporter, permease protein |
|
Gene: Cyan7425_4926: Predicted Mn/Zn chelate ABC transporter, permease protein |
Gene: MAE_08530: Predicted Mn/Zn chelate ABC transporter, permease protein |
|
*
Trichodesmium erythraeum IMS101 Site: position = -287 score = 5.24377 sequence = ATTATAATCATATTTATTATTAA Gene: Tery_3358: Predicted Mn/Zn chelate ABC transporter, permease protein |
2
Synechococcus elongatus PCC 7942 Gene: Synpcc7942_1318: Predicted Mn/Zn chelate ABC transporter, permease protein Gene: Synpcc7942_2573: Predicted Mn/Zn chelate ABC transporter, permease protein |
Gene: PMT2201: Predicted Mn/Zn chelate ABC transporter, permease protein |
Gene: CYA_1678: Predicted Mn/Zn chelate ABC transporter, permease protein |
Gene: SYNW0969: Predicted Mn/Zn chelate ABC transporter, permease protein |
*3
Gloeobacter violaceus PCC 7421 Site: position = -56 score = 5.29863 sequence = TCAAGAATGATTCTCATTCTAGA Gene: gll1693: Predicted Mn/Zn chelate ABC transporter, permease protein Gene: gll3309: Predicted Mn/Zn chelate ABC transporter, permease protein Gene: glr3313: Predicted Mn/Zn chelate ABC transporter, permease protein |
|
Predicted Mn/Zn chelate ABC transporter, permease protein |
| CRON 2. | |||||||||||||||
| hisI2 |
|
|
*
Cyanothece sp. ATCC 51142 Site: position = -37 score = 5.42518 sequence = ATGATAATGATTATCAAAATTGA Gene: cce_4845: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
|
|
|
|
*
Trichodesmium erythraeum IMS101 Site: position = -37 score = 4.80538 sequence = AGGATAATGATTATTAAAATTGA Gene: Tery_2490: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
|
|
|
|
|
|
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
| CRON 3. | |||||||||||||||
| ompZ |
|
*
Synechocystis sp. PCC 6803 Site: position = -118 score = 6.72536 sequence = ATGATAATGATTATCATTATTTA Gene: sll1550: Predicted zink uptake outer membrane protein |
|
|
Gene: Cyan7425_0823: Predicted zink uptake outer membrane protein |
*
Microcystis aeruginosa NIES-843 Site: position = -40 score = 5.52967 sequence = CTGAGAACAATAATCATTCTTGT Gene: MAE_10010: Predicted zink uptake outer membrane protein |
|
|
*4
Synechococcus elongatus PCC 7942 Site: position = -37 score = 6.10867 sequence = ATGAGAATAATAATCATTTTTAG Gene: Synpcc7942_1463: Predicted zink uptake outer membrane protein Gene: Synpcc7942_1464: Predicted zink uptake outer membrane protein Gene: Synpcc7942_1635: Predicted zink uptake outer membrane protein Gene: Synpcc7942_1607: Predicted zink uptake outer membrane protein |
|
Gene: CYA_1411: Predicted zink uptake outer membrane protein |
|
|
*
Thermosynechococcus elongatus BP-1 Site: position = -84 score = 6.16162 sequence = AGTAGAATGATAATCATTACAAT Gene: tlr1246: Predicted zink uptake outer membrane protein |
Predicted zink uptake outer membrane protein |
| CRON 4. | |||||||||||||||
| smtA |
Gene: SYNPCC7002_A2563: Predicted zinc-binding metallothionein |
|
Gene: cce_2496: Predicted zinc-binding metallothionein |
*
Cyanothece sp. PCC 8801 Site: position = -152 score = 5.74129 sequence = TCTAGAATGATAATCACTCTCAT Gene: PCC8801_0861: Predicted zinc-binding metallothionein |
|
|
|
|
Gene: Synpcc7942_1290: Predicted zinc-binding metallothionein |
|
|
*
Synechococcus sp. WH 8102 Site: position = -105 score = 6.17488 sequence = CCGATAATGATTATCATTCTTTT Site: position = -79 score = 5.49836 sequence = CCAATAATGAGAATTATTCTTAT Gene: SYNW0359: Predicted zinc-binding metallothionein |
Gene: gsl3430: Predicted zinc-binding metallothionein |
Gene: tsl1016: Predicted zinc-binding metallothionein |
Predicted zinc-binding metallothionein |
| CRON 5. | |||||||||||||||
| thrS2 |
|
|
*2
Cyanothece sp. ATCC 51142 Site: position = 28 score = 6.3225 sequence = ATGATAATGATTATTATTACAAT Gene: cce_4835: Threonyl-tRNA synthetase (EC 6.1.1.3) Site: position = 81 score = 6.71995 sequence = TTGATAATGATTATCATTTTTAT Site: position = 127 score = 6.94326 sequence = ATAATAATGATTATCATTTTTAT Gene: cce_1495: Threonyl-tRNA synthetase (EC 6.1.1.3) |
|
|
*
Microcystis aeruginosa NIES-843 Site: position = -34 score = 6.00144 sequence = GCTACAATGATAATCATTATCAT Gene: MAE_31590: Threonyl-tRNA synthetase (EC 6.1.1.3) |
*
Nostoc sp. PCC 7120 Site: position = -28 score = 5.87463 sequence = ATGATAACGATTCTCATTATTTA Gene: all4723: Threonyl-tRNA synthetase (EC 6.1.1.3) |
|
|
|
|
|
|
|
Threonyl-tRNA synthetase (EC 6.1.1.3) |
| yciC |
|
|
*4
Cyanothece sp. ATCC 51142 Site: position = -80 score = 6.3225 sequence = ATTGTAATAATAATCATTATCAT Site: position = -52 score = 5.30237 sequence = CGTAAATTGATAATCATTATCAA Gene: cce_4834: Putative zinc chaperone, COG0523 family Site: position = -46 score = 5.62245 sequence = TTAAGAACGATTATCGTTATAGT Gene: cce_4833: Putative zinc chaperone, COG0523 family Gene: cce_1500: Putative zinc chaperone, COG0523 family Gene: cce_3555: Putative zinc chaperone, COG0523 family |
Gene: PCC8801_0865: Putative zinc chaperone, COG0523 family |
Gene: Cyan7425_1081: Putative zinc chaperone, COG0523 family |
Gene: MAE_31600: Putative zinc chaperone, COG0523 family |
Gene: all4722: Putative zinc chaperone, COG0523 family |
*
Trichodesmium erythraeum IMS101 Site: position = -255 score = 5.17916 sequence = ATTATGATAATAATTATTGCAAT Gene: Tery_4617: Putative zinc chaperone, COG0523 family |
|
|
|
|
|
*
Thermosynechococcus elongatus BP-1 Site: position = -36 score = 5.71652 sequence = ATGAGAATGATTCTCTTTTTCTT Gene: tlr2276: Putative zinc chaperone, COG0523 family |
Putative zinc chaperone, COG0523 family |
| folE2 |
Gene: SYNPCC7002_G0128: GTP cyclohydrolase I (EC 3.5.4.16) |
|
*
Cyanothece sp. ATCC 51142 Site: position = -43 score = 5.41907 sequence = TTGAGAACGATTATCATTTTATC Gene: cce_1501: GTP cyclohydrolase I (EC 3.5.4.16) |
*
Cyanothece sp. PCC 8801 Site: position = -50 score = 5.89161 sequence = TTGAGAACGATTATCATTTTAAA Gene: PCC8801_0864: GTP cyclohydrolase I (EC 3.5.4.16) |
|
*
Microcystis aeruginosa NIES-843 Site: position = -323 score = 5.85518 sequence = ATGATAACGATTATCATTCTAGG Gene: MAE_22860: GTP cyclohydrolase I (EC 3.5.4.16) |
Gene: all4721: GTP cyclohydrolase I (EC 3.5.4.16) |
Gene: Tery_4616: GTP cyclohydrolase I (EC 3.5.4.16) |
|
|
|
|
|
|
GTP cyclohydrolase I (EC 3.5.4.16) |
| hemB2 |
*
Synechococcus sp. PCC 7002 Site: position = -25 score = 5.9318 sequence = TCGAGAATGATTATCATTTTTTA Gene: SYNPCC7002_G0127: Porphobilinogen synthase (EC 4.2.1.24) |
|
*2
Cyanothece sp. ATCC 51142 Site: position = -78 score = 7.11365 sequence = ATAATAATGATTATCATTATTAT Site: position = -32 score = 5.91941 sequence = ATAATAATGATTATCGTTTCTAA Gene: cce_1489: Porphobilinogen synthase (EC 4.2.1.24) Site: position = -72 score = 6.01902 sequence = TAAATAATAATAATCATTCTCGT Site: position = -46 score = 6.63211 sequence = ATAATAATGATTATCATTTTGAT Gene: cce_4852: Porphobilinogen synthase (EC 4.2.1.24) |
*
Cyanothece sp. PCC 8801 Site: position = -72 score = 5.50274 sequence = TTGATAATGATTATCATTCCGTG Site: position = -32 score = 6.68613 sequence = ATAATAATGATTATCATTTTTAA Gene: PCC8801_0777: Porphobilinogen synthase (EC 4.2.1.24) |
|
Gene: MAE_22850: Porphobilinogen synthase (EC 4.2.1.24) |
*
Nostoc sp. PCC 7120 Site: position = -31 score = 5.71889 sequence = ATGATAATGGTTATCAATCTTGT Gene: all4725: Porphobilinogen synthase (EC 4.2.1.24) |
Gene: Tery_4608: Porphobilinogen synthase (EC 4.2.1.24) |
|
Gene: PMT1547: Porphobilinogen synthase (EC 4.2.1.24) |
Gene: CYA_2762: Porphobilinogen synthase (EC 4.2.1.24) |
Gene: SYNW1933: Porphobilinogen synthase (EC 4.2.1.24) |
|
Gene: tll0422: Porphobilinogen synthase (EC 4.2.1.24) |
Porphobilinogen synthase (EC 4.2.1.24) |
| PF07992 |
*
Synechococcus sp. PCC 7002 Site: position = -70 score = 6.37965 sequence = TTGATAATAATTATCATTTTTAT Gene: SYNPCC7002_G0132: Predicted FAD-dependent oxidoreductase, PF07992 family |
|
*
Cyanothece sp. ATCC 51142 Site: position = -62 score = 6.37457 sequence = ATTAAAATGATAACCATTATTAT Site: position = -36 score = 6.12924 sequence = ATGAGAATGATTATCGTTAATTT Gene: cce_4863: Predicted FAD-dependent oxidoreductase, PF07992 family |
|
|
|
Gene: all4724: Predicted FAD-dependent oxidoreductase, PF07992 family |
*
Trichodesmium erythraeum IMS101 Site: position = -43 score = 6.51848 sequence = AAAAGAATGATAATCATTCTTAA Gene: Tery_4613: Predicted FAD-dependent oxidoreductase, PF07992 family |
|
|
|
|
|
|
Predicted FAD-dependent oxidoreductase, PF07992 family |
| CRON 6. | |||||||||||||||
| glr0533 |
|
|
|
|
|
|
|
|
|
|
|
|
*
Gloeobacter violaceus PCC 7421 Site: position = -40 score = 5.62945 sequence = TTGAGAACGACTATCATTGTTAT Gene: glr0533: Predicted metal transporter |
|
Predicted metal transporter |
| yciC2 |
Gene: SYNPCC7002_D0010: Putative zinc chaperone, COG0523 family |
|
*2
Cyanothece sp. ATCC 51142 Site: position = -77 score = 6.11985 sequence = TTGAGAATGATTATTATTCTTAA Site: position = -38 score = 6.16874 sequence = ATGAAAATGATTATCATTTTAGA Gene: cce_1488: Putative zinc chaperone, COG0523 family Site: position = -50 score = 5.77593 sequence = ATGAGATCAATTATCATTATCAT Gene: cce_4857: Putative zinc chaperone, COG0523 family |
*
Cyanothece sp. PCC 8801 Site: position = -76 score = 5.37298 sequence = TTGAGAATGATTCTTATTCTTGA Site: position = -38 score = 5.74129 sequence = ATGAGAGTGATTATCATTCTAGA Gene: PCC8801_0862: Putative zinc chaperone, COG0523 family |
*
Cyanothece sp. PCC 7425 Site: position = -41 score = 6.16639 sequence = TTGATAATGATTATCATTGTATA Gene: Cyan7425_1909: Putative zinc chaperone, COG0523 family |
|
*
Nostoc sp. PCC 7120 Site: position = -44 score = 5.01359 sequence = GTGATAATGATTATCCGTATGGT Gene: all1751: Putative zinc chaperone, COG0523 family |
|
|
|
|
Gene: SYNW2482: Putative zinc chaperone, COG0523 family |
Gene: glr0534: Putative zinc chaperone, COG0523 family |
|
Putative zinc chaperone, COG0523 family |
| COG2319 |
|
|
2
Cyanothece sp. ATCC 51142 Gene: cce_1487: WD-40 repeat-containing protein, COG2319 family Gene: cce_4858: WD-40 repeat-containing protein, COG2319 family |
Gene: PCC8801_0863: WD-40 repeat-containing protein, COG2319 family |
Gene: Cyan7425_1908: WD-40 repeat-containing protein, COG2319 family |
|
Gene: all1750: WD-40 repeat-containing protein, COG2319 family |
|
|
|
|
Gene: SYNW2483: WD-40 repeat-containing protein, COG2319 family |
Gene: glr0535: WD-40 repeat-containing protein, COG2319 family |
|
WD-40 repeat-containing protein, COG2319 family |
| CRON 7. | |||||||||||||||
| znuA |
*
Synechococcus sp. PCC 7002 Site: position = -39 score = 5.54711 sequence = ATAAGAACGATTATCATTTCAAG Gene: SYNPCC7002_A2501: Zinc ABC transporter, substrate-binding protein |
*
Synechocystis sp. PCC 6803 Site: position = -84 score = 5.6038 sequence = ATGATAATGATTATCGTTTATTG Gene: slr2043: Zinc ABC transporter, substrate-binding protein |
*2
Cyanothece sp. ATCC 51142 Site: position = -72 score = 6.12924 sequence = AAATTAACGATAATCATTCTCAT Site: position = -46 score = 6.37457 sequence = ATAATAATGGTTATCATTTTAAT Gene: cce_4862: Zinc ABC transporter, substrate-binding protein Site: position = -79 score = 5.59416 sequence = TTAATAGTGATAATGATTCTTAT Gene: cce_2961: Zinc ABC transporter, substrate-binding protein |
*
Cyanothece sp. PCC 8801 Site: position = -52 score = 5.29102 sequence = GATACAATGATAATCGTTATCAG Gene: PCC8801_3888: Zinc ABC transporter, substrate-binding protein |
Gene: Cyan7425_1915: Zinc ABC transporter, substrate-binding protein |
*
Microcystis aeruginosa NIES-843 Site: position = -67 score = 4.79342 sequence = TTCAGAATGATAACGATTCTCAC Gene: MAE_20780: Zinc ABC transporter, substrate-binding pro |
*
Nostoc sp. PCC 7120 Site: position = -110 score = 6.15196 sequence = ATGAGAATGAGAATTATTATAAT Site: position = -80 score = 5.04367 sequence = TGTACAATAAGTATCATTGTCAA Gene: all0833: Zinc ABC transporter, substrate-binding protein |
*
Trichodesmium erythraeum IMS101 Site: position = -49 score = 6.89596 sequence = AAAAGAATGATAATCATTATCAT Gene: Tery_4951: Zinc ABC transporter, substrate-binding protein |
*
Synechococcus elongatus PCC 7942 Site: position = -84 score = 5.6038 sequence = ATGATAATGATTATCGTTTATTG Gene: slr2043: Zinc ABC transporter, substrate-binding protein |
|
Gene: CYA_2532: Zinc ABC transporter, substrate-binding protein |
Gene: SYNW2481: Zinc ABC transporter, substrate-binding protein |
|
*
Thermosynechococcus elongatus BP-1 Site: position = -31 score = 6.31155 sequence = ATGAGAATGATTATCATTCATCT Gene: tlr2062: Zinc ABC transporter, substrate-binding protein |
Zinc ABC transporter, substrate-binding protein |
| znuB |
Gene: SYNPCC7002_A2500: Zinc ABC transporter, ATP-binding protein |
Gene: slr2044: Zinc ABC transporter, ATP-binding protein |
2
Cyanothece sp. ATCC 51142 Gene: cce_4861: Zinc ABC transporter, ATP-binding protein Gene: cce_2962: Zinc ABC transporter, ATP-binding protein |
Gene: PCC8801_3889: Zinc ABC transporter, ATP-binding protein |
Gene: Cyan7425_1914: Zinc ABC transporter, ATP-binding protein |
Gene: MAE_20770: Zinc ABC transporter, ATP-binding protein |
Gene: all0832: Zinc ABC transporter, ATP-binding protein |
Gene: Tery_4952: Zinc ABC transporter, ATP-binding protein |
Gene: slr2044: Zinc ABC transporter, ATP-binding protein |
|
Gene: CYA_2531: Zinc ABC transporter, ATP-binding protein |
Gene: SYNW2480: Zinc ABC transporter, ATP-binding protein |
|
Gene: tlr2063: Zinc ABC transporter, ATP-binding protein |
Zinc ABC transporter, ATP-binding protein |
| znuC |
Gene: SYNPCC7002_A2499: Zinc ABC transporter, permease protein |
Gene: slr2045: Zinc ABC transporter, permease protein |
2
Cyanothece sp. ATCC 51142 Gene: cce_4860: Zinc ABC transporter, permease protein Gene: cce_2963: Zinc ABC transporter, permease protein |
Gene: PCC8801_3890: Zinc ABC transporter, permease protein |
Gene: Cyan7425_1913: Zinc ABC transporter, permease protein |
Gene: MAE_52810: Zinc ABC transporter, permease protein |
Gene: all0830: Zinc ABC transporter, permease protein |
Gene: Tery_4953: Zinc ABC transporter, permease protein |
Gene: slr2045: Zinc ABC transporter, permease protein |
|
Gene: CYA_2529: Zinc ABC transporter, permease protein |
Gene: SYNW2479: Zinc ABC transporter, permease protein |
|
Gene: tlr0501: Zinc ABC transporter, permease protein |
Zinc ABC transporter, permease protein |
| zur |
Gene: SYNPCC7002_A2498: Zinc uptake transcription regulator, Fur family |
*
Synechocystis sp. PCC 6803 Site: position = -45 score = 5.6038 sequence = CAATAAACGATAATCATTATCAT Gene: sll1937: Zinc uptake transcription regulator, Fur family |
*
Cyanothece sp. ATCC 51142 Site: position = -120 score = 6.04887 sequence = ATAATAATGATTATTATTCTACA Gene: cce_4859: Zinc uptake transcription regulator, Fur family |
Gene: PCC8801_4134: Zinc uptake transcription regulator, Fur family |
*
Cyanothece sp. PCC 7425 Site: position = -56 score = 6.43243 sequence = ATGATAATGATTATCATTGCCTT Gene: Cyan7425_1917: Zinc uptake transcription regulator, Fur family |
Gene: MAE_57540: Zinc uptake transcription regulator, Fur family |
Gene: all2473: Zinc uptake transcription regulator, Fur family |
Gene: Tery_1953: Zinc uptake transcription regulator, Fur family |
Gene: Synpcc7942_0817: Zinc uptake transcription regulator, Fur family |
Gene: PMT2208: Zinc uptake transcription regulator, Fur family |
Gene: CYA_1383: Zinc uptake transcription regulator, Fur family |
Gene: SYNW2401: Zinc uptake transcription regulator, Fur family |
Gene: glr0783: Zinc uptake transcription regulator, Fur family |
Gene: tlr0192: Zinc uptake transcription regulator, Fur family |
Zinc uptake transcription regulator, Fur family |
| Cyan7425_1916 |
|
|
|
|
*
Cyanothece sp. PCC 7425 Site: position = -104 score = 6.43243 sequence = AAGGCAATGATAATCATTATCAT Gene: Cyan7425_1916: Hypothetical protein |
|
|
|
|
|
|
|
|
|
Hypothetical protein |
| sufE |
|
|
|
|
|
|
|
|
|
|
*
Synechococcus sp. JA-3-3Ab Site: position = -39 score = 5.73875 sequence = TTATGATTGATTATCATTCTCAT Gene: CYA_2533: Cysteine desulfuration protein |
|
|
|
Cysteine desulfuration protein |
| CRON 8. | |||||||||||||||
| alr3242 |
|
|
|
|
|
|
*
Nostoc sp. PCC 7120 Site: position = -260 score = 4.28993 sequence = ATGATAATCATTATCAAAAAATG Site: position = -266 score = 5.56479 sequence = GTAAACATGATAATCATTATCAA Gene: alr3242: Zinc-regulated TonB-dependent outer mambrane receptor |
|
|
|
|
|
|
|
Zinc-regulated TonB-dependent outer mambrane receptor |
| alr3243 |
|
|
|
|
|
|
Gene: alr3243: ABC transporter, periplasmic binding protein, COG0614 family |
|
|
|
|
|
|
|
ABC transporter, periplasmic binding protein, COG0614 family |
| CRON 9. | |||||||||||||||
| alr1197 |
|
|
*
Cyanothece sp. ATCC 51142 Site: position = -6 score = 4.69003 sequence = CTAACAATGATTACTGTAATTAT Gene: cce_1494: Putative metallochaperone, similar to COG0523 family |
|
|
*
Microcystis aeruginosa NIES-843 Site: position = -6 score = 5.55075 sequence = GCTAGAATGATTATCATTATCAC Gene: MAE_31630: Putative metallochaperone, similar to COG0523 family |
*
Nostoc sp. PCC 7120 Site: position = -29 score = 4.43984 sequence = AACTGCATGAAAATGATTATCAT Site: position = -23 score = 6.06488 sequence = ATGAAAATGATTATCATTTAAAA Gene: alr1197: Putative metallochaperone, similar to COG0523 family |
|
|
|
|
|
|
|
Putative metallochaperone, similar to COG0523 family |
| alr1198 |
|
|
Gene: cce_1493: Metallophosphoesterase, COG0622 family |
|
|
Gene: MAE_31640: Metallophosphoesterase, COG0622 family |
Gene: alr1198: Metallophosphoesterase, COG0622 family |
|
|
|
|
|
|
|
Metallophosphoesterase, COG0622 family |
| alr1199 |
|
|
Gene: cce_1492: Metal-dependent phosphatase |
|
|
Gene: MAE_31650: Metal-dependent phosphatase |
Gene: alr1199: Metal-dependent phosphatase |
*
Trichodesmium erythraeum IMS101 Site: position = -84 score = 4.30461 sequence = TTTGAAACAAGTATTATTGTTTT Gene: Tery_4609: Metal-dependent phosphatase |
|
|
|
|
|
|
Metal-dependent phosphatase |
| CRON 10. | |||||||||||||||
| omp |
|
|
|
|
|
|
*2
Nostoc sp. PCC 7120 Site: position = -122 score = 5.8542 sequence = GTGATAATAATAATCATTATCTA Gene: alr4028: Zinc-regulated TonB-dependent outer mambrane receptor Gene: alr4029: Zinc-regulated TonB-dependent outer mambrane receptor |
|
|
|
|
|
|
|
Zinc-regulated TonB-dependent outer mambrane receptor |
| alr4030 |
|
|
|
|
|
|
Gene: alr4030: Putative ferredoxin, COG3411 family |
|
|
|
|
|
|
|
Putative ferredoxin, COG3411 family |
| alr4031 |
|
|
|
|
|
|
Gene: alr4031: ABC transporter, periplasmic binding protein, COG0614 family |
|
|
|
|
|
|
|
ABC transporter, periplasmic binding protein, COG0614 family |
| alr4032 |
|
|
|
|
|
|
Gene: alr4032: ABC transporter, permease protein |
|
|
|
|
|
|
|
ABC transporter, permease protein |
| alr4033 |
|
|
|
|
|
|
Gene: alr4033: ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
ABC transporter, ATP-binding protein |
| CRON 11. | |||||||||||||||
| all3515 |
|
|
|
|
|
|
*
Nostoc sp. PCC 7120 Site: position = -52 score = 5.42815 sequence = CTGATTATGATAATCATTATCGG Gene: all3515: Putative outer membrane protein |
|
|
|
|
|
|
|
Putative outer membrane protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |