Orthologous regulated operons containing cce_1484 gene

Properties
Regulog:	Zur - Cyanobacteria
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Cyanobacteria

Built upon 84 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cyanothece sp. ATCC 51142
Position: -40 Score: 6.68012 Sequence: ACTAGAATGATTATCATTATCAT Locus tag: cce_1484 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
cce_1484	-40	6.7	ACTAGAATGATTATCATTATCAT	cce_1484
Cyanothece sp. PCC 7425
Position: -29 Score: 5.20204 Sequence: TTGAAAATGAGAATGGTTCTTAT Locus tag: Cyan7425_0822 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
cce_1484	-29	5.2	TTGAAAATGAGAATGGTTCTTAT	Cyan7425_0822
Cyanothece sp. PCC 8801
Position: -53 Score: 4.90046 Sequence: ACAATTATGAAAATCATTATGAG Locus tag: PCC8801_2483 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
cce_1484	-53	4.9	ACAATTATGAAAATCATTATGAG	PCC8801_2483
Gloeobacter violaceus PCC 7421
Position: -6 Score: 5.29863 Sequence: TCTAGAATGAGAATCATTCTTGA Locus tag: glr1694 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
cce_1484	-6	5.3	TCTAGAATGAGAATCATTCTTGA	glr1694
Prochlorococcus marinus str. MIT 9313
Position: -34 Score: 5.95581 Sequence: ATAAAAATGGGAATCATTCTCAT Locus tag: PMT2203 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
cce_1484	-34	6	ATAAAAATGGGAATCATTCTCAT	PMT2203
Synechococcus elongatus PCC 7942
Position: -59 Score: 4.89761 Sequence: TAGGGAATGATAACGATTCTCAA Locus tag: Synpcc7942_1316 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein Locus tag: Synpcc7942_1317 Name: cce_1485 Funciton: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Locus tag: Synpcc7942_1318 Name: cce_1486 Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
cce_1484-cce_1485-cce_1486	-59	4.9	TAGGGAATGATAACGATTCTCAA	Synpcc7942_1316
Synechococcus sp. WH 8102
Position: 37 Score: 6.32587 Sequence: GTAAAAATGATAATCATTCTCAT Locus tag: SYNW0971 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
cce_1484	37	6.3	GTAAAAATGATAATCATTCTCAT	SYNW0971

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing cce_1484 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --