Regulon of Zur in Synechococcus sp. WH 8102

Properties
Regulator type:	Transcription factor
TF locus tag:	SYNW2401
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Cyanobacteria
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 6.3 Sequence: ATGAGAATGATTATCATTTTTAC Locus tag: SYNW0970 Name: cce_1485 Funciton: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Locus tag: SYNW0969 Name: cce_1486 Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
	SYNW0970	cce_1485	Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
	SYNW0969	cce_1486	Predicted Mn/Zn chelate ABC transporter, permease protein
Position: 37 Score: 6.3 Sequence: GTAAAAATGATAATCATTCTCAT Locus tag: SYNW0971 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
	SYNW0971	cce_1484	Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
Position: -105 Score: 6.2 Sequence: CCGATAATGATTATCATTCTTTT Position: -79 Score: 5.5 Sequence: CCAATAATGAGAATTATTCTTAT Locus tag: SYNW0359 Name: smtA Funciton: Predicted zinc-binding metallothionein
	SYNW0359	smtA	Predicted zinc-binding metallothionein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD