Orthologous regulated operons containing znuA gene

Properties
Regulog:	Zur - Cyanobacteria
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Cyanobacteria

Built upon 84 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cyanothece sp. ATCC 51142
Position: -72 Score: 6.12924 Sequence: AAATTAACGATAATCATTCTCAT Position: -46 Score: 6.37457 Sequence: ATAATAATGGTTATCATTTTAAT Locus tag: cce_4862 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: cce_4861 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: cce_4860 Name: znuC Funciton: Zinc ABC transporter, permease protein
znuA-znuB-znuC	-72	6.1	AAATTAACGATAATCATTCTCAT	cce_4862
	-46	6.4	ATAATAATGGTTATCATTTTAAT
Cyanothece sp. PCC 7425
Position: -104 Score: 6.43243 Sequence: AAGGCAATGATAATCATTATCAT Locus tag: Cyan7425_1916 Name: Cyan7425_1916 Funciton: Hypothetical protein Locus tag: Cyan7425_1915 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: Cyan7425_1914 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: Cyan7425_1913 Name: znuC Funciton: Zinc ABC transporter, permease protein
Cyan7425_1916-znuA-znuB-znuC	-104	6.4	AAGGCAATGATAATCATTATCAT	Cyan7425_1916
Cyanothece sp. PCC 8801
Position: -52 Score: 5.29102 Sequence: GATACAATGATAATCGTTATCAG Locus tag: PCC8801_3888 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: PCC8801_3889 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: PCC8801_3890 Name: znuC Funciton: Zinc ABC transporter, permease protein
znuA-znuB-znuC	-52	5.3	GATACAATGATAATCGTTATCAG	PCC8801_3888
Microcystis aeruginosa NIES-843
Position: -67 Score: 4.79342 Sequence: TTCAGAATGATAACGATTCTCAC Locus tag: MAE_20780 Name: znuA Funciton: Zinc ABC transporter, substrate-binding pro Locus tag: MAE_20770 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein
znuA-znuB	-67	4.8	TTCAGAATGATAACGATTCTCAC	MAE_20780
Nostoc sp. PCC 7120
Position: -110 Score: 6.15196 Sequence: ATGAGAATGAGAATTATTATAAT Position: -80 Score: 5.04367 Sequence: TGTACAATAAGTATCATTGTCAA Locus tag: all0833 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: all0832 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: all0830 Name: znuC Funciton: Zinc ABC transporter, permease protein
znuA-znuB-znuC	-110	6.2	ATGAGAATGAGAATTATTATAAT	all0833
	-80	5	TGTACAATAAGTATCATTGTCAA
Synechococcus elongatus PCC 7942
Position: -84 Score: 5.6038 Sequence: ATGATAATGATTATCGTTTATTG Locus tag: slr2043 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: slr2044 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: slr2045 Name: znuC Funciton: Zinc ABC transporter, permease protein
znuA-znuB-znuC	-84	5.6	ATGATAATGATTATCGTTTATTG	slr2043
Synechococcus sp. JA-3-3Ab
Position: -39 Score: 5.73875 Sequence: TTATGATTGATTATCATTCTCAT Locus tag: CYA_2533 Name: sufE Funciton: Cysteine desulfuration protein Locus tag: CYA_2532 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: CYA_2531 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: CYA_2529 Name: znuC Funciton: Zinc ABC transporter, permease protein
sufE-znuA-znuB-znuC	-39	5.7	TTATGATTGATTATCATTCTCAT	CYA_2533
Synechococcus sp. PCC 7002
Position: -39 Score: 5.54711 Sequence: ATAAGAACGATTATCATTTCAAG Locus tag: SYNPCC7002_A2501 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: SYNPCC7002_A2500 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: SYNPCC7002_A2499 Name: znuC Funciton: Zinc ABC transporter, permease protein Locus tag: SYNPCC7002_A2498 Name: zur Funciton: Zinc uptake transcription regulator, Fur family
znuA-znuB-znuC-zur	-39	5.5	ATAAGAACGATTATCATTTCAAG	SYNPCC7002_A2501
Synechocystis sp. PCC 6803
Position: -84 Score: 5.6038 Sequence: ATGATAATGATTATCGTTTATTG Locus tag: slr2043 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: slr2044 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: slr2045 Name: znuC Funciton: Zinc ABC transporter, permease protein
znuA-znuB-znuC	-84	5.6	ATGATAATGATTATCGTTTATTG	slr2043
Thermosynechococcus elongatus BP-1
Position: -31 Score: 6.31155 Sequence: ATGAGAATGATTATCATTCATCT Locus tag: tlr2062 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: tlr2063 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein
znuA-znuB	-31	6.3	ATGAGAATGATTATCATTCATCT	tlr2062
Trichodesmium erythraeum IMS101
Position: -49 Score: 6.89596 Sequence: AAAAGAATGATAATCATTATCAT Locus tag: Tery_4951 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: Tery_4952 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: Tery_4953 Name: znuC Funciton: Zinc ABC transporter, permease protein
znuA-znuB-znuC	-49	6.9	AAAAGAATGATAATCATTATCAT	Tery_4951

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing znuA gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --