Regulon of Zur in Synechococcus sp. PCC 7002

Properties
Regulator type:	Transcription factor
TF locus tag:	SYNPCC7002_A2498
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Cyanobacteria
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -25 Score: 5.9 Sequence: TCGAGAATGATTATCATTTTTTA Locus tag: SYNPCC7002_G0127 Name: hemB2 Funciton: Porphobilinogen synthase (EC 4.2.1.24) Locus tag: SYNPCC7002_G0128 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16)
	SYNPCC7002_G0127	hemB2	Porphobilinogen synthase (EC 4.2.1.24)
	SYNPCC7002_G0128	folE2	GTP cyclohydrolase I (EC 3.5.4.16)
Position: -70 Score: 6.4 Sequence: TTGATAATAATTATCATTTTTAT Locus tag: SYNPCC7002_G0132 Name: PF07992 Funciton: Predicted FAD-dependent oxidoreductase, PF07992 family
	SYNPCC7002_G0132	PF07992	Predicted FAD-dependent oxidoreductase, PF07992 family
Position: -39 Score: 5.5 Sequence: ATAAGAACGATTATCATTTCAAG Locus tag: SYNPCC7002_A2501 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: SYNPCC7002_A2500 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: SYNPCC7002_A2499 Name: znuC Funciton: Zinc ABC transporter, permease protein Locus tag: SYNPCC7002_A2498 Name: zur Funciton: Zinc uptake transcription regulator, Fur family
	SYNPCC7002_A2501	znuA	Zinc ABC transporter, substrate-binding protein
	SYNPCC7002_A2500	znuB	Zinc ABC transporter, ATP-binding protein
	SYNPCC7002_A2499	znuC	Zinc ABC transporter, permease protein
	SYNPCC7002_A2498	zur	Zinc uptake transcription regulator, Fur family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD