Regulon of Zur in Thermosynechococcus elongatus BP-1

Properties
Regulator type:	Transcription factor
TF locus tag:	tlr0192
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Cyanobacteria
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 6.2 Sequence: AGTAGAATGATAATCATTACAAT Locus tag: tlr1246 Name: ompZ Funciton: Predicted zink uptake outer membrane protein
	tlr1246	ompZ	Predicted zink uptake outer membrane protein
Position: -36 Score: 5.7 Sequence: ATGAGAATGATTCTCTTTTTCTT Locus tag: tlr2276 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	tlr2276	yciC	Putative zinc chaperone, COG0523 family
Position: -31 Score: 6.3 Sequence: ATGAGAATGATTATCATTCATCT Locus tag: tlr2062 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: tlr2063 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein
	tlr2062	znuA	Zinc ABC transporter, substrate-binding protein
	tlr2063	znuB	Zinc ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD