Regulon of Zur in Nostoc sp. PCC 7120

Properties
Regulator type:	Transcription factor
TF locus tag:	all2473
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Cyanobacteria
Statistics of regulated genes:
- Genes	22
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -28 Score: 5.9 Sequence: ATGATAACGATTCTCATTATTTA Locus tag: all4723 Name: thrS2 Funciton: Threonyl-tRNA synthetase (EC 6.1.1.3) Locus tag: all4722 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: all4721 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16)
	all4723	thrS2	Threonyl-tRNA synthetase (EC 6.1.1.3)
	all4722	yciC	Putative zinc chaperone, COG0523 family
	all4721	folE2	GTP cyclohydrolase I (EC 3.5.4.16)
Position: -31 Score: 5.7 Sequence: ATGATAATGGTTATCAATCTTGT Locus tag: all4725 Name: hemB2 Funciton: Porphobilinogen synthase (EC 4.2.1.24) Locus tag: all4724 Name: PF07992 Funciton: Predicted FAD-dependent oxidoreductase, PF07992 family
	all4725	hemB2	Porphobilinogen synthase (EC 4.2.1.24)
	all4724	PF07992	Predicted FAD-dependent oxidoreductase, PF07992 family
Position: -44 Score: 5 Sequence: GTGATAATGATTATCCGTATGGT Locus tag: all1751 Name: yciC2 Funciton: Putative zinc chaperone, COG0523 family Locus tag: all1750 Name: COG2319 Funciton: WD-40 repeat-containing protein, COG2319 family
	all1751	yciC2	Putative zinc chaperone, COG0523 family
	all1750	COG2319	WD-40 repeat-containing protein, COG2319 family
Position: -110 Score: 6.2 Sequence: ATGAGAATGAGAATTATTATAAT Position: -80 Score: 5 Sequence: TGTACAATAAGTATCATTGTCAA Locus tag: all0833 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: all0832 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: all0830 Name: znuC Funciton: Zinc ABC transporter, permease protein
	all0833	znuA	Zinc ABC transporter, substrate-binding protein
	all0832	znuB	Zinc ABC transporter, ATP-binding protein
	all0830	znuC	Zinc ABC transporter, permease protein
Position: -29 Score: 4.4 Sequence: AACTGCATGAAAATGATTATCAT Position: -23 Score: 6.1 Sequence: ATGAAAATGATTATCATTTAAAA Locus tag: alr1197 Name: alr1197 Funciton: Putative metallochaperone, similar to COG0523 family Locus tag: alr1198 Name: alr1198 Funciton: Metallophosphoesterase, COG0622 family Locus tag: alr1199 Name: alr1199 Funciton: Metal-dependent phosphatase
	alr1197	alr1197	Putative metallochaperone, similar to COG0523 family
	alr1198	alr1198	Metallophosphoesterase, COG0622 family
	alr1199	alr1199	Metal-dependent phosphatase
Position: -266 Score: 5.6 Sequence: GTAAACATGATAATCATTATCAA Position: -260 Score: 4.3 Sequence: ATGATAATCATTATCAAAAAATG Locus tag: alr3242 Name: alr3242 Funciton: Zinc-regulated TonB-dependent outer mambrane receptor Locus tag: alr3243 Name: alr3243 Funciton: ABC transporter, periplasmic binding protein, COG0614 family
	alr3242	alr3242	Zinc-regulated TonB-dependent outer mambrane receptor
	alr3243	alr3243	ABC transporter, periplasmic binding protein, COG0614 family
Position: -122 Score: 5.9 Sequence: GTGATAATAATAATCATTATCTA Locus tag: alr4028 Name: omp Funciton: Zinc-regulated TonB-dependent outer mambrane receptor Locus tag: alr4029 Name: omp Funciton: Zinc-regulated TonB-dependent outer mambrane receptor Locus tag: alr4030 Name: alr4030 Funciton: Putative ferredoxin, COG3411 family Locus tag: alr4031 Name: alr4031 Funciton: ABC transporter, periplasmic binding protein, COG0614 family Locus tag: alr4032 Name: alr4032 Funciton: ABC transporter, permease protein Locus tag: alr4033 Name: alr4033 Funciton: ABC transporter, ATP-binding protein
	alr4028	omp	Zinc-regulated TonB-dependent outer mambrane receptor
	alr4029	omp	Zinc-regulated TonB-dependent outer mambrane receptor
	alr4030	alr4030	Putative ferredoxin, COG3411 family
	alr4031	alr4031	ABC transporter, periplasmic binding protein, COG0614 family
	alr4032	alr4032	ABC transporter, permease protein
	alr4033	alr4033	ABC transporter, ATP-binding protein
Position: -52 Score: 5.4 Sequence: CTGATTATGATAATCATTATCGG Locus tag: all3515 Name: all3515 Funciton: Putative outer membrane protein
	all3515	all3515	Putative outer membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Nostoc sp. PCC 7120

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --